CN111235264A

CN111235264A - Composition, kit and method for detecting polymorphism of human TPMT gene and NUDT15 gene

Info

Publication number: CN111235264A
Application number: CN202010105523.8A
Authority: CN
Inventors: 龙凤英; 吴康; 缪为民; 戴立忠
Original assignee: Sansure Biotech Inc
Current assignee: Shengxiang Shanghai Gene Technology Co ltd
Priority date: 2020-02-20
Filing date: 2020-02-20
Publication date: 2020-06-05
Anticipated expiration: 2040-02-20
Also published as: CN111235264B

Abstract

The invention relates to the field of molecular biological detection, in particular to the field of polymorphism detection of human TPMT gene and NUDT15 gene. A composition is provided which detects polymorphisms in the human TPMT gene and the NUDT15 gene; meanwhile, the composition is used for detecting the polymorphism of the human TPMT gene and the NUDT15 gene, a kit containing the composition and a method for detecting the polymorphism of the human TPMT gene and the NUDT15 gene, and by using the composition and the method, 3 SNP sites of TPMT and one detection site of NUDT15 are detected, so that the mercaptopurine medicine detection capability is more comprehensive, the sensitivity is high, and the detection is rapid.

Description

Composition, kit and method for detecting polymorphism of human TPMT gene and NUDT15 gene

Technical Field

The invention belongs to the field of molecular biological detection, and more particularly belongs to the field of polymorphism detection of human TPMT genes and NUDT15 genes.

Background

Mercaptopurine drugs such as 6-mercaptopurine (6-MP), 6-thioguanine (6-TG) and Azathioprine (AZP) are antimetabolites with immunosuppressive effects. 6-TG and 6-MP are commonly used in chemotherapy of malignant tumors, and AZP is mainly used for patients with autoimmune diseases and organ transplantation. Thiopurine methyltransferase (TPMT) activity exhibits monogenic inheritance and catabolism of thiopurines. TPMT allelic variation is associated with low enzymatic activity and significant pharmacological effects of thiopurines. Alleles of the NUDT15 gene that cause loss of function are common in asian and hispanic and reduce the degradation of active thiopurine nucleotide metabolites. The CPIC guidelines in 2018 recommend adjusting the dose of mercaptopurine based on TPMT and NUDT15 genotypes.

Mercaptopurine methyltransferase (TPMT) is a cytosolic enzyme that catalyzes the thiomethylation of mercaptopurine drugs such as 6-mercaptopurine (6-mercapture, 6-MP). In vivo, 6-MP is metabolized to thioguanine nucleotide (6-TGN) and incorporated into DNA to exert a cytotoxic effect, but inactive metabolites are produced by TPMT methylation. TPMT activity is related to the curative effect and toxic reaction of 6-MP, the genetic polymorphism of TPMT is related to the curative effect and toxicity of purine drugs, the activity of human TPMT is in tri-state distribution, and about 90 percent of individuals are TPMT wild type high enzyme activity; 10% of individuals were TPMT heterozygous variants exhibiting moderate enzyme activity; 0.3% of individuals are homozygous variations of TPMT, resulting in low or no activity of TPMT. TPMT heterozygote variant can tolerate 65% of 6-MP standard dose, and homozygous variant can only tolerate 5% -10% of standard dose. More than 20 mutations in the TPMT genes have been found, of which TPMT2, TPMT 3 are the most common and account for more than 90% of individuals with moderate and low enzymatic activity. Patients with high activity are easy to have tolerance after taking the thiopurine medicine for a long time, and the recurrence rate is possibly increased; patients with low activity, even with routine doses of thiopurines, are at increased risk of developing serious hematologic adverse events, and may even die. FDA has approved the drug instruction of 6-mercaptopurine, 6-thioguanine and azathioprine to increase the suggestion of TPMT gene polymorphism detection before drug administration.

