CN113750111A - Application of miRNA-15A in treatment of KIF3B high-expression tumor - Google Patents
Application of miRNA-15A in treatment of KIF3B high-expression tumor Download PDFInfo
- Publication number
- CN113750111A CN113750111A CN202111115890.7A CN202111115890A CN113750111A CN 113750111 A CN113750111 A CN 113750111A CN 202111115890 A CN202111115890 A CN 202111115890A CN 113750111 A CN113750111 A CN 113750111A
- Authority
- CN
- China
- Prior art keywords
- mirna
- seq
- kif3b
- breast cancer
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Oncology (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Genetics & Genomics (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Hospice & Palliative Care (AREA)
- Epidemiology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention provides an application of miRNA-15A in treating high-expression KIF3B tumor. In particular discloses an application of miRNA, a precursor pre-miRNA thereof or a derivative thereof in preparing a medicament for inhibiting the proliferation of a tumor cell with high expression of KIF3B and promoting the apoptosis of the tumor cell with high expression of KIF3B, or in preparing a medicament for reducing the proliferation, migration, invasion and clonogenic capacity of the tumor cell with high expression of KIF 3B; the nucleotide sequence of the miRNA is shown in SEQ ID No. 1. The tumor cells highly expressing KIF3B are selected from triple negative breast cancers. The invention proves that the high expression of KIF3B is related to the proliferation, infection, migration, invasion and clonogenic capacity of triple negative breast cancer for the first time, and proves that the reduction of the expression of KIF3B can realize the inhibition of the proliferation, infection, migration, invasion and clonogenic capacity of triple negative breast cancer.
Description
Technical Field
The invention relates to the field of biotechnology and biomedicine, and particularly provides application of miRNA-15A in treating high-expression KIF3B tumors.
Background
Triple negative breast cancer
The breast cancer is one of the cancers with the highest global morbidity and mortality, the number of new breast cancer cases and death cases is 226 ten thousand and 68 ten thousand respectively in 2020 world, the number of new breast cancer cases and death cases accounts for 24% and 15% of female cancer cases, and the morbidity and mortality are the first cancers of all types in the world. Similar to other countries and regions, breast cancer is the first cancer incidence rate of Chinese women and seriously threatens the life health and safety of Chinese women.
In the face of severe situations, great importance is needed in the research and prevention of breast cancer. The early breast cancer treatment mainly takes operation as a main part, the fatality rate is low, and the cure rate is high; however, the breast cancer has the characteristics of infiltration growth and metastasis, and the middle and late-stage breast cancer is often accompanied by the metastasis of other organs such as liver, lung and bone marrow, so the operation treatment effect is poor, the overall prognosis of the middle and late-stage breast cancer treatment is poor, the recurrence is easy, and the mortality rate is high. In order to reduce the pain borne by breast cancer patients, improve the living quality of breast cancer patients, increase the cure rate of breast cancer and improve prognosis, a targeted therapeutic drug for breast cancer needs to be developed.
Triple-negative breast cancer (TNBC) refers to a type of breast cancer in which immunohistochemical detection of Estrogen Receptor (ER), Progesterone Receptor (PR) and human epidermal growth factor receptor 2(HER-2) is negative, and has poor current stage treatment and prognosis. Triple negative breast cancer is one of the most difficult breast cancer types to treat, accounting for approximately 15% of breast cancer cases, but accounting for 25% of all deaths associated with breast cancer. Compared with other molecular typing breast cancers, the triple negative breast cancer has higher recurrence rate and short progression-free survival period. Because of the negative targeting molecules, common targeting drugs have low treatment effect on triple negative breast cancer, clinical internal treatment on triple negative breast cancer mainly adopts chemotherapy, and has large treatment side effect and poorer curative effect than other types of breast cancer. With the deep exploration on the molecular typing of triple negative breast cancer, the research of targeted therapy gradually becomes the focus of attention.
miRNA
mirnas are a class of non-coding single-stranded RNA molecules of about 22 nucleotides in length encoded by endogenous genes, which are involved in the regulation of post-transcriptional gene expression in mammals. mirnas typically target one or more mrnas, regulating the expression of genes by inhibiting translation or degrading the target mRNA. Approximately 1000 mirnas are present in the human genome, estimated to regulate more than 60% of mammalian genes; the miRNA expression levels of different cell types and tissue types are different, and the miRNA expression levels can be involved in the execution process of physiological functions of various organs; in addition, under various pathological states, miRNA shows abnormal expression, plays an important role in the occurrence, development and prognosis of diseases, and makes the research on treatment modes based on miRNA show good prospects.
