CN113755501A - Gene ScPEL for controlling color conversion of three-hundred-grass leaves and application thereof - Google Patents

Abstract

The invention discloses a gene ScPEL for controlling color conversion of three-hundred-grass leaves and application thereof. The CDS sequence of the gene is shown in SEQ ID NO. 1. A recombinant expression vector containing the gene ScPEL. The gene ScPEL is applied to the regulation of the color conversion of plant leaves. According to the invention, transcriptome sequencing is carried out on three hundred grass leaves with different colors, a gene PEL (Pseudo-methylation in Light) specifically expressed in white bracts is screened out, homology comparison is carried out on the gene in NCBI, no homologous gene is found, and the functional specificity of ScPEL is suggested to exist. The gene ScPEL is cloned by designing a primer, the CDS sequence is shown as SEQ ID NO.1, and the gene is found to be capable of controlling the color conversion of the leaves of the saururus chinensis by functional verification and is reported for the first time in saururus chinensis.

Description

Gene ScPEL for controlling color conversion of three-hundred-grass leaves and application thereof

Technical Field

The invention belongs to the field of genes, and relates to a gene ScPEL for controlling color conversion of saururus chinensis leaves and application thereof.

Background

Saururaceae (Saururaceae) is a stable component in ancient herbaceous plants and has important significance for studying angiosperm origin and early evolution (Mengwu, 2001; phylogeny of Saururaceae based on 5.8s rDNA sequence theory). Saururus chinensis (Lour.) Baill is a plant of Saururus of Saururaceae, and the whole herb can be used as medicine, and has the effects of clearing away heat and toxic materials, and inducing diuresis to reduce edema. When the saururus chinensis is in the flowering phase, 2-3 leaves below the inflorescence of the stem tip are white. Then, the leaves turn from white to green with the change of the growing time.

Genes controlling leaf color conversion: the mutation of the leaf color of the plant is a phenomenon that the leaf color of the plant changes in the growth process and is caused by the hindered synthesis or accelerated degradation of chlorophyll (Liuxin Liang, etc., 2017). The precursor of higher plant chlorophyll synthesis is glutamate, a process involved by 18 key enzymes encoded by more than 30 genes (Tanaka and Tanaka, 2006; Harpaz-Saad et al, 2007; Tanaka et al, 2011). The occurrence of leaf color mutation may be influenced by factors such as chlorophyll synthesis and chloroplast development. Research shows that the expression level of a gene coding glutamyl-tRNA synthetase (GluRS) is reduced in the chlorophyll synthesis process, so that the content of chlorophyll in tobacco can be reduced, and the tobacco has a yellowing phenotype (Kim et al, 2005); in arabidopsis magnesium protoporphyrin IX methyltransferase (CHLM) gene function-deficient mutants, the chloroplast protein complex content was reduced and the plants exhibited a albino phenotype (Pontier et al, 2007). Mutations in the photomorphogenetic process affect chloroplast development, such as Phytochrome Interacting Factors (PIFs), which regulate the transcriptional levels of related genes. Research shows that PIF3 can inhibit expression of key enzyme genes in chlorophyll synthesis pathway, including HEMA1 (encoding glutamic acid-tRNA reductase), GUN5 (encoding ChlH) and genes like LHCA1 and PsaE1 in PSI of photosynthetic system (Shin et al, 2009). In addition, protein transport and processing, thylakoid differentiation, chloroplast division, etc. may also affect chloroplast development (Kubis et al, 2004; Hoober et al, 2007; Okazaki et al, 2009). At present, the genome of the saururus chinensis has not been published, and the molecular mechanism of the color conversion of the saururus chinensis bracts has not been elucidated. Therefore, what gene controls the transformation of leaf color in saururus chinensis cannot be predicted according to the existing report.