The nucleoside diphosphate linker moiety X-type domain gene 15(NUDT15) gene encodes a hydrolase that dephosphorylates the active metabolites of azathioprine, 6-TGTP and 6-TGDP, to reduce toxicity, and is a negative regulator of thioprine activation and toxicity. Mutations in the NUDT15 gene result in hypometabolism of thiopurines and are associated with thiopurine-induced early leukopenia. Although there is currently no multi-ethnic study available to test these two TPMT and NUDT15 variants, in fact TPMT is largely similar to the degree of thiopurine tolerance (e.g., mercaptopurine) in carriers with reduced function of NUDT15 activity. Therefore, CPIC suggests a polymorphism detection for NUDT15 similar to TPMT. For normal metabolisms of NUDT15 (NUDT15 x 1/' 1), no initial dose changes were required. For the intermediate metabolites of NUDT15 (NUDT15 x 1/x 3), a reduction in the initial dose should be considered to minimize toxicity, and for the poor metabolites of NUDT15 (NUDT15 x 3/x 3) a reduction in the dose of the drug used is a large or alternative drug considered.

Currently, there are some products that can detect gene polymorphisms of both. For example, the Chinese invention publication CN109486932A discloses that at least one of rs1142345 site of TPMT gene and rs116855232 site of NUDT15 gene can be detected; the Chinese invention publication CN107574239A also mentions that detection of mercaptopurine drug SNP requires detection of rs1142345 site of TPMT gene and rs116855232 site of NUDT15 gene. However, as the SNP site corresponding to TPMT is not only one, the CPIC guideline recommends the detection of four polymorphic sites of TPMT gene and NUDT15 gene, and therefore, both of the SNP sites and the SNP sites have the defects of inaccuracy and incomprehension in the detection of the metabolic capability of mercaptopurine drugs.

Therefore, there is a need in the art for a product that is capable of more fully detecting the metabolic capacity of mercaptopurine drugs to meet CPIC guidelines recommendations, and that has high sensitivity and rapid detection.

Disclosure of Invention

In view of the above, in a first aspect, the present invention provides a composition capable of detecting polymorphisms of the human TPMT gene and the NUDT15 gene, the composition comprising:

1) the upstream primer of the TPMT gene 238 shown as SEQ ID NO. 1, the downstream primer of the TPMT gene 238 shown as SEQ ID NO. 2, the probe of the TPMT gene 238 shown as SEQ ID NO. 3 and the probe of the TPMT gene 238 shown as SEQ ID NO. 4;

2) TPMT gene 460 upstream primer shown as SEQ ID NO. 5, TPMT gene 460 downstream primer shown as SEQ ID NO. 6 and TPMT gene 460 probe shown as SEQ ID NO. 7 and SEQ ID NO. 8;

3) an upstream primer of the TPMT gene 719 shown as SEQ ID NO. 9, a downstream primer of the TPMT gene 719 shown as SEQ ID NO. 10 and probes of the TPMT gene 719 shown as SEQ ID NO. 11 and SEQ ID NO. 12;

4) an upstream primer of the NUDT15 gene 415 shown as SEQ ID NO. 13, a downstream primer of the NUDT15 gene 415 shown as SEQ ID NO. 14 and a probe of the NUDT15 gene 415 shown as SEQ ID NO. 15 and SEQ ID NO. 16;

wherein 1) to 4) are present in any pairwise combination;

wherein the fluorescent reporter groups of the 4 probes in one group are different from each other, and the fluorescent reporter groups of the 4 probes in the other group are different from each other.

In one embodiment, 1) and 2) are one group; 3) and 4) as another group.

In one embodiment, 1) and 3) are one group; 2) and 4) as another group.

In one embodiment, 1) and 4) are one group; 2) and 3) as another group.

The composition can detect the polymorphism of human TPMT gene and NUDT15 gene, especially detect the polymorphism of TPMT gene rs1800462(238G > C), rs1800460(460G > A), rs1142345(719A > G) and NUDT15 gene rs116855232 (415C > T), and expand the range of detecting the polymorphism of the two genes in the prior art, so that the detection of the mercaptopurine drug metabolism is more comprehensive and accurate, the sensitivity is high, and the nucleic acid sample with the concentration as low as 1 ng/muL can be detected. The use of the composition of the present invention enables the simultaneous use of a whole blood sample and a buccal swab sample. The invention designs the primers and the probes based on the fluorescent probe method, adopts 4 different probes, realizes that one tube of reagent can simultaneously detect two SNP sites, realizes the detection of the whole 4 SNPs by using two tubes of reagent, ensures that the operation of the whole process is extremely simple, and can judge the result reading process through an amplification curve and a CT value. The composition has high detection accuracy, each probe adopts different fluorescent reporter groups, and the mutual interference superposition between background signals is avoided; however, in the prior art such as the melting curve method, only one fluorescent reporter group is used for a plurality of probes, so that the mutual interference and superposition among background signals increase the background value, and the accuracy of the result is reduced, but the composition provided by the invention overcomes the defect, as described in example 6, the detection result of the composition provided by the invention is consistent with the second-generation sequencing result, which shows that the composition provided by the invention has high accuracy.