The miRNA genes are typically transcribed intranucleally by RNA polymerase II (polII), with the initial product being a large pre-miRNA with a cap structure (7MGpppG) and a poly A tail (AAAAA). The pre-miRNA is processed into the pre-miRNA consisting of 70 nucleotides under the action of a nuclease Drosha and a cofactor Pasha thereof. RAN-GTP and exportin5 transport pre-miRNAs into the cytoplasm. Subsequently, it was cleaved by another nuclease Dicer to generate miRNA of about 22 nucleotides in length miRNA-double strand. This duplex is quickly directed into a silencing complex (RISC) complex, where a single mature, single-stranded miRNA is retained. The site where the mature miRNA binds to its complementary mRNA regulates gene expression by base pairing.
In mammals, mirnas that are not fully complementary to the target mRNA inhibit their expression at the protein translation level. There may be multiple target genes per miRNA, and several miRNAs may also regulate the same gene. This complex regulatory network can regulate the expression of multiple genes by either one miRNA or a combination of several miRNAs to fine-tune the expression of a gene. Recent studies have found that miRNA expression is associated with a variety of cancers, and approximately 50% of the annotated miRNAs are located at tumor-associated sites on the genome, suggesting that miRNAs play a crucial role in tumorigenesis.
Wnt/beta-catenin signal channel
The Wnt signaling pathway, which is widely present in invertebrates and vertebrates, plays a crucial role in the growth and development of animals. In a normally growing mature organism, the growth, proliferation and differentiation of cells have certain regularity and orderliness, and the Wnt pathway of the cells with limited growth is in a closed state when the cells are not stimulated by Wnt signal molecules. However, when the Wnt signaling pathway is activated, it can cause catastrophic changes in many cells, such as: abnormal proliferation and differentiation of cells occurs, leading to tumor formation.
The activation of the canonical Wnt signaling pathway, also called Wnt/beta-catenin signaling pathway, is based on the ectopic localization of beta-catenin in the nucleus to initiate the Wnt pathway, thereby promoting the cell cycle development or producing abnormal proteins to make the cell become cancerous. The beta-catenin gene mutation exists in different degrees in a plurality of tumor cells, such as colorectal cancer, stem cell cancer, thyroid cancer, ovarian cancer, skin cancer cells and the like.
APC, GSK-3 and Axin can form a compound with beta-catenin to promote phosphorylation of the beta-catenin, and then the beta-catenin is combined with ubiquitinated protein to be ubiquitinated and degraded. These are negative regulatory factors of the Wnt pathway, playing a role in negative regulation. The genes expressing these factors are detected to be mutated or deleted in most cancer cells, and beta-catenin is not phosphorylated any more, but is accumulated in cytoplasm and transported into nucleus. The beta-catenin in the nucleus is combined with transcription factors such as T cell factor/lymphokines (TCF/LEF) and the like, Legless proteins (BCL9 and BCL9L) and PYGO protein to form a compound, and then transcription of target genes such as FGF20, DKK1 and CCND1 is started.
Disclosure of Invention
In order to overcome the disadvantages and shortcomings of the prior art, the primary object of the present invention is to provide a method for treating triple negative breast cancer with miRNA, which has high affinity with mRNA sequence of target gene KIF3B and can block KIF3B by binding to mRNA of KIF3B, thereby inhibiting signaling of Wnt/β -catenin signaling pathway. Due to research and discovery that the Wnt/beta-catenin signal path in the triple-negative breast cancer is abnormally activated, the miRNA therapy plays an important role in the aspects of targeted inhibition of proliferation, migration, invasion, clone formation and the like of the triple-negative breast cancer cells with the abnormal Wnt/beta-catenin signal path, and has great application value in the aspect of targeted therapy of the triple-negative breast cancer.