The application of the plant leaf color mutation comprises the following steps: most of the leaf color yellowing mutations can be found at the early growth stage of plants and are easy to identify; the yellowing mutation can be stably inherited, and the non-lethal yellowing mutation can be used as a marker shape for variety breeding and genetic improvement, so that the period of fine variety breeding can be effectively shortened.

Reference documents:

[1]Harpaz-Saad S,Azoulay T,Arazi T,et al.Chlorophyllase Is a Rate-Limiting Enzyme in Chlorophyll Catabolism and Is Posttranslationally Regulated[J].The Plant Cell,2007,19(3):1007-1022.

[2]Hoober J K,Eggink L L,Min C.Chlorophylls,ligands and assembly of light-harvesting complexes in chloroplasts[J].Photosynthesis Research,2007,94(2):387-400.

[3]Kim Y K,Lee J Y,Cho H S,et al.Inactivation of Organellar Glutamyl-and Seryl-tRNA Synthetases Leads to Developmental Arrest of Chloroplasts and Mitochondria in Higher Plants[J].Journal of Biological Chemistry,2005,280.

[4]Kubis,S.The Arabidopsis ppi1 Mutant Is Specifically Defective in the Expression,Chloroplast Import,and Accumulation of Photosynthetic Proteins[J].The Plant Cell,2003,15(8):1859-1871.

[5]Okazaki K,Kabeya Y,Suzuki K,Mori T,Ichikawa T,Matsui M,Nakanishi H,Miyagishima S.The PLASTID DIVISION1 and 2Components of the Chloroplast Division Machinery Determine the Rate of Chloroplast Division in Land Plant Cell Differentiation[J].THE PLANT CELL,2009.，21(6):1769-1780.

[6]Pontier D,Albrieux C,Joyard J,et al.Knock-out of the Mg protoporphyrin IX methyltransferase gene in Arabidopsis:Effects on chloroplast development and on chloroplast-to-nucleus signaling[J].Journal of Biological Chemistry,2007,82(4):2297-2304.

[7]Shin J,Kim K,Kang H,et al.Phytochromes promote seedling light responses by inhibiting four negatively-acting phytochrome-interacting factors[J].Proceedings of the National Academy of Sciences of the United States of America,2009,106(18):7660-7665.

[8]Tanaka A,Tanaka R.Chlorophyll metabolism[J].Current Opinion in Plant Biology,2006,9(3):248-255.

[9]Tanaka R,Kobayashi K,Masuda T.Tetrapyrrole Metabolism in Arabidopsis thaliana.[J].The Arabidopsis Book,2011,9(9):e0145.

[10] liu Xin Liang, Li Xian Min, which is small and three, and the like, the research progress of the plant leaf color yellowing mutation molecular mechanism [ J ]. southern agricultural science, 2017(8).

[11] Saururaceae phylogeny based on the 5.8S rDNA sequence theory [ J ] Yunnan plant research, 2001(03):43-46.

Disclosure of Invention

The invention aims to provide a gene ScPEL for controlling the color conversion of three hundred grass leaves, aiming at overcoming the defects in the prior art.

Another object of the present invention is to provide a recombinant expression vector containing the gene.

The invention also aims to provide the application of the gene and the recombinant expression vector.

The purpose of the invention can be realized by the following technical scheme:

the CDS sequence of the gene ScPEL for controlling the color conversion of the saururus chinensis leaves is shown as SEQ ID NO. 1.

Preferably, the gene ScPEL has a gene sequence shown in SEQ ID NO. 2.

A recombinant expression vector containing the gene ScPEL.

Preferably, the starting vector of the recombinant expression vector is pMDC 83.

The gene ScPEL is applied to the regulation of the color conversion of plant leaves.

Preferably, the plant is selected from arabidopsis thaliana or saururus chinensis.

The recombinant expression vector is applied to the regulation of the color conversion of plant leaves.

Preferably, the plant is selected from arabidopsis thaliana or saururus chinensis.