In the present invention, the fluorescent reporter group of the probe may be selected from the group consisting of FAM, HEX, ROX, VIC, CY5, 5-TAMRA, TET, CY3 and JOE, but is not limited thereto.

In a specific embodiment, the fluorescent reporter of the probe for TPMT gene 238 as shown in SEQ ID NO. 3 is FAM; the fluorescent reporter group of the probe of the TPMT gene 238 shown as SEQ ID NO. 4 is HEX; the fluorescent reporter group of the probe of the TPMT gene 460 shown as SEQ ID NO. 7 is ROX; the fluorescent reporter of the probe for TPMT gene 460 as shown in SEQ ID NO. 8 is CY 5.

In a specific embodiment, the fluorescent reporter group of the probe for TPMT gene 719 shown in SEQ ID NO. 11 is FAM; the fluorescent reporter group of the probe of the TPMT gene 719 shown as SEQ ID NO. 12 is HEX; the fluorescent reporter group of the probe of the NUDT15 gene 415 shown as SEQ ID NO. 15 is ROX; the fluorescent reporter group of the probe of the NUDT15 gene 415 shown in SEQ ID NO 16 is CY 5.

Further, the first and second groups are present in individually packaged form.

Further, the composition further comprises a substance for obtaining a swab sample or a device for preserving a swab sample.

Further, the dosage of the primer in the composition is 0.2-0.4 mu mol/L; the dosage of the probe in the composition is 0.2-0.4 mu mol/L.

In a second aspect, the present invention provides the use of the above-mentioned composition of the present invention in the preparation of a kit for detecting polymorphisms of the human TPMT gene and the NUDT15 gene.

In a third aspect, the present invention provides a kit for detecting polymorphisms of the human TPMT gene and the NUDT15 gene, the kit comprising the above-described composition of the present invention.

Further, the kit also comprises at least one of nucleic acid releasing reagent, dNTP, DNA polymerase and PCR buffer solution.

Furthermore, the concentration of dNTP is 2-3 mmol/L, and the PCR buffer solution is 3-7 μ L. In a specific embodiment, the buffer solution for PCR reaction comprises 200mmol/L Tris-HCl solution, pH7.5, 30mmol/L magnesium chloride solution, 500mmol/L potassium chloride solution, 0.2% (v/v) Triton solution and 10% (v/v) formamide solution.

Further, the kit may further comprise Mg²⁺Glycosylase, dUTP.

In a specific embodiment, the nucleic acid release reagent comprises one or more of 0.01-0.5 mmol/L of cyperantin (surfactin), 100-200 mmol/L of potassium chloride, 50-200 mmol/L of lithium chloride, 0.1-1% of lauryl triethanolamine sulfate in a mass/volume ratio, 0.1-1% of ethylphenylpolyethylene glycol (NP-40) in a volume/volume ratio, 0.01-2% of sodium dodecyl sulfonate in a mass/volume ratio, 0.05-1% of ethanol in a volume/volume ratio, and the like.

Through using this kind of nucleic acid release reagent, need not carry out nucleic acid extraction, the method and it is simple, do not need purification centrifugation nor high temperature heating, only need add nucleic acid release reagent blow beat can, make the nucleic acid release very complete simultaneously, be convenient for subsequent PCR amplification operation, the degree of accuracy of detection has been improved, and also make the sample detection that can be suitable for whole blood and oral cavity swab simultaneously, but direct detection fingertip blood sample and oral cavity swab sample, oral cavity swab sample does not have the injury to the human body, only scrape with the swab and get oral cavity inner wall exfoliative cell can, the sample normal atmospheric temperature is preserved, the transport is convenient, can really reach the purpose of having a wound sample.

In specific embodiments, the DNA polymerase is 5U/. mu.L to 15U/. mu.L; the glycosylase is 0.05U/mu L-0.2U/mu L.

By setting an anti-pollution system of uracil DNA glycosylase (UNG enzyme) + dUTP, the UNG enzyme is utilized to fully degrade the possible PCR product pollution, so as to eliminate the possible false positive result caused by the pollution and ensure that the detection result is more accurate.