Another object of the present invention is to provide a derivative of the above miRNA, which is also capable of specifically binding to KIF3B with high affinity to KIF 3B.
The invention further aims to provide application of the miRNA and the derivative thereof.
In order to realize the task, the invention adopts the following technical solution:
one aspect of the invention provides an application of miRNA, a pre-miRNA precursor thereof, or a derivative thereof in preparing a medicament for inhibiting proliferation of tumor cells with high expression of KIF 3B; the nucleotide sequence of the miRNA is shown as SEQ ID No.1, uagcagcacauaaugguuugug SEQ ID No: 1; the precursor pre-miRNA can be processed into mature miRNA in cells through nuclease Dicer, and the sequence of the miRNA is shown in SEQ ID NO. 1.
In another aspect, the invention provides the use of the miRNA, the precursor pre-miRNA or the derivative thereof in the preparation of a medicament for promoting apoptosis of tumor cells highly expressing KIF 3B; the nucleotide sequence of the miRNA is shown as SEQ ID No.1, uagcagcacauaaugguuugug SEQ ID No: 1; the precursor pre-miRNA can be processed into mature miRNA in cells through nuclease Dicer, and the sequence of the miRNA is shown in SEQ ID NO. 1.
In still another aspect, the invention provides the application of the miRNA and the derivative of the miRNA in preparing a medicine for reducing the proliferation, migration, invasion and clonogenic capacity of KIF 3B-highly-expressed tumor cells.
In another aspect, the invention provides the application of the miRNA, the precursor pre-miRNA and the derivative of the miRNA in the preparation of medicines for treating tumor diseases with high KIF3B expression.
In the technical scheme of the invention, the tumor cells highly expressing KIF3B are selected from triple-negative breast cancer cell lines. For example, the triple negative breast cancer cell line is MDA-MB-231.
In the technical scheme of the invention, the tumor disease with high KIF3B expression is selected from breast cancer.
In the technical scheme of the invention, the tumor disease with high KIF3B expression is selected from triple negative breast cancer with negative PR, ER and HER2 indexes.
In a further aspect, the invention provides a use of miRNA, a precursor pre-miRNA thereof, or a derivative thereof in preparing a KIF3B protein inhibitor; the nucleotide sequence of the miRNA is shown as SEQ ID No.1, uagcagcacauaaugguuugug SEQ ID No: 1; the precursor pre-miRNA can be processed into mature miRNA in cells through nuclease Dicer, and the sequence of the miRNA is shown in SEQ ID NO. 1.
In a further aspect, the invention provides the use of a miRNA, a pre-miRNA precursor thereof, or a derivative thereof in the preparation of a medicament for treating a disease caused by an increase in KIF3B protein; the nucleotide sequence of the miRNA is shown as SEQ ID No.1, uagcagcacauaaugguuugug SEQ ID No: 1; the precursor pre-miRNA can be processed into mature miRNA in cells through nuclease Dicer, and the sequence of the miRNA is shown in SEQ ID NO. 1.
Preferably, the disease caused by elevated KIF3B protein is triple negative breast cancer.
In another aspect, the invention provides a miRNA, a precursor pre-miRNA thereof, or a derivative thereof for preparing a beta-catenin protein inhibitor; the nucleotide sequence of the miRNA is shown as SEQ ID No.1, uagcagcacauaaugguuugug SEQ ID No: 1; the precursor pre-miRNA can be processed into mature miRNA in cells through nuclease Dicer, and the sequence of the miRNA is shown in SEQ ID NO. 1.
In a further aspect, the present invention provides a medicament comprising at least one of the above-mentioned miRNA, the above-mentioned precursor pre-miRNA, or a derivative thereof.
In the technical scheme of the invention, the medicine contains one or more pharmaceutically acceptable carriers.
In the technical scheme of the invention, the pharmaceutically acceptable carrier is preferably diluent, excipient, filler, adhesive, wetting agent, disintegrant, absorption enhancer, adsorption carrier, surfactant or lubricant;
in the technical scheme of the invention, the preparation form of the medicament is tablets, granules, capsules, oral liquid or injection, and the medicaments of various dosage forms can be prepared according to the conventional method in the pharmaceutical field.