Has the advantages that:

according to the invention, transcriptome sequencing is carried out on three hundred grass leaves with different colors, a gene PEL (Pseudo-methylation in Light) specifically expressed in white bracts is screened out, homology comparison is carried out on the gene in NCBI, no homologous gene is found, and the functional specificity of ScPEL is suggested to exist. The CDS sequence is shown in SEQ ID NO.1 and is reported in saururus chinensis for the first time by designing a primer to clone the gene ScPEL.

The invention carries out heterologous expression on the gene ScPEL specifically expressed in the white bract of the saururus chinensis in the arabidopsis thaliana, finds that the arabidopsis thaliana plant over expressing the ScPEL has a yellowing phenotype, and compared with a wild plant, the arabidopsis thaliana transformed with the ScPEL gene grows normally. The chlorophyll content test result shows that the chlorophyll content in the Arabidopsis leaves transformed with the ScPEL gene is obviously reduced compared with that of wild plants. The ScPEL is probably to influence the color conversion of the arabidopsis leaf by regulating the change of the chlorophyll content.

Drawings

FIG. 1 TA cloning transformation and identification process of target fragment

FIG. 2 alignment of single-clone sequencing of ScPEL sequence

FIG. 3ScPEL-pMDC83 recombinant plasmid schematic

FIG. 4 Positive identification result of Arabidopsis thaliana overexpressing ScPEL gene

FIG. 5 overexpression of ScPEL Gene Arabidopsis thaliana T₁Etiolated phenotype

FIG. 6 overexpression of ScPEL Gene Arabidopsis thaliana T₂Etiolated phenotype

FIG. 7 chlorophyll content measurement of Arabidopsis thaliana leaves overexpressing ScPEL Gene

Detailed Description

Example 1

(1) TROZOL method for extracting Saururi herba cell slice RNA

1) Placing a proper amount of saururus chinensis baill pills into a mortar precooled by liquid nitrogen, continuously adding the liquid nitrogen, grinding the saururus chinensis baill pills into powder, and adding 1mL of trozol into 50-100mg of the powder. Standing on ice for 5 min.

2) Centrifuge at 13000rpm for 5min at 4 ℃ and aspirate the supernatant into a 2.0mL centrifuge tube.

3) Adding 200 μ L chloroform, shaking, mixing, and standing at room temperature for 5 min.

4) Centrifuge at 13000rpm for 15min at 4 ℃ and aspirate the supernatant into a 2.0mL centrifuge tube.

5) The supernatant was aspirated into a new centrifuge tube, an equal volume of precooled isopropanol was added, and the tube was left at-20 ℃ for 10 min.

6) Centrifuge at 13000rpm for 10min at 4 ℃.

7) The supernatant was discarded and the precipitate was washed with 75% absolute ethanol.

8) After brief blow-drying, 30. mu.L of RNAase free H was added₂And dissolving the O.

9) After detection by agarose gel, the RNA samples were stored at-80 ℃ for future use.

(2) Reverse transcription of RNA

Taking 1pg-500ng Total RNA, adding 4 XgDNA wiper Mix 2 μ L, adding RNase free ddH2O to make up to 8 μ L;

standing at 42 deg.C for 2min on ice for 3 min;

adding 2 mu L of 5 xqRT Supermix II into the reaction system;

25℃,10min；50℃,30min；85℃,5min；

the cDNA was obtained.

(3) PCR of the fragment of interest

The target fragment is amplified by using high fidelity enzyme, and the PCR reaction system is as follows: 0.5. mu.L of Phanta Max Super-Fidelity DNA Polymerase, 12.5. mu.L of 2 XPphanta Max Buffer, 0.5. mu.L of dNTP Mix (10mM each) and 0.8. mu.L of each of primers ScPEL-F1/R1(SEQ ID NO.3/SEQ ID NO.4, 10. mu.M) were used to fill up a final volume of 25. mu.L with 1. mu.L of cDNA template and water. High fidelity enzymatic PCR amplification procedure: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15s, annealing at 48-62 ℃ (selected according to gradient PCR results) for 15s, extension at 72 ℃ for 30-120 s (time set according to fragment size, 2kb/min), 35 cycles; extending for 5min at 72 ℃; storing at 4 ℃. The amplification product was subjected to electrophoresis and Gel recovery, and the specific operation was performed with reference to Gel Extraction Kit (CWBIO).