In a specific embodiment, the kit further comprises a negative control and a positive control, wherein the positive control comprises a plasmid DNA mixture containing 8 SNP target sequences, and the specific steps are as follows:

TPMT gene 238G plasmid sequence (SEQ ID NO: 17):

CCTCTAAATTAAAGAAAATATATGCTTACTCTAATATAACCCTCTATTTAGTCATTTGAAAACATAATTTAAGTGTAAATGTATGATTTTATGCAGGTTTGCAGACCGGGGACACAGTGTAGTTGGTGTGGAAATCAGTGAACTTGGGATACAAGAATTTTTTACAGAGCAGAATCTTTCTTACTCAGAAGAACCAATCACCG

TPMT gene 238C plasmid sequence (SEQ ID NO: 18):

CCTCTAAATTAAAGAAAATATATGCTTACTCTAATATAACCCTCTATTTAGTCATTTGAAAACATAATTTAAGTGTAAATGTATGATTTTATGCAGGTTTCCAGACCGGGGACACAGTGTAGTTGGTGTGGAAATCAGTGAACTTGGGATACAAGAATTTTTTACAGAGCAGAATCTTTCTTACTCAGAAGAACCAATCACCG

TPMT gene 460G plasmid sequence (SEQ ID NO: 19):

TGCTCATCTTCTTAAAGATTTGATTTTTCTCCCATAAAATGTTTTTTCTCTTTCTGGTAGGACAAATATTGGCAAATTTGACATGATTTGGGATAGAGGAGCATTAGTTGCCATCAATCCAGGTGATCGCAAATGGTAAGTAATTTTTCTTTTTTTGTTTAGCTGTCTTAATTTTTTAGTATACTATACTTTTTCTGGGTTCTAG

TPMT gene 460A plasmid sequence (SEQ ID NO: 20):

TGCTCATCTTCTTAAAGATTTGATTTTTCTCCCATAAAATGTTTTTTCTCTTTCTGGTAGGACAAATATTGGCAAATTTGACATGATTTGGGATAGAGGAACATTAGTTGCCATCAATCCAGGTGATCGCAAATGGTAAGTAATTTTTCTTTTTTTGTTTAGCTGTCTTAATTTTTTAGTATACTATACTTTTTCTGGGTTCTAG

plasmid sequence of TPMT gene 719A (SEQ ID NO: 21):

GTTTCAGGTAAAATATGCAATATACGTTGTCTTGAGAAGGTTGATGCTTTTGAAGAACGACATAAAAGTTGGGGAATTGACTGTCTTTTTGAAAAGTTATATCTACTTACAGAAAAGTAAATGAGACATAGATAAAATAAAATCACACTGACATGTTTTTGAGGAATTGAAAATTATGCTAAAGCCTGAAAATGTAATGGATGAATTTTTAAAATTGTTTA

TPMT gene 719G plasmid sequence (SEQ ID NO: 22):

GTTTCAGGTAAAATATGCAATATACGTTGTCTTGAGAAGGTTGATGCTTTTGAAGAACGACATAAAAGTTGGGGAATTGACTGTCTTTTTGAAAAGTTATGTCTACTTACAGAAAAGTAAATGAGACATAGATAAAATAAAATCACACTGACATGTTTTTGAGGAATTGAAAATTATGCTAAAGCCTGAAAATGTAATGGATGAATTTTTAAAATTGTTTA

NUDT15 gene 415C plasmid sequence (SEQ ID NO: 23):

TAATTTTTTCTAAATATAGGTTAGCTTACCCAAATAAACACCCTTTGTTTTCTGTTATCTAAATAAATTGATTTAGCATCTTTCTTTTCTAGGTTGGGAGTGGGTTCCTTGGGAAGAACTACCTCCCCTGGACCAGCTTTTCTGGGGACTGCGTTGTTTAAAAGAACAAGGCTATGATCCATTTAAAGAAGATCTGAACCATCTGGTGGGATACAAAGGAAATCATCTCTAGGTGGCCGAGAAGATTTGATTTTCTTTAAAAAGACAAGAATAAGGTCTGGTTAGGGAATGAAAAATGTATA

NUDT15 gene 415T plasmid sequence (SEQ ID NO: 24):

TAATTTTTTCTAAATATAGGTTAGCTTACCCAAATAAACACCCTTTGTTTTCTGTTATCTAAATAAATTGATTTAGCATCTTTCTTTTCTAGGTTGGGAGTGGGTTCCTTGGGAAGAACTACCTCCCCTGGACCAGCTTTTCTGGGGACTGTGTTGTTTAAAAGAACAAGGCTATGATCCATTTAAAGAAGATCTGAACCATCTGGTGGGATACAAAGGAAATCATCTCTAGGTGGCCGAGAAGATTTGATTTTCTTTAAAAAGACAAGAATAAGGTCTGGTTAGGGAATGAAAAATGTATA

negative control: 0.9% physiological saline.