In another aspect, the invention provides an application of a kit F3B detection reagent in preparation of a detection reagent for detecting triple-negative breast cancer.
In a further aspect of the invention there is provided an antibody to the aforementioned miRNA or derivative of miRNA.
Advantageous effects
(1) The invention provides miRNA-15a for inhibiting KIF3B gene and derivatives thereof, wherein the miRNA and the derivatives thereof can be specifically combined with a KIF3B nucleic acid sequence and specifically inhibit a Wnt/beta-catenin signal channel.
(2) The invention proves that the high expression of KIF3B is related to the proliferation, infection, migration, invasion and clonogenic capacity of triple negative breast cancer for the first time, and proves that the reduction of the expression of KIF3B can realize the inhibition of the proliferation, infection, migration, invasion and clonogenic capacity of triple negative breast cancer.
(3) The invention firstly proves that the reduction of the expression of KIF3B can increase the ubiquitination modification of the beta-catenin so as to increase the proteasome pathway degradation of the beta-catenin and inhibit the signal conduction of the Wnt/beta-catenin signal pathway.
(4) The miRNA and the derivative thereof obtained by screening can inhibit the migration, invasion and clone forming capability of triple negative breast cancer cells by blocking a Wnt/beta-catenin signal channel, can be used as a nucleic acid inhibiting medicine expressed by KIF3B protein, and can be used for preparing a medicine for preventing and/or treating triple negative breast cancer. Can be widely applied in the medical and biological fields and can generate huge social and economic benefits.
Drawings
FIG. 1 shows the results of the systematic proliferation, cloning, cell migration and invasion abilities of breast cancer according to examples 1-2. miR-15a inhibits the cell proliferation, clone formation, cell migration, invasion and other capabilities of MDA-MB-231 and MCF7 cell lines of breast cancer respectively, and the inhibition of miR-15a on breast cancer cells is independent of the expression of common targets such as ER, PR and HER 2. Wherein A is NCmicic miR-15a and miR-15a inhibitor, and a cell micrograph of MDA-MB-231 and MCF7 cell line cell migration and invasion results is shown, and B is NCmicic miR-15a and miR-15a inhibitor, and a numerical value statistical result of MDA-MB-231 and MCF7 cell line cell migration and invasion results is shown. C is a control, NCmicmic miR-15a and miR-15a inhibitor, the results of photographs of MDA-MB-231 and MCF7 cell lines, namely NCmicmic miR-15a and miR-15a inhibitor, and MDA-MB-231 and MCF7 cell lines are proliferated and cloned to form culture plates, and D is a C data statistical result chart.
FIG. 2 shows the experimental results of miRNA-15a down-regulating beta-catenin in example 3. miR-15a in the breast cancer cell line can inhibit downstream signals of a Wnt/beta-catenin pathway and can reduce survivin, cyclin D1, c-Myc and other genes related to cell proliferation and survival. Wherein, A and B show the results of detecting the levels of each component and whole cell protein aiming at MCF7 and MDA-MB-231 cell western blotting, and C and D are the results of the experiment of quantitatively detecting the expression of each gene by qPCR.
FIG. 3 shows the experimental results of miRNA-15a down-regulating beta-catenin in example 3. miR-15a can reduce the total protein level of beta-catenin, and can simultaneously reduce the protein level of beta-catenin which is used as a transcription factor in the nucleus.
FIG. 4 is a graph showing the results of inhibition of KIF3B to cause activation of Wnt/beta-catenin pathway downstream, and increasing the expression of proteins such as CyclinD1, c-Myc, survivin and the like, thereby causing cell proliferation and inhibiting apoptosis.
FIG. 5 is a graph of the results of the experiment in example 4, showing that the gene KIF3B is a target for miR-15a, and miR-15a inhibits KIF3B expression.
FIG. 6 is a graph of the results of the experiment in example 4, showing that inhibition of KIF3B can down-regulate Wnt/β -catenin pathway signaling.
Detailed Description
In order to make the aforementioned objects, features and advantages of the present invention more comprehensible, specific embodiments thereof are described in detail below, but the present invention is not to be construed as being limited to the implementable range thereof.
In the examples, each raw reagent material is commercially available, and the experimental method not specifying the specific conditions is a conventional method and a conventional condition well known in the art, or a condition recommended by an instrument manufacturer.