(4) TA cloning of the fragment of interest

TA Cloning was performed using pEASY-Blunt Simple Cloning Kit, Trans-T1 phase resist chemical company. The ligation reaction was as follows: 0.5 mu L of Blunt Simple vector and 4.5 mu L of target fragment;

and (3) lightly blowing and sucking by using a pipette, uniformly mixing, incubating and connecting for 15-30 min at 25 ℃, and then carrying out transformation, wherein the transformation and identification processes are shown in figure 1.

After agarose gel electrophoresis detection, positive clones were selected and sent to Nanjing Optimus department biology Ltd for sequencing.

(5) Sequencing result comparison and plasmid extraction

And (3) comparing and analyzing the returned sequencing result with the CDS sequence (SC004_1478.1) of the ScPEL predicted by the prophase transcriptome sequencing by using DNAMAN software, wherein the comparison result is as follows: p-6 is a single clone with correct sequencing.

Selecting a monoclonal antibody with a correct sequencing result, amplifying and shaking a bacterial liquid, and extracting plasmids by using a plasmid extraction kit for later use, wherein the method has a method reference kit instruction.

Example 2 functional verification of ScPEL Gene

(1) Homologous recombination primer design

The plant expression vector is pMDC83 with GFP labels, and the homologous recombination primer sequence is:

ScPEL-F (recombinant): AGGACCTCGACTCTAGAACTAGTATGGCCGGGTCCTCTGC (SEQ ID NO.5)

ScPEL-R (recombinant): CCCCCCCTCGAGGCGCGCCAACTCTCGGAATCTCTTG (SEQ ID NO.6)

(2) Homologous recombination vector construction

1) Amplification with recombinant primers

PCR was carried out using the above-described correctly sequenced plasmid containing the target gene as a template and ScPEL-F (recombination) and ScPEL-R (recombination) as primers using a high fidelity enzyme system as in (3) of example 1; and (3) detecting the PCR product by agarose gel electrophoresis, and then recovering, wherein the sequence of the amplification product is shown as SEQ ID NO. 7.

2) Destination vector linearization

The enzyme cutting sites used for the linearization of the pMDC83 vector are Asc I and Spe I, and the enzyme cutting system is as follows: plasmid 10. mu.L, Asc I and Spe I1. mu.L each, Cutsmart 2.5. mu.L, supplemented with water to 25. mu.L. And reacting for 2 hours under the condition of 37 ℃ water bath. And (3) detecting the linearized vector by agarose gel electrophoresis and then recovering the linearized vector.

3) Homologous recombination

The reagent used by homologous recombination is Trelief of the department of Onychidae^TMThe reaction system of the SoSoSoo Cloning Kit is as follows: 1 mu L of linearized vector, 4 mu L of target fragment and 5 mu L of 2 XSoSoo Mix; the reaction was carried out at 50 ℃ for 15 min.

4) Transformation and characterization

The procedure was referred to (4) of example 1. The recombinant vector is schematically shown in FIG. 3.

(3) Agrobacterium transformation

Selecting positive clones to carry out agrobacterium transformation, wherein the agrobacterium competence is GV3101, and the agrobacterium transformation process is as follows:

1) the agrobacterium tumefaciens stored at the temperature of minus 80 ℃ is taken to be in a sensitive state at room temperature or palm for a moment until part of the agrobacterium tumefaciens is melted, and the agrobacterium tumefaciens is inserted into ice when the agrobacterium tumefaciens is in an ice-water mixed state.

2) Adding 0.01-1 μ g plasmid DNA (with high transformation efficiency, and preferably pre-experiment to determine the amount of plasmid added before first use) per 100 μ L competence, stirring with hand to mix well, standing on ice for 5min, liquid nitrogen for 5min, water bath at 37 deg.C for 5min, and ice bath for 5 min.

3) Adding 700 mu L of LB or YEB liquid culture medium without antibiotics, and carrying out shake culture at 28 ℃ for 2-3 hours.

4) Centrifuging at 6000rpm for one minute to collect bacteria, collecting supernatant of about 100 μ L, lightly blowing to obtain resuspended bacteria block, spreading on LB or YEB plate containing corresponding antibiotics, and culturing in 28 deg.C incubator for 2-3 days.

5) And (3) carrying out PCR identification on positive single colonies and preserving bacterial liquid.

(4) Infection of Arabidopsis thaliana

1) Picking the single colony or the preserved glycerol bacterial liquid, placing the single colony or the preserved glycerol bacterial liquid in about 8mL LB (+) culture medium, and shaking the single colony or the preserved glycerol bacterial liquid overnight at 28 ℃ until the OD of the bacterial liquid is 0.8(0.7-0.9 is not problematic);

2) collecting bacteria at 5000rpm for 10min, re-suspending with the suspension, and adjusting OD to 2.4-2.6;

3) the liquid was aspirated with a pipette tip and infected with Arabidopsis thaliana.

The suspension formulation: 20mL of

MS	0.043g
		Sucrose	1g
Silwet 77	3μl

Note: 1. adjusting the pH value to 5.8 by NaOH;

2. every other week, the infection is performed for 2-3 times

(5) Screening and phenotype identification of arabidopsis positive plants

1) Drying the arabidopsis seeds harvested after infection in a constant temperature box at 37 ℃;

2) after arabidopsis seeds were sterilized (75% ethanol 1 min; sodium hypochlorite), sowing the seeds on 1/2MS culture medium containing 25mg/L hygromycin, and culturing for 14 d;

3) and transferring the plantlets capable of rooting on the screening culture medium into nutrient soil to continue growing.

4) After one week, DNA of the leaves of the transplanted plantlets is extracted for positive identification. The results of the identification are shown in FIG. 4.

5) Harvesting seeds of individual positive plants, i.e. T₁The generation seeds, T1 generation yellowing phenotype is shown in FIG. 5, and T1 generation positive plants show greenish and yellowish phenotype compared with wild type.

(6) Phenotypic observation of transgenic offspring

1) Mixing the above T₁Sterilizing the seed generation, sowing on 1/2MS culture medium, and culturing₂Observation of transgenic offspring at the seedling stage, T₁T for seed germination₂In the generation plantlets, there were some negative plants (the color was dark green, consistent with the wild type Arabidopsis phenotype), while most plantlets were light green, and were determined to be positive plants after PCR positive identification (FIG. 6).

(7) Transgenic progeny chlorophyll content determination (ref Lolle et al, 1998)

1) Weighing 0.1g (FW) Arabidopsis thaliana leaves, adding into 20mL 80% ethanol, and standing at room temperature for 24 h;

2) measuring the absorbance at 664nm and 647nm by using a spectrophotometer;

3) calculating the chlorophyll leaching amount, wherein the formula is as follows:

chlorophyll extraction amount (mmol.g)^-1)＝7.93*A₆₆₄+19.53*A₆₄₇

4) The chlorophyll content measurement results are shown in fig. 7, and the leaf content of different lines of transgenic offspring is significantly lower than that of wild-type material.

Sequence listing

<110> institute of plant of Chinese academy of sciences of Jiangsu province

<120> gene ScPEL for controlling color conversion of saururus chinensis leaves and application thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 279

<212> DNA

<213> Saururus chinensis (Lour.) Baill

<400> 1

atggccgggt cctctgcttc ctatatacac atggtacaac atctgattga agagtgcctg 60

ctctttcata tgaccaagga agagtgcgcg gaagctctct ccaagcatgc taacatcaac 120

ccagtcatca cttccactgt gtggcaagag ctggagaagg agaacagaga gttcttccaa 180

gcttacaagc tgcgcagaga ggagcgaagg tttgagaagg agacaaggga cggagcactg 240

aagatgagcc cgggatcttc aagagattcc gagagttag 279

<210> 2

<211> 898

<212> DNA

<213> Saururus chinensis (Lour.) Baill

<400> 2

gcaaggctct attgcttgac gtaggcccca aatctaagtg tataaatctc cacagactgg 60

gttttgggtt gcatgttcct gttcctcccc ccattcgacc caaatcaaag tagtattcct 120

actgtttatc atcgttgtac ctttttgcag cgcatcctct tagccttcca ctattttcag 180

gaacaacacc gccatctcaa atggccgggt cctctgcttc ctatatacac atggtaaata 240

tgcgtactaa tgtgtacgaa ggttggcgat cttatggagt tgttctcctt actgactctt 300

gtttcttctt gtggcatgtg ggtgactggg catcaaaggt acaacatctg attgaagagt 360

gcctgctctt tcatatgacc aaggaagagt gcgcggaagc tctctccaag catgctaaca 420

tcaacccagt catcacttcc actggtacgt gctcctcttc tagagtgaac cttcatcggc 480

gactgctgcc tctagcttcc tcttttcatc ttgactatgt gtgaagtagt agcgctgagt 540

gttgttggtc accaccagtg tggcaagagc tggagaagga gaacagagag ttcttccaag 600

cttacaagct gcgcagagag gagcgaaggt ttgagaagga gacaagggac ggagcactga 660

agatgagccc gggatcttca agagattccg agagttagaa tctgaaagag acagaagatc 720

gcaagctgat gatggtgacg cacatataca cagatgggca gaattccaac ctccacggtc 780

agccaaatag tagtatatat tctgaaaaat atgtagtatc aatcctacaa acgagtttca 840

gttgtggcgt tgtgtgcaag tactggaacg aggaaggctg gctatgcttc catttcat 898

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gaacaacacc gccatctca 19

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgtgcgtcac catcatcag 19

<210> 5

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aggacctcga ctctagaact agtatggccg ggtcctctgc 40

<210> 6

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccccccctcg aggcgcgcca actctcggaa tctcttg 37

<210> 7

<211> 348

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tggagaggac ctcgactcta gaactagtat ggccgggtcc tctgcttcct atatacacat 60

ggtacaacat ctgattgaag agtgcctgct ctttcatatg accaaggaag agtgcgcgga 120

agctctctcc aagcatgcta acatcaaccc agtcatcact tccactgtgt ggcaagagct 180

ggagaaggag aacagagagt tcttccaagc ttacaagctg cgcagagagg agcgaaggtt 240

tgagaaggag acaagggacg gagcactgaa gatgagcccg ggatcttcaa gagattccga 300

gagttagggc gcgcctcgag ggggggcccg gtaccggtag aaaaaatg 348

Claims (8)

1. A gene ScPEL for controlling the color conversion of saururus chinensis leaves is characterized in that a CDS sequence is shown as SEQ ID NO. 1.

2. The ScPEL gene according to claim 1, wherein the gene sequence is as shown in SEQ ID NO. 2.

3. A recombinant expression vector comprising ScPEL gene according to claim 1.

4. The recombinant expression vector according to claim 1, wherein the starting vector is pMDC 83.

5. Use of the ScPEL gene of claim 1 for modulating color conversion in plant leaves.

6. Use according to claim 5, characterized in that the plant is selected from Arabidopsis thaliana or Saururus chinensis.

7. Use of the recombinant expression vector of claim 3 or 4 for modulating color conversion in plant leaves.

8. Use according to claim 7, characterized in that the plant is selected from Arabidopsis thaliana or Saururus chinensis.

Images