In a fourth aspect, there is provided a method for detecting polymorphisms in the human TPMT gene and the NUDT15 gene, the method comprising the steps of:

1) releasing nucleic acid of a sample to be detected;

2) performing fluorescent quantitative PCR on the nucleic acid obtained in step 1) using the composition of the present invention as described above or the kit of the present invention as described above;

3) results were obtained and analyzed.

In the present invention, the sample for detection may be whole blood, buccal swab, or the like, but is not limited thereto.

Further, the reaction conditions of the fluorescent quantitative PCR are as follows:

the fluorescence is not collected in the first ten cycles, and the fluorescence is collected in the last thirty cycles, so that the curve of the fluorescence PCR is more stiff and straight, and the analysis result is more accurate.

Drawings

FIG. 1 is an amplification chart of a positive plasmid for detection of a composition of the present invention;

FIG. 2 is an amplification chart of positive plasmids detected by the composition of the present invention;

FIG. 3 is an expanded view of a buccal swab sample tested with a composition of the invention to detect a TPMT wild-type and NUDT15 hybrid;

FIG. 4 is an expanded view of a buccal swab sample tested with a composition of the invention to detect a TPMT wild-type and NUDT15 hybrid;

FIG. 5 is an amplification graph of a peripheral blood sample tested for TPMT719 heterozygote and NUDT15 wild type according to the present invention;

FIG. 6 is an amplification graph of a peripheral blood sample from a composition of the present invention tested for TPMT719 heterozygote and NUDT15 wild type;

FIG. 7 is an amplification chart of positive plasmids for detection by the composition of the present invention;

FIG. 8 is an amplification chart of positive plasmids for detection by the composition of the present invention;

FIG. 9 is an amplification chart of positive plasmids for detection by the composition of the present invention;

FIG. 10 is an amplification plot of a positive plasmid for detection by a composition of the invention;

FIG. 11 shows the results of a sensitivity test for a composition of the present invention;

FIG. 12 shows the results of a sensitivity test for a composition of the present invention;

FIG. 13 shows the results of testing comparative example compositions of the present invention;

FIG. 14 shows the results of testing comparative example compositions according to the present invention.

Detailed Description

The present invention will be described in detail below with reference to specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly apparent therefrom. It will be understood by those skilled in the art that these specific embodiments and examples are for the purpose of illustrating the invention and are not to be construed as limiting the invention.

Example 1 primers and probes used in the present invention

The upstream and downstream primers for target polynucleotide amplification and the probe for target polynucleotide detection are respectively originated from the rs1800462(238G & gtC) site, the rs1800460(460G & gtA) site, the rs1142345(719A & gtG) site of the TPMT gene and the rs116855232 site (415C & gtT) of the NUDT15 gene, wherein the sites are respectively used as target regions by 150bp before and after the site.

1) Determining the probe sequence of the TPMT gene G238C primer as follows:

TPMT-238-F：5'-CGCATAATTTAAGTGTAAATGTATGATTT-3'(SEQ ID NO:1)；

TPMT-238-R：5'-GATTTCCACACCAACTACACTGTGTC-3'(SEQ ID NO:2)；

TPMT-238G-P：5'-ATGCAGGTTTGCAGAC-3'(SEQ ID NO:3)；

TPMT-238C-P：5'-ATGCAGGTTTCCAGAC-3'(SEQ ID NO:4)；

2) the primer probe sequence of the TPMT gene G460A is determined as follows:

TPMT-460-F：5'-ATTGGCAAATTTGACATGATTTG-3'(SEQ ID NO:5)；

TPMT-460-R：5'-CGATCACCTGGATTGATGGCA-3'(SEQ ID NO:6)；

TPMT-460G-P：5'-GGATAGAGGAGCATTAG-3'(SEQ ID NO:7)；

TPMT-460A-P：5'-GGATAGAGGAACATTAG-3'(SEQ ID NO:8)；

3) the primer probe sequence of TPMT gene A719G is determined as follows:

TPMT-719-F：5'-GCAGTTGGGGAATTGACTGTCT-3'(SEQ ID NO:9)；

TPMT-719-R：5'-GCCATGTCAGTGTGATTTTATTTTATC-3'(SEQ ID NO:10)；

TPMT-719A-P：5'-GAAAAGTTATATCTACTTACA-3'(SEQ ID NO:11)；

TPMT-719G-P：5'-GAAAAGTTATGTCTACTTACA-3'(SEQ ID NO:12)；

4) the probe sequence of the C415T primer of the NUDT15 gene is determined as follows:

NUDT15-415-F：5'-TGGGAAGAACTACCTCCCCTGGA-3'(SEQ ID NO:13)；

NUDT15-415-R：5'-CACCAGATGGTTCAGATCTTCTTTAA-3'(SEQ ID NO:14)；

NUDT15-415C-P：5'-TCTGGGGACTGCGTTGT-3'(SEQ ID NO:15)；

NUDT15-415T-P：5'-TCTGGGGACTGTGTTGT-3'(SEQ ID NO:16)；

wherein, the fluorescent reporter group of the probe of the TPMT gene G238C shown as SEQ ID NO. 3 is FAM; the fluorescent reporter group of the probe of the TPMT gene G238C shown as SEQ ID NO. 4 is HEX; the fluorescent reporter group of the probe of the TPMT gene G460A shown as SEQ ID NO. 7 is ROX; the fluorescent reporter group of the probe of the TPMT gene G460A shown as SEQ ID NO. 8 is CY 5; the fluorescent reporter group of the probe of TPMT gene A719G shown as SEQ ID NO. 11 is FAM; the fluorescent reporter group of the probe of the TPMT gene A719G shown as SEQ ID NO. 12 is HEX; the fluorescent reporter group of the probe of the NUDT15 gene C415T shown as SEQ ID NO. 15 is ROX; the fluorescent reporter group of the probe of NUDT15 gene C415T shown in SEQ ID NO 16 is CY5, and the 3' end of the probe is also connected with MGB.

Wherein, 1) -4) can be combined into two groups at will, and the sample to be detected is detected.

Example 2 method for detecting polymorphism of human TPMT Gene and NUDT15 Gene

1, reagent preparation:

according to the number of samples to be detected, negative controls and positive controls, taking two PCR reaction solutions (42-46 mu L/person) and enzyme mixed solutions (2-3 mu L/person) with corresponding amounts according to a proportion, respectively and fully mixing the two solutions to form a PCR reaction solution 1 (one group in the composition is added later) and a PCR reaction solution 2 (the other group in the composition is added later), and carrying out instantaneous centrifugation for later use.

2 sample treatment

(2) Measuring a plurality of PCR reaction tubes according to the number of samples to be detected, adding 3-7 mu L of a nucleic acid releasing agent into each PCR reaction tube (deep suction and shallow suction are recommended to avoid bubbles), sequentially adding 3-7 mu L of the samples to be detected (peripheral blood or oral swab), negative control and positive control, and uniformly sucking and stirring for 3-5 times;

(3) and (3) taking 1-6 mu L of releasing agent-sample, releasing agent-positive control and releasing agent-negative control mixed liquor to corresponding two PCR reaction tubes, then respectively and sequentially adding 44-49 mu L of PCR reaction liquor, covering a tube cover, and centrifuging at 2000rpm for 30 seconds.

3 fluorescent PCR reaction and result analysis

(1) And (3) placing the PCR reaction tube into a sample groove of an amplification instrument, and setting the names of the samples to be detected according to the corresponding sequence.

(2) Fluorescence detection channel selection: selecting FAM channel (report: FAM, Quencher: None) to detect TPMT238G and TPMT 719A; selecting HEX channel (Reportere: CY5, Quencher: None) to detect TPMT 238C and TPMT 719G; selecting ROX channel (Reportere: HEX, Quencher: None) to detect TPMT 460G and NUDT 15415C; CY5 channel (Reportere: ROX, Quencher: None) was selected for detection of TPMT 460A and NUDT 15415T.

(3) The fluorescent quantitative PCR reaction conditions are as follows:

analysis of results

After the reaction is finished, the instrument automatically stores the result, or the instrument can automatically analyze the result by using the self-contained result interpretation software (or manually adjust the starting value, the ending value and the threshold line value of the base line for analysis), and then record the Ct value of the sample to obtain the typing result. The instrument software can automatically interpret the typing results according to the Ct value of each sample. The following table specifically shows:

method for judging negative and positive

Example 3 test results of the inventive composition for testing Positive controls

A combination of the compositions provided according to the present invention (specifically, 1) and 2); 3) and 4)) detecting a positive control plasmid, wherein the positive control is a mixed solution of 8 plasmids containing four SNP sites, and the detection method is carried out according to the detection method described in the example 2, except that nucleic acid extraction is not needed. The amplification results of the PCR reaction solution 1 and the PCR reaction solution 2 are shown in FIG. 1 and FIG. 2, respectively, and it can be seen from the figure that the composition of the present invention can well detect the positive control plasmid, indicating that the composition of the present invention can be used for detecting the polymorphism of the human TPMT gene and the NUDT15 gene.

Example 4 test results of oral swab samples with the inventive composition

The composition of example 3 provided herein was used to detect oral swab samples heterozygous for TPMT wild-type and NUDT15 according to the detection method described in example 2. The amplification results of the PCR reaction solution 1 (detecting TPMT238 GG and 460GG double wild samples) and the PCR reaction solution 2 (detecting TPMT719 AA and NUDT 15415 CT samples) are respectively shown in the figure 3 and the figure 4, and it can be seen from the figure that the composition of the invention can well detect the polymorphism of the human TPMT gene and the NUDT15 gene in the oral swab sample.

Example 5 test results of the composition of the present invention for testing peripheral blood samples

The composition of example 3 provided herein was tested on TPMT719 heterozygote and NUDT15 wild-type peripheral blood samples according to the test method described in example 2. The amplification results of the PCR reaction solution 1 (detecting TPMT238 GG and 460GG double wild samples) and the PCR reaction solution 2 (detecting TPMT719 AG and NUDT 15415 CC samples) are respectively shown in the figure 5 and the figure 6, and it can be seen from the figure that the composition can well detect the polymorphism of the human TPMT gene and the NUDT15 gene in the whole blood sample.

Example 6 testing of positive controls for additional combinations of compositions of the invention

Other combinations of the compositions provided according to the invention (specifically, manner one: 1) and 3); 2) and 4) and mode two: 1) and 4); 2) and 3)) detecting a positive control plasmid, wherein the positive control is a mixed solution of 8 plasmids containing four SNP sites, and the detection method is carried out according to the detection method described in the example 2, except that nucleic acid extraction is not needed. The amplification results of the PCR reaction solution 1 and the PCR reaction solution 2 are shown in FIGS. 7 and 8 and FIGS. 9 and 10, respectively, and it can be seen from the graphs that the positive control plasmid can be well detected by the other combination of the composition of the present invention, indicating that the composition of the present invention can be used for detecting the polymorphism of the human TPMT gene and the NUDT15 gene.

Example 7 test of comparison of detection results with second-generation sequencing results

8-exception peripherical blood samples with unknown test results were tested as described in example 2 and compared to Sanger sequencing results as follows:

and (4) conclusion: the detection results of the kit for detecting TPMT gene and NUDT15 gene polymorphism related to human thiopurine drug metabolism are completely consistent with the detection results of TPMT gene rs1800462(238G > C), rs1800460(460G > A), rs1142345(719A > G) and NUDT15 gene rs116855232 (415C > T) gene Sanger sequencing.

Example 8 sensitivity testing of compositions of the invention

The nucleic acid of the sample 8 was extracted using the nucleic acid extracting and purifying reagent and diluted to a concentration of 1 ng/. mu.L, and the test using the composition of the present invention was carried out as described in example 2, and the test results are shown in FIGS. 11 and 12 below, from which it can be seen that the composition of the present invention can still well detect the sample when the concentration of the nucleic acid in the sample is 1 ng/. mu.L.

Comparative example 1, detection results of comparative primer and Probe

In the process of designing the primers and the probes, the inventor also designs the other primers and probes to be also used for detecting the polymorphism of the human TPMT gene and the NUDT15 gene. The sequence is shown as follows:

other primer probe combinations of the TPMT gene G238C are as follows:

TPMT-238-F：5'-CGCATAATTTAAGTGTAAATGTATGA-3'(SEQ ID NO:1)；

TPMT-238-R：5'-GATTTCCACACCAACTACACTGTGT-3'(SEQ ID NO:2)；

TPMT-238G-P：5'-FAM-TGTATGATTTTATGCAGGTTTGCA-MGB-3'(SEQ ID NO:25)；

TPMT-238C-P：5'-HEX-TGTATGATTTTATGCAGGTTTCCA-MGB-3'(SEQ ID NO:26)；

other primer probe combinations of the TPMT gene G460A are as follows:

TPMT-460-F：5'-ATTGGCAAATTTGACATGATTTG-3'(SEQ ID NO:5)；

TPMT-460-R：5'-CGATCACCTGGATTGATGGCA-3'(SEQ ID NO:6)；

TPMT-460G-P：5'-ROX-TTTGGGATAGAGGAGCA-MGB-3'(SEQ ID NO:27)；

TPMT-460A-P：5'-CY5-CTTTGGGATAGAGGAACA-MGB-3'(SEQ ID NO:28)；

other primer probe combinations of TPMT gene A719G are as follows:

TPMT-719-F：5'-GCAGTTGGGGAATTGACTGTCT-3'(SEQ ID NO:9)；

TPMT-719-R：5'-GCCATGTCAGTGTGATTTTATTTTA-3'(SEQ ID NO:10)；

TPMT-719A-P：5'-FAM-TTGAAAAGTTATATCTACT-MGB-3'(SEQ ID NO:29)；

TPMT-719G-P：5'-HEX-TTGAAAAGTTATGTCTACT-MGB-3'(SEQ ID NO:30)；

other primer probe combination sequences of NUDT15 gene C415T are as follows:

NUDT15-415-F：5'-TGGGAAGAACTACCTCCCCTGG-3'(SEQ ID NO:13)；

NUDT15-415-R：5'-CACCAGATGGTTCAGATCTTCTT-3'(SEQ ID NO:14)；

NUDT15-415C-P：5'-ROX-GCTTTTCTGGGGACTGCGT-MGB-3'(SEQ ID NO:31)；

NUDT15-415T-P：5'-CY5-GCTTTTCTGGGGACTGTGT-MGB-3'(SEQ ID NO:32)；

the results of 8 mixed plasmids tested by the composition according to the method described in example 2 are shown in fig. 13 and 14, and it can be seen from the graphs that the primers and probes of the comparative example can not well test positive plasmids, which proves that the primers and probes of the comparative example can not be used for testing the polymorphism of TPMT gene and NUDT15 gene related to the metabolism of human thiopurine drugs.

Claims

1. A composition capable of detecting polymorphisms in the human TPMT gene and the NUDT15 gene, said composition comprising:

wherein 1) to 4) are present in any combination of two;

2. The composition of claim 1, wherein 1) and 2) are one group; 3) and 4) as another group.

3. The composition of claim 1, wherein 1) and 3) are one group; 2) and 4) as another group.

4. The composition of claim 1, wherein 1) and 4) are one group; 2) and 3) as another group.

5. A composition as claimed in any one of claims 1 to 4, wherein the one and other groups are present in separate packages.

6. Use of the composition according to any one of claims 1 to 5 in the preparation of a kit for detecting polymorphisms of the human TPMT gene and the NUDT15 gene.

7. A kit for detecting polymorphisms of the human TPMT gene and the NUDT15 gene, the kit comprising the composition according to any one of claims 1 to 5.

8. The kit of claim 7, wherein the kit further comprises at least one of nucleic acid releasing reagents, dntps, DNA polymerase, PCR buffer; preferably, the dNTP is 2-3 mmol/L, PCR, the buffer solution is 3-7 mu L, DNA, and the polymerase is 5-15U/mu L.

9. A method for detecting polymorphisms of the human TPMT gene and the NUDT15 gene, the method comprising the steps of:

1) releasing nucleic acid of a sample to be detected; preferably, the sample is whole blood or a buccal swab;

2) performing fluorescent quantitative PCR on the nucleic acid obtained in the step 1) by using the composition of any one of claims 1 to 5 or the kit of claim 7 or 8;

3) results were obtained and analyzed.

10. The method of any one of claims 8 to 9, wherein the reaction conditions of the fluorescent quantitative PCR are as follows:

。