Example 1miRNA-15a inhibits migration and invasion of breast cancer cells
Firstly, breast cancer cells MCF7 and triple negative breast cancer cells MDA-MB-231 are mixed by 1 × 106Inoculating each cell/well in a 6-well cell culture plate, culturing for 24h with the culture medium volume of each well being 2mL, and replacing a fresh serum-carrying culture medium;
respectively diluting control NC micic, miR-15a micic and miR-15a inhibitor with a serum-free culture medium, and mixing the diluted control NC micic, miR-15a micic and miR-15a inhibitor with lipo3000 diluted with the serum-free culture medium, wherein 2 mu L of lipo3000 is added to each 1 mu g of RNA;
the nucleotide sequence of miRNA-15a is shown in SEQ ID No.1, uagcagcacauaaugguuugug SEQ ID No:1
Thirdly, adding the mixture obtained in the second step into a 6-hole cell culture plate in sequence, adding 2.5-5 mu g of RNA into each hole in an equal ratio, incubating for 12h, and replacing a new culture medium;
digesting the cells, resuspending the cells in a serum-free culture medium, respectively inoculating the cells into a transwell cell dish chamber and a transwell cell dish chamber pre-paved with matrigel, adding a culture medium with serum into the lower chamber, and erasing the cells on the upper side of the chamber by using a cotton swab after 24-36 hours;
washing the cells at the lower side of the chamber with PBS, fixing with 2% paraformaldehyde for 30min, staining with crystal violet solution for 45min, observing and taking pictures under a microscope, wherein the experimental results are shown in figures 1A and B, and show that: the miR-15a imic has an inhibition effect on migration and invasion of two breast cancer cell lines, and the miR-15a inhibitor has a promotion effect on migration and invasion of breast cancer cells, so that the miR-15a has an inhibition effect on migration and invasion of breast cancer cells, and is particularly effective on triple negative breast cancer.
Example 2MiRNA-15a inhibits clonogenic capacity of breast cancer cells
First, MCF7 and MDA-MB-231 were mixed at 1X 106Inoculating each cell/well in a 6-well cell culture plate, culturing for 24h with the culture medium volume of each well being 2mL, and replacing a fresh serum-carrying culture medium;
respectively diluting control PBS, negative control miRNA micic, miR-15a micic and miR-15a inhibitor with a serum-free culture medium, mixing with lipo3000 diluted with the same serum-free culture medium, and adding 2 mu L of lipo3000 to 1 mu g of RNA;
thirdly, adding the mixture obtained in the second step into a 6-hole cell culture plate in sequence, adding 2.5-5 mu g of RNA into each hole in an equal ratio, incubating for 12h, and replacing a new culture medium;
24h later, digesting and counting MCF7 and MDA-MB-231 cells in a logarithmic growth phase, inoculating the cells into a 6-hole cell culture dish at a density of 200 cells per hole, and replacing the cells with 0.5% FBS culture medium after the cells are attached to the wall;
fifthly, repeating the transfection step once every 3 days until 2 weeks or more cells are formed by cloning (the cell number is more than or equal to 60), washing the cells with PBS, fixing with 2% paraformaldehyde for 30min, staining with crystal violet for 45min, observing and counting under a microscope, wherein the experimental results are shown in figures 1C and D, and the results show that: the miR-15a imic has an inhibition effect on the proliferation of two breast cancer cell lines, and the miR-15a inhibitor has a promotion effect on the migration and proliferation of breast cancer, which proves that the miR-15a is effective in inhibiting the proliferation and cloning formation of breast cancer cells and also in treating triple negative breast cancer.
Example 3miRNA-15a inhibits the Wnt pathway and its downstream genes by downregulating beta-catenin
First, MCF7 and MDA-MB-231 were mixed at 1X 106Inoculating each cell/well in 6-well cell culture plate, and replacing fresh serum-carrying culture medium after overnight;
respectively diluting negative control miRNA micic, miR-15a micic and miR-15a inhibitor with a serum-free culture medium, and mixing the negative control miRNA micic, miR-15a micic and miR-15a inhibitor with lipo3000 diluted with the same serum-free culture medium, wherein 2 mu L of lipo3000 is added to each 1 mu g of RNA;
thirdly, adding the mixture obtained in the second step into a 6-hole cell culture plate in sequence, adding 5 mu g of RNA into each hole in equal proportion, incubating for 12h, and replacing a new culture medium;
fourthly, collecting cells after 48 hours, extracting RNA, and quantitatively detecting the expression of each gene by qPCR, wherein the result is shown in figures 2C and D;
collecting cells after 72h, separating a part of cell components, detecting the protein level of each component and whole cell by western blotting, and obtaining the experimental result shown in figure 2A, B and figure 3.
The experimental results show that: the miR-15a micic can effectively reduce the protein level of cell beta-catenin, thereby inhibiting the expression of downstream genes of a Wnt/beta-catenin pathway, such as CCND1 and survivin; the miR-15a inhibitor can up-regulate the protein level of the beta-catenin and activate the Wnt/beta-catenin pathway and the expression of downstream genes thereof. This demonstrates that miR-15a can inhibit tumor cells by inhibiting Wnt/beta-catenin pathway signaling in breast cancer.
Example 4MiRNA-15a Regulation of beta-catenin by inhibition of KIF3B expression
Constructing KIF3B-U1-WT and KIF 3B-U1-mut stable transfection plasmids with Luciferase reporter genes respectively, transfecting HEK293T cells respectively and stably screening;
transfecting the cells in the step by using negative controls miR-NC and miR-15a imic respectively, collecting the cells and measuring luciferase assay, wherein the result is shown in a figure 4B;
transfecting MDA-MB-231 cells by using negative controls miR-NC and miR-15a imic respectively, collecting the cells after 48 hours, and detecting the expression level of KIF3B protein by using western blotting, wherein the result is shown in figure 4A;
synthesizing siRNA inhibiting KIF3B, transiently transfecting MDA-MB-231 breast cancer cell line according to the steps, collecting cells after 48h, and detecting protein level by western blotting, wherein the results are shown in FIGS. 5-6.
The experimental results show that: the KIF3B gene is a miR-15a target, and miR-15a can effectively reduce the expression of KIF3B protein in a triple negative breast cancer cell line MDA-MB-231; the Wnt/beta-catenin signal channel can be inhibited by down-regulating KIF3B, which shows that miR-15a can inhibit the level of KIF3B protein to down-regulate the Wnt/beta-catenin signal channel and play a role in inhibiting triple negative breast cancer.
SEQUENCE LISTING
<110> Shenzhen International institute for graduate of Qinghua university
<120> application of miRNA-15A in treatment of KIF3B high-expression tumor
<130> CP121010579C
<160> 1
<170> PatentIn version 3.3
<210> 1
<211> 22
<212> RNA
<213> Artificial sequence
<400> 1
uagcagcaca uaaugguuug ug 22
Claims (10)
1. The application of miRNA, a pre-miRNA precursor thereof or a derivative thereof in preparing a medicament for inhibiting proliferation of a tumor cell with high expression of KIF3B and promoting apoptosis of the tumor cell with high expression of KIF 3B; the nucleotide sequence of the miRNA is shown as SEQ ID No.1, uagcagcacauaaugguuugug SEQ ID No: 1; the precursor pre-miRNA can be processed into mature miRNA in cells through nuclease Dicer, and the sequence of the mature miRNA is shown in SEQ ID NO. 1;
preferably, the tumor cells highly expressing KIF3B are selected from triple negative breast cancer cell lines.
2. The application of miRNA and derivatives of miRNA in preparing medicines for reducing proliferation, migration, invasion and clonogenic capacity of KIF 3B-highly-expressed tumor cells; the nucleotide sequence of the miRNA is shown as SEQ ID No.1, uagcagcacauaaugguuugug SEQ ID No: 1; the precursor pre-miRNA can be processed into mature miRNA in cells through nuclease Dicer, and the sequence of the mature miRNA is shown in SEQ ID NO. 1;
preferably, the tumor cells highly expressing KIF3B are selected from triple negative breast cancer cell lines.
3. The application of miRNA, precursor pre-miRNA and derivatives of miRNA in preparing medicines for treating high-expression KIF3B tumor diseases; the nucleotide sequence of the miRNA is shown as SEQ ID No.1, uagcagcacauaaugguuugug SEQ ID No: 1; the precursor pre-miRNA can be processed into mature miRNA in cells through nuclease Dicer, and the sequence of the mature miRNA is shown in SEQ ID NO. 1;
preferably, the tumor disease highly expressing KIF3B is selected from breast cancer, more preferably triple negative breast cancer.
4. Use of a miRNA, a pre-miRNA precursor thereof, or a derivative thereof in the preparation of a KIF3B protein inhibitor; the nucleotide sequence of the miRNA is shown as SEQ ID No.1, uagcagcacauaaugguuugug SEQ ID No: 1; the precursor pre-miRNA can be processed into mature miRNA in cells through a nuclease Dicer, and the sequence of the mature miRNA is shown in SEQ ID NO. 1.
5. Use of a miRNA, a pre-miRNA precursor thereof, or a derivative thereof in the manufacture of a medicament for the treatment of a disease caused by an increase in KIF3B protein; the nucleotide sequence of the miRNA is shown as SEQ ID No.1, uagcagcacauaaugguuugug SEQ ID No: 1; the precursor pre-miRNA can be processed into mature miRNA in cells through nuclease Dicer, and the sequence of the miRNA is shown in SEQ ID NO. 1;
preferably, the disease caused by elevated KIF3B protein is triple negative breast cancer.
6. The application of miRNA, precursor pre-miRNA thereof, or derivative thereof in preparing beta-catenin protein inhibitor; the nucleotide sequence of the miRNA is shown as SEQ ID No.1, uagcagcacauaaugguuugug SEQ ID No: 1; the precursor pre-miRNA can be processed into mature miRNA in cells through a nuclease Dicer, and the sequence of the mature miRNA is shown in SEQ ID NO. 1.
7. A medicament for inhibiting triple negative breast cancer, said medicament comprising a miRNA, at least one of the precursor pre-miRNA or a derivative thereof; the nucleotide sequence of the miRNA is shown as SEQ ID No.1, uagcagcacauaaugguuugug SEQ ID No: 1; the precursor pre-miRNA can be processed into mature miRNA in cells through a nuclease Dicer, and the sequence of the mature miRNA is shown in SEQ ID NO. 1.
8. The medicament of claim 7, wherein said medicament comprises one or more pharmaceutically acceptable carriers.
9. The pharmaceutical according to claim 7 or 8, wherein the pharmaceutical is in the form of tablet, granule, capsule, oral liquid or injection, and the pharmaceutical in each dosage form can be prepared according to the conventional method in the pharmaceutical field.
10. An application of a detection reagent for detecting KIF3B in preparing a detection reagent for detecting triple negative breast cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111115890.7A CN113750111A (en) | 2021-09-23 | 2021-09-23 | Application of miRNA-15A in treatment of KIF3B high-expression tumor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111115890.7A CN113750111A (en) | 2021-09-23 | 2021-09-23 | Application of miRNA-15A in treatment of KIF3B high-expression tumor |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113750111A true CN113750111A (en) | 2021-12-07 |
Family
ID=78797055
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111115890.7A Pending CN113750111A (en) | 2021-09-23 | 2021-09-23 | Application of miRNA-15A in treatment of KIF3B high-expression tumor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113750111A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1719973A (en) * | 2002-11-13 | 2006-01-11 | 托马斯杰斐逊大学 | Compositions and methods for cancer diagnosis and therapy |
| WO2006128245A1 (en) * | 2005-06-03 | 2006-12-07 | Southern Adelaide Health Service-Flinders Medical Centre | Targeting cells with altered microrna expression |
| US20100035966A1 (en) * | 2006-06-14 | 2010-02-11 | Rosetta Inpharmatics Llc | Methods and compositions for regulating cell cycle progression |
| CN110950931A (en) * | 2019-12-13 | 2020-04-03 | 清华大学深圳国际研究生院 | Polypeptide for specifically targeting triple negative breast cancer stem cells and application thereof |
-
2021
- 2021-09-23 CN CN202111115890.7A patent/CN113750111A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1719973A (en) * | 2002-11-13 | 2006-01-11 | 托马斯杰斐逊大学 | Compositions and methods for cancer diagnosis and therapy |
| WO2006128245A1 (en) * | 2005-06-03 | 2006-12-07 | Southern Adelaide Health Service-Flinders Medical Centre | Targeting cells with altered microrna expression |
| US20100035966A1 (en) * | 2006-06-14 | 2010-02-11 | Rosetta Inpharmatics Llc | Methods and compositions for regulating cell cycle progression |
| CN110950931A (en) * | 2019-12-13 | 2020-04-03 | 清华大学深圳国际研究生院 | Polypeptide for specifically targeting triple negative breast cancer stem cells and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| YOSHIAKI SHINDEN ET AL.: ""Diminished Expression of MiR-15a Is an Independent Prognostic Marker for Breast Cancer Cases"", 《ANTICANCER RESEARCH》, vol. 35, no. 2015, pages 123 - 128 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yang et al. | RETRACTED: Exosome-derived miR-130a activates angiogenesis in gastric cancer by targeting C-MYB in vascular endothelial cells | |
| Xu et al. | MicroRNA-193b regulates proliferation, migration and invasion in human hepatocellular carcinoma cells | |
| Qian et al. | Pivotal role of reduced let-7g expression in breast cancer invasion and metastasis | |
| Zhang et al. | miR-1266 contributes to pancreatic cancer progression and chemoresistance by the STAT3 and NF-κB signaling pathways | |
| Li et al. | MicroRNA-21: a ubiquitously expressed pro-survival factor in cancer and other diseases | |
| Hwang et al. | MicroRNA-146a suppresses metastatic activity in brain metastasis | |
| JP2018507866A (en) | Pharmaceutical composition for cancer treatment comprising microRNA as an active ingredient | |
| Li et al. | MiR-124 down-regulation is critical for cancer associated fibroblasts-enhanced tumor growth of oral carcinoma | |
| Li et al. | miR-124 functions as a tumor suppressor in the endometrial carcinoma cell line HEC-1B partly by suppressing STAT3 | |
| Pan et al. | Role of microRNAs in remodeling the tumor microenvironment | |
| Abulsoud et al. | The potential role of miRNAs in the pathogenesis of salivary gland cancer–A Focus on signaling pathways interplay | |
| Zou et al. | miR-362-3p targets nemo-like kinase and functions as a tumor suppressor in renal cancer cells | |
| Liu et al. | miR-371-5p down-regulates pre mRNA processing factor 4 homolog B (PRPF4B) and facilitates the G1/S transition in human hepatocellular carcinoma cells | |
| Wang et al. | Role of exosomal miR‑21 in the tumor microenvironment and osteosarcoma tumorigenesis and progression | |
| Zhang et al. | MiR-520b suppresses proliferation of hepatoma cells through targeting ten-eleven translocation 1 (TET1) mRNA | |
| Chen et al. | circ-PRKCI targets miR-1294 and miR-186-5p by downregulating FOXK1 expression to suppress glycolysis in hepatocellular carcinoma | |
| Zhang et al. | A miR-124/ITGA3 axis contributes to colorectal cancer metastasis by regulating anoikis susceptibility | |
| Wangyang et al. | NcRNAs and cholangiocarcinoma | |
| Yue et al. | MicroRNA‑124 negatively regulates chloride intracellular channel 1 to suppress the migration and invasion of liver cancer cells | |
| Yuan et al. | Downregulation of PDCD4 by miR‑21 suppresses tumor transformation and proliferation in a nude mouse renal cancer model | |
| Mirzaei et al. | MicroRNAs regulating SOX2 in cancer progression and therapy response | |
| Li et al. | MiR-422a targets MAPKK6 and regulates cell growth and apoptosis in colorectal cancer cells | |
| Chen et al. | Crosstalk between extracellular vesicles and tumor-associated macrophage in the tumor microenvironment | |
| CN103861121A (en) | Use of micro-RNA molecule miR491-5p in treatment and/or diagnosis and/or prognosis of pancreatic cancer | |
| Guo et al. | Anti‑microRNA‑21/221 and microRNA‑199a transfected by ultrasound microbubbles induces the apoptosis of human hepatoma HepG2 cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |