CN103861121A - Use of micro-RNA molecule miR491-5p in treatment and/or diagnosis and/or prognosis of pancreatic cancer - Google Patents

Abstract

The present invention relates to a use of micro-RNA molecule miR491-5p in treatment and/or diagnosis and/or prognosis of pancreatic cancer, and particularly discloses a use of the micro-RNA molecule miR491-5p in preparation of pancreatic cancer treatment drugs. The present invention further discloses a use of the micro-RNA molecule miR491-5p in preparation of an apparatus for diagnosis and/or prognosis of pancreatic cancer. According to the present invention, the miR491-5p presents differential expression between the normal pancreas and the pancreatic cancer tissue, can be used as the pancreatic cancer diagnosis marker, and can further be used as the active ingredient so as to be used for preparing the pancreatic cancer treatment drug.

Description

The purposes of microRNA molecules miR491-5p in treatment and/or diagnosis and/or the prognosis of cancer of pancreas

Technical field

The present invention relates to biomedicine field, relate to gene therapy and/or gene diagnosis field; Purposes in particular to microRNA molecules in the medicine for the preparation for the treatment of cancer of pancreas and the microRNA molecules purposes in the device for the preparation of diagnosis and/or prognosis cancer of pancreas; More specifically, relate to purposes and the miR491-5p purposes in device for the preparation of diagnosis and/or prognosis cancer of pancreas of miR491-5p in the medicine for the preparation for the treatment of cancer of pancreas.

Background technology

Microrna (microRNA or miRNA) is a kind of novel gene regulation factor that can initiatively participate in physiology and pathological process.Such RNA is the little RNA of non-coding that a class length is about 21-25 nucleotide (nt), and its function is expression (Bartel, D.P., 2004 at post-transcriptional level regulation and control target gene; Kim, the people such as V.N., 2009).

Although the generation of functional miRNA is defined as several different stages, as initial miRNA(pi-miRNA), precursor miRNA (pre-miRNA) and ripe miRNA etc., but in cell this process be in fact one by kytoplasm the continuous course of processing to karyon.In nucleus, first transcription product forms an initial pi-miRNA with neck ring structure, pi-miRNA processes the hair fastener type intermediate product into about 70nt through the double-stranded RNA nuclease Drosha of nucleoprotein DGCR8 and karyon subsequently, the miRNA before maturation, being known as precursor miRNA is pre-miRNA(Lee, Y. wait people, 2003; Han, the people such as J., 2004).Pre-miRNA is through the white 5(exportin 5 of outer turning egg(s) on nucleopore) and the combined effect of GTP-Ran be transported to endochylema (Lund, the people such as E., 2004; Bohnsack, the people such as M.T., 2004).At endochylema, another double-stranded RNA nuclease Dicer is processed into pre-miRNA the ripe miRNA(Ketting of 21-25nt, the people such as R.F., 2001; Hutvagner, the people such as G., 2001).Except Dicer, the reticent complex (RISC) of the RNA induction forming also comprises Ago protein family member, and its effect is to take ripe miRNA to target gene mRNA(Maniataki, the people such as E., 2005; Gregory, the people such as R.I., 2005; Chendrimada, the people such as T.P., 2005).

Cancer of pancreas is a kind ofly there is no early symptom and very high affecting conditions (Jemal, the people such as A., 2010 of fatality rate in crowd; Krejs, G.J.2010; Lowenfels, the people such as A.B., 2006).Normal Pancreas mainly contains the formations such as ductal epithelial cell, islet cells and acinus, and the cell that has 70-80% in islets of langerhans is beta Cell of islet.80% cancer of pancreas is brought out by ductal epithelial cell.Due to the screening of cancer of pancreas biomarker the early diagnosis to disease and prognosis all very important, therefore this respect work had received very large concern (Wang, the people such as J., 2011) in the last few years.With cancer of pancreas and the control tissue sample thereof of the fixing paraffin-embedded cancer of pancreas sample of formaldehyde and excision, on miRNA chip, carry out extensive miRNA expression pattern analysis research and find to have at least 40 kinds of miRNA significantly to be raised or lower (Bloomston, M. wait people, 2007; Szafranska, the people such as A.E, 2007; Jiao, the people such as L.R., 2012; Ali, the people such as S., 2012; Papaconstantinou, the people such as I.G., 2012).The miRNA of some variant expression as miR-21, miR-155 and miR-196a-2 may be relevant with the propagation of tumor and poor prognosis.

But, in these extensive miRNA chip examination processes, do not detect hsa-miR491-5p(be called for short miR491-5p) with cancer of pancreas occur dependency.The inventor studies show that, miR49-5p expression in normal person's pancreatic tissue is very high, and expression is lower in pancreatic cancer cell, therefore there is the effect that suppresses potentially cancer of pancreas propagation, likely the treatment on cancer of pancreas and diagnosis and/or prognosis produce actively impact.

Summary of the invention

According to an aspect of the present invention, the invention provides the purposes of microRNA molecules miR491-5p in the medicine for the preparation for the treatment of cancer of pancreas.

In some concrete embodiments, wherein said miR491-5p is selected from one or more of following form: the precursor miRNA of initial miRNA, the miR491-5p of miR491-5p or ripe miR491-5p.

In a preferred embodiment, described miR491-5p is ripe miR491-5p.

In some concrete embodiments, ripe miR491-5p is the RNA as shown in SEQ ID NO:1.

In other concrete embodiments, ripe miR491-5p processes the RNA of the DNA shown in SEQ ID NO:2 freely.

Sequence SEQ ID NO:1 as above is made up of 23 nucleotide, and its 3 ' terminal nucleotide sequence can form approximately 7 nucleotide with target gene 5 ' end mates completely, forms Seed Sequences (seed sequence).

Sequence SEQ ID NO:2 is a sequence that size is 1470-bp, and it is positioned on No. 9 chromosomes of people.SEQ ID NO:2 is after suitable vector expression, the initial miRNA(that can produce miR491-5p also makes pi-miR491-5p herein), and then be processed into the precursor miRNA (also making pre-miR491-5p herein) of miR491-5p, being finally processed as ripe miR491-5p(is the RNA shown in SEQ ID NO:1).

Therefore, some preferred embodiment in, miR491-5p is ripe miR491-5p.

Described ripe miR491-5p can be the miR491-5p of rna form, i.e. RNA as shown in SEQ ID NO:1; It can be natural generation or synthetic.In some concrete embodiments, the RNA shown in SEQ ID NO:1 is synthetic.

In other concrete embodiments, described ripe miR491-5p can process the RNA from the DNA shown in sequence SEQ ID NO:2; Preferably, obtain by being present in the DNA processing shown in the SEQ ID NO:2 in expression vector; Described expression vector can be viral vector or carrier for expression of eukaryon.

Viral vector can be any suitable carrier, includes but not limited to retroviral vector, adenovirus vector, adeno-associated virus (AAV) carrier, herpesvirus (for example herpes simplex virus, vaccinia virus and Epstein-Barr virus) carrier, Alphavirus carrier.In some concrete embodiments, expression vector is retroviral vector pLNCX2.

Carrier for expression of eukaryon can be any suitable expression vector, include but not limited to pCMV-Myc expression vector, pcDNA3.0 expression vector, pcDNA3.1 expression vector, pEGFP expression vector, pEF Bos expression vector, pTet expression vector, pTRE expression vector or on the basis of known expression vector through the carrier of transformation, such as pBin438, pCAMBIA1301 etc.

Although in some embodiments, expression vector is retroviral vector pLNCX2, but should be understood to, those skilled in the art can select suitable carrier according to experimenter to be administered, sequence to be administered, the pending factor such as disease, route of administration.

In some concrete embodiments, described medicine comprises miR491-5p; Preferably, described medicine comprises ripe miR491-5p, comprises the RNA as shown in SEQ ID NO:1.

In other concrete embodiments, described medicine comprises the expression vector that comprises the DNA shown in SEQ ID NO:2.

When needs, in described medicine, can also add one or more pharmaceutically acceptable carriers.Described pharmaceutically acceptable carrier includes but not limited to diluent, buffer agent, suspensoid, Emulsion, granule, encapsulation agents, excipient, filler, binding agent, spray, cutaneous permeable agent, wetting agent, disintegrating agent, absorption enhancer, surfactant, coloring agent, correctives or absorption carrier.

In some concrete embodiments, described medicine can be made the dosage form, injection, tablet, powder, granule, the capsule that include but not limited to microinjection agent, be suitable for transfection.The medicine of above-mentioned various dosage forms all can be according to the conventional method preparation of pharmaceutical field.

In some concrete embodiments, described medicine can be used separately; Or carry out combined administration with antibiotic, immunostimulant etc.

In some concrete embodiments, described medicine can be used (ex vivo approach) in vitro: import in vitro or transfection human body self or variant cell (or heterogenous cell) by miR491-5p or containing the carrier of the DNA shown in SEQ ID No.2, after cell in vitro amplification, defeated the Huis' body.In some concrete embodiments, miR491-5p or the carrier containing the DNA shown in SEQ ID No.2 are used to cell by vitro approach.

In other concrete embodiments, described medicine can be used (in vivo approach): miR491-5p or directly import in body containing the carrier of the DNA shown in SEQ ID No.2 in body.This carrier can be virus type or non-viral, or even naked DNA or RNA.

Described experimenter is selected from the mankind, mice, Canis familiaris L., rabbit, cattle or monkey; The preferably mankind, monkey or mice; The most preferably mankind.In some concrete embodiments, experimenter is the mankind; More specifically, be the mankind's organ, tissue, cell; Preferably mankind's pancreas, pancreatic tissue, pancreatic cell; More preferably, suffer from the mankind's of cancer of pancreas pancreas, Pancreatic Adenocarcinoma, pancreatic cancer cell; Most preferably, human pancreatic adenocarcinoma cell.

It will be appreciated by those skilled in the art that the miR491-5p that uses to experimenter or the amount containing the carrier of the DNA shown in SEQ ID No.2, be one as calculated, produce the predetermined amount of active substance of required therapeutical effect.Pin for purposes of the invention, the miR491-5p using to experimenter or the amount containing the carrier of the DNA shown in SEQ ID No.2, refer to can be statistically remarkable anticancer propagation and/or cause cancer cell-apoptosis and predetermined amount.At the medicine for the manufacture of for purposes of the present invention, based on factors such as experimenter's feature (such as age well known in the art, sex, body weight, complication, medical history, inherited genetic factors, Other diseases etc.), disease severity, support, route of administration, common healthcare givers can determine the miR491-5p using to experimenter or the amount that contains the carrier of the DNA shown in SEQ ID No.2.

According to a further aspect in the invention, the invention provides the purposes of microRNA molecules miR491-5p in the device for the preparation of diagnosis and/or prognosis cancer of pancreas.

Wherein said miR491-5p is selected from one or more of following form: the precursor miRNA of initial miRNA, the miR491-5p of miR491-5p or ripe miR491-5p.

In a preferred embodiment, described miR491-5p is ripe miR491-5p.

In some concrete embodiments, ripe miR491-5p is the RNA as shown in SEQ ID NO:1.Although that use in some specific embodiment is the ripe miR491-5p as shown in SEQ ID NO:1, but those skilled in the art can expect, initial miRNA(pi-miR491-5p), precursor miRNA (pre-miR491-5p) can obtain the technique effect same with ripe miR491-5p, because cell is had the ability further by initial miRNA(pi-miR491-5p), precursor miRNA (pre-miR491-5p) is processed as ripe miR491-5p.

In other concrete embodiments, ripe miR491-5p is the RNA of processing from the DNA shown in SEQ ID NO:2.

In some concrete embodiments, described device is test kit, and it comprises that RNA extracts reagent, buffer system, reverse transcription reagent, pcr amplification reagent, primer pair and operation instructions for miR491-5p.

In some concrete embodiments, be the DNA shown in SEQ ID NO:3 and SEQ ID NO:4 for the primer pair of miR491-5p.

Below in conjunction with the drawings and specific embodiments, the present invention is described in further details.

Accompanying drawing explanation

Fig. 1 shows the histiocyte expression pattern analysis of miR491-5p, the differential expression of A:miR491-5p in adult's tissue; The differential expression of B:miR491-5p in 18 kinds of tissues having reported; The differential expression of C:miR491-5p in adult tissue, embryonal tissue and pancreatic cancer cell.

Fig. 2 shows miR491-5p differential expression in normal person's pancreas and human pancreatic cancer cell.

The expression of Fig. 3 Explicit Expression carrier pLNCX2-G491 in 293 cells.

Fig. 4 shows that miR491-5p is in TP53 and the forecast analysis of Bcl-XL gene 3 ' UTR target site.

Fig. 5 demonstration, by semi-quantitative RT-PCR analysis result, the inhibitory action of the expression of the transfection of the RNA shown in carrier pLNCX2-G491 or SEQ ID No.1 to target gene TP53 and Bcl-XL, A: the transfection of carrier pLNCX2-G491; The transfection of RNA shown in B:SEQ ID No.1.

Fig. 6 demonstration, by real-time quantitative RT-PCR analysis result, the inhibitory action of the expression of the transfection of the RNA shown in carrier pLNCX2-G491 or SEQ ID No.1 to target gene TP53 and Bcl-XL, A: the transfection of carrier pLNCX2-G491; The transfection of RNA shown in B:SEQ ID No.1.

Fig. 7 shows after the RNA shown in transfection carrier pLNCX2-G491 or SEQ ID No.1, the protein expression level of target gene TP53 and Bcl-XL, A: the transfection of carrier pLNCX2-G491; The transfection of RNA shown in B:SEQ ID No.1.

Fig. 8 shows after the RNA shown in the each dosage pLNCX2-G491 of transfection or SEQ ID No.1 24,48 and 72 hours, the inhibitory action of the propagation to SW1990 cell.

Fig. 9 shows after the RNA shown in the each dosage SEQ of transfection ID No.1, A: the fluidic cell figure of pancreatic cancer cell SW1990; The positive ratio of B:SW1990 cell annexin V list (early apoptosis); The two positive ratios (apoptosis in late period) of C: annexin V/PI.

Figure 10 shows after the each dosage miR491-5p of transfection, participates in the albumen of apoptosis pathway or the expression of the factor of intrinsic mitochondrion mediation, and beta-actin is as internal reference, and left side numeral is molecular weight.

Figure 11 shows after the each dosage miR491-5p of transfection, participates in PI-3K/Akt and the albumen of STAT3 signal path or the expression of the factor, and beta-actin is as internal reference, and left side numeral is molecular weight.

The specific embodiment

Term

Term " miR491-5p " unless otherwise as used herein, in the time mentioning miR491-5p, it initial miRNA(that comprises miR491-5p also makes pi-miR491-5p), precursor miRNA (also making pre-miR491-5p) and the ripe miR491-5p of miR491-5p.

Term " processing " refers to the process that obtains ripe miR491-5p from DNA as used herein; With regard to current scientific and technological level, it has been generally acknowledged that processing comprises the steps: that DNA obtains pri-miRNA, pri-miRNA and in nucleus, cut into pre-miRNA, pre-miRNA by Drosha and under the effect of transport protein exportin-5, forward in by core in kytoplasm, then further cut and produced ripe miRNA by Dicer through transcribing; Wherein said DNA can be from chromosomal DNA or exchromosomal DNA or even from carrier DNA; It will be appreciated by those skilled in the art that, although the detailed process details of " processing " described herein and concrete mechanism thereof are not disclosed fully up hill and dale by the research worker of global range institute, but this does not hinder the realization of " processing ", in the middle of eukaryotic cell, cell can complete voluntarily " processing " and produce pri-miRNA described herein, pre-miRNA and ripe miRNA.

Embodiment

The concrete material and the source thereof that in embodiment of the present invention, use are below provided.But, should be understood that, these are only exemplary, are not intended to limit the present invention, with material as same or analogous in the type of undertissue, cell, reagent and instrument, model, quality, character or function all can for implement the present invention.

In following embodiment, method therefor is conventional method if no special instructions, and concrete steps can be referring to " Molecular Cloning:A Laboratory Manual " (Sambrook, J., Russell, David W., 2001).The primer and DNA, RNA sequence are synthesized by the raw work in Shanghai.

Material:

Note:

1. unless otherwise, the present invention's chemistry, biological reagent used can be any suitable commercial reagent;

2. above-mentioned cell line all can commercially availablely obtain.

The histiocyte expression pattern analysis of embodiment 1.miR491-5p detects

Be handled as follows:

Human embryonic kidney cell line 293, human hepatoma cell line HepG2, human lung cancer cell line A549, human pancreatic cancer cell Cap-1 and SW1990 increase in Tissue Culture Dish; Every kind of each collection at least 5 × 10 of cell ⁶individual; With 1mLTRIzol processing, add 150 μ l chloroforms, centrifuging and taking supernatant after mixing; In supernatant, add isopyknic isopropanol precipitating, obtain cell total rna;

Extract the total RNA of normal adult tissue (people's lung, people's kidney, human brain, people liver, people's spleen and human pancreas) and normal person's embryo tissue (people's embryo liver, people's embryo spleen and people's embryo pancreas);

Getting the total RNA of 100ng is that template is carried out poly(A) RT-qPCR analyzes (Zhang, the people such as J., 2008), and instrument is iQ5 PCR in real time detection system (U.S. Bio-Rad laboratory), and the primer is:

SEQ ID No.3:5 '-agtggggaacccttccatga-3 ' (forward primer)

SEQ ID No.4:5 '-tctcagggtccgaggtattc-3 ' (reverse primer);

Under the guiding of 5 '-cgactcgatccagtctcagggtccgaggtattcgatcgagtcgcactttttttttt t-3 ' (SEQ ID No.5), carry out one-step method reverse transcription-polymerase chain reaction by the chimeric method of SYBR Green I and detect miR-491-5p expression, take U6snRNA as internal reference, the amplimer sequence of U6snRNA is:

SEQ ID No.6:5 '-ctcgcttcggcagcaca-3 ' (forward primer)

SEQ ID No.7:5 '-aacgcttcacgaatttgcgt-3 ' (reverse primer)

Reverse transcription reaction condition is: first 42 ℃, and 5 minutes; PCR condition is: 95 ℃ 10 seconds; 95 ℃ 5 seconds, 60 ℃ 10 seconds, repeat 40 circulations;

The condition of dissociating of reactant is 55 ℃ to 95 ℃ and heats up 0.2 ℃ for every 10 seconds.

Result:

Show that miR-491-5p all has higher expression in adult pancreas, people's embryo pancreas, adult brain tissue, wherein with the highest (Fig. 1 of the expression in adult pancreas, A), once detected that the expression of miR-491-5p in adult pancreas was higher than its approximately 4800 times of level (Fig. 1, C) in adult human liver.With tissue specific expression spectrum discovery (Fig. 1 of miRNAmap analysis software retrieval miR-491-5p, B), in 18 kinds of detected tissues reporting, the expression the highest http://mirnamap.mbc.nctu.edu.tw/php/mirna_entry.php acc=MI0003126 of miR-491-5p in brain.

Embodiment 2.miR491-5p and cancer of pancreas generation correlation detection

Extraction pancreatic carcinoma Cap-1, pancreatic carcinoma SW1990 are outer, total RNA of pancreatic carcinoma Mia, pancreatic carcinoma AsPC-1;

Obtain the total RNA of normal person's beta Cell of islet, the total RNA of normal person's sternzellen;

With poly(A) RT-qPCR detects.

Result:

MiR491-5p is high expressed in normal person's pancreatic tissue, and the expression in pancreatic carcinoma Mia and AsPC-1 cell is also very low, detects beta Cell of islet and pancreatic stellate cells miR491-5p expression and also maintains lower level (Fig. 2).The unconventionality expression that shows miR491-5p is probably relevant to the generation of cancer of pancreas.

Structure and the detection of embodiment 3.miR-491-5p expression vector

From miRNA data base, (http://microrna.sanger.ac.uk/sequences/) finds position and the concrete sequence information (SEQ ID No.2) of miR-491-5p on genome;

According to genome sequence, determine the particular location of pri-miR491-5p;

At the interval design of the 500-800bp of pri-miR-491-5p site upstream and downstream Auele Specific Primer: SEQ ID No.8:5 '-ttagatctacagaagctgcacacataca-3 ' (forward primer)

SEQ ID No.9:5 '-ttgtcgactatctcaactgctgccatca-3 ' (reverse primer);

The pcr amplification that carries out target sequence take the genomic DNA of HEK293T cell as template, amplification condition is 94 ℃ of degeneration 5 minutes, then 94 ℃ 30 seconds, 50 ℃ 30 seconds, 72 ℃ 90 seconds, totally 35 circulations, last 72 ℃ 10 minutes;

Pcr amplification product is carried out to 1% agarose gel electrophoresis detection;

Reclaiming test kit with DNA reclaims length about 1470bp object fragment and it is carried out to purification;

Recovery fragment is carried out to T-A clone with pMD-18T simple test kit and connect, form carrier pMD-18T-G491;

It is the sequence of SEQ ID NO:2 really that gained PCR product is examined in order-checking;

The G491 sequence product of confirming, after the digestion of BglII/SalI double digestion, is carried out to 1% agarose gel electrophoresis detection;

Reclaim the object fragment of the about 1470bp of test kit recovery length with DNA;

The 1470bp product of purification is subcloned into the BglII/SalI site of pLNCX2 carrier, forms expression vector pLNCX2-G491;

By 5 × 10 ⁶the 293T cell of/mL is laid in 35mm culture dish;

In the time that cell covers 80%, adopt transfection reagent Vigofect that the pLNCX2-G491 carrier DNA of 3 μ g is proceeded to 293T cell;

After transfection 48 hours, collecting cell is in 1.5ml centrifuge tube;

With 1mL TRIzol processing cell, add 150 μ l chloroforms, mix rear centrifuging and taking supernatant, add the isopropanol precipitating of equivalent, after high speed centrifugation, obtain total RNA;

Adopt the method for embodiment 1 to detect the expression of miR-491-5p in 293T cell.

Result:

Transfection expression carrier pLNCX2-G491 can significantly promote the expression (Fig. 3) of miR491-5p in 293T cell effectively, and this experimental results show that the feasibility of the intracellular ripe miR491-5p level of artificial raising.

Embodiment 4.miR-491-5p can effectively identify target gene TP53 and Bcl-XL and suppress its expression

Because miR-491-5p has obvious differential expression at normal pancreatic tissue and Pancreatic Adenocarcinoma, therefore miR-491-5p likely brings into play antioncogene effect in normal pancreatic tissue.Inventor utilizes bioinformatic analysis software to predict the potential target gene of miR-491-5p.For improving the accuracy of software prediction, three kinds of miRNA forecasting softwares (DIANA-MICROT, MICRORNA, TARGETSCAN) are used for finding the miR-491-5p target gene relevant to cancer of pancreas simultaneously.

Inventor sets only has the target gene that is simultaneously predicted as high score by two or more analysis software just can be defined as positive target gene.Final confirm TP53(nt1382-1404 (NM_000546)) and Bcl-XL(nt1503-1525 (NM_138578)) 3 ' UTR potential recognition site (Fig. 4) of containing miR-491-5p.

Adopt two kinds of methods to detect the inhibitory action (with RNA as SEQ ID No.1 as shown in the respectively transfection SW1990 of constructed expression vector pLNCX2-G491 or synthetic) of miR-491-5p to TP53 and Bcl-XL gene expression:

By 5 × 10 ⁶the SW1990 cell of/mL is laid in 35mm culture dish;

In the time that cell covers 80%, by transfection reagent and the RNA shown in the pLNCX2-G491(of various dose or the SEQ ID No.1 of synthetic) mix and distinguish afterwards transfectional cell, in order to keep the total amount of application of each experimental group identical, with empty carrier pLNCX2 or as negative control sequence miRNA NC(5 '-uucuccgaacgugucacguuu-3 ') carry out polishing, miRNA NC is one section of synthetic, in cell without any the random sequence of function;

After incubated at room 15 minutes, dropwise add the SW1990 cell that newly changes liquid;

Hatch after 2 hours for 37 ℃, change whole serum culture fluid;

After 48 hours by cell harvesting in 1.5ml centrifuge tube;

Part cell is processed with 1mL TRIzol, adds 150 μ l chloroforms, mixes rear centrifuging and taking supernatant, adds the isopropanol precipitating of equivalent, obtains total RNA after high speed centrifugation;

Another part cell carries out full lysis with cell pyrolysis liquid ice bath, after high speed centrifugation, collects cell pyrolysis liquid supernatant, detects the protein concentration of lysate by BCA method;

Detect the impact of the expression of miR-491-5p on target gene by sxemiquantitative and real-time quantitative RT-PCR method, the primer is:

TP53 gene:

SEQ ID No.10:5 '-atcacactggaagactccag-3 ' (forward primer)

SEQ ID No.11:5 '-ctgacgcacacctattgcaa-3 ' (reverse primer);

Bcl-XL gene:

SEQ ID No.12:5 '-ggtggttgactttctctcct-3 ' (forward primer)

SEQ ID No.13:5 '-gcatctccttgtctacgctt-3 ' (reverse primer);

Internal reference contrast beta-actin:

SEQ ID No.14:5 '-cacactgtgcccatctacga-3 ' (forward primer)

SEQ ID No.15:5 '-ctgcttgctgatccacatct-3 ' (reverse primer);

Reverse transcription reaction condition is: first 50 ℃ 35 minutes; Then 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 40 seconds, totally 25 circulations, last 72 ℃ 10 minutes;

After reaction finishes, pcr amplification product is carried out to 1% agarose gel electrophoresis detection, result as shown in Figure 5 A and 5B;

In addition, carry out protein level detection to collecting sample, each experimental point is respectively got 15 μ g total proteins and is carried out electrophoretic separation, after separating with 12%SDS-PAGE degeneration glue, forward on nitrocellulose filter (Amersham Biosciences), then hybridize take the anti-TP53 antibody of rabbit, the anti-Bcl-XL antibody of rabbit, mouse-anti beta-actin antibody as primary antibodie respectively, take fluorescein-labeled goat-anti rabbit or sheep anti-mouse antibody as two anti-, finally carry out hybridization signal amplification with the chemiluminescent substrate of ECL.

Result:

Semi-quantitative RT-PCR analysis demonstration, the mrna expression level that strengthens the pLNCX2-G491 visible endogenous TP53 of transfection dosage and Bcl-XL has the trend (Fig. 5, A) of successively decreasing.The amount of application of RNA shown in the SEQ ID No.1 of increase synthetic also can significantly suppress the mrna expression level (Fig. 5, B) of endogenous TP53 and Bcl-XL.

Real-time quantitative RT-PCR analysis demonstration, transfection 4 μ g pLNCX2-G491 can significantly suppress TP53 and Bcl-XL gene expression, are subject to further inhibition (Fig. 6, A) but the transfection dosage of increase pLNCX2-G491 has no gene expression; And the synthetic miR491-5p of transfection can have certain dosage effect (Fig. 6, B) to TP53 and Bcl-XL gene expression.

No matter protein level detection display, be transfection pLNCX2-G491 expression vector dna or the miR491-5p of transfection synthetic, and the protein expression level of TP53 and Bcl-XL is with the increase of transfection dosage significantly successively decrease (Fig. 7, A and Fig. 7, B).

Embodiment 5.miR-491-5p can suppress the propagation of pancreatic cancer cell SW1990

Adopt cell counting test kit CCK-8 to detect cell proliferation situation:

By about 5x10 ⁶individual SW1990 cell is laid in 24 hole culture dishs;

Carrier pLNCX2-G491(0,5 and 10 μ that dye incremental change to every hole SW1990 transit cell with Vigofect reagent g) or the RNA(0 shown in synthetic SEQ ID No.1,4 and 8 μ g), in order to keep total amount of application of each experimental group identical, use respectively empty carrier pLNCX2 or miRNANC polishing;

Respectively at after transfection 24 hours, 48 hours and 72 hours, water-soluble tetrazolium salts WST-8 dyestuff is added in each hole;

Change to evaluate the ratio of the cell number of living in every hole with light splitting range meter detection absorbance 450nm detection WST-8 dye colour.

Result:

Compared with the control, transfection after 24 hours the RNA shown in visible each amount of application pLNCX2-G491 and SEQ ID No.1 the propagation of SW1990 cell is had to significant inhibitory action.Only at high dose, (10 μ g) have a remarkable inhibition cell proliferation, and at low dosage, (0 μ g, 5 μ g) transfection 48 hours or the transfection sample of 72 hours have no on cell proliferation and have obvious inhibition (the left figure of Fig. 8) for pLNCX2-G491 transfection 48 hours.RNA shown in transfection SEQ ID No.1 had no obvious cell inhibitory effect at 48 hours, and only in high dose group, (8 μ g) detected remarkable inhibition (the right figure of Fig. 8) at 72 hours.

The explanation of this experimental result, no matter be with the rna form shown in the SEQ ID No.1 of synthetic, or the DNA from expression vector processes and the miR491-5p form of generation, miR491-5p targeting suppress TP53 and Bcl-XL gene expression simultaneously in SW1990 cell, there is the whole structure that suppresses cell proliferation, and this depression effect has the feature of TP53 dependent/non-dependent.

Embodiment 6.miR-491-5p can bring out the apoptosis of pancreatic cancer cell SW1990

Apoptosis is detected to the two transfection reagent boxes of the main Annexin of employing V-FITC/PI to be detected.With g) the transfection SW1990 cell of RNA(0,4,8 μ shown in the SEQ IDNo.1 of the synthetic of ascending-dose, in order to keep total amount of application of each experimental group identical, with miRNA NC polishing.After transfection 48 hours, collecting cell is also resuspended in 50 μ l binding buffer liquid, adds annexin V-FITC of 200ng in this cell suspension, and room temperature reaction adds the propidium iodide of 200ng for 15 minutes again.FACSARIA flow cytometer for product (Becton Dickenson company of the U.S.) is analyzed.

Result:

With the increase of the RNA dosage shown in SEQ ID No.1, the two positive ratios (apoptosis in late period) of the positive ratio of SW1990 cell annexin V list (early apoptosis) and annexin V/PI increase obviously (Fig. 9, A).Statistical analysis shows, in the case of the RNA(8 μ shown in high dose SEQ ID No.1 g), SW1990 early apoptosis of cells and late period apoptosis ratio have statistical significance (Fig. 9, B and 9, C) compared with matched group.

Embodiment 7.miR491-5p activates SW1990 apoptosis by the intrinsic the mitochondrial pathways of cell

With g) the transfection SW1990 cell of miR491-5p(0,4,8 μ of the chemosynthesis of ascending-dose;

After 48 hours, collecting cell is also used cell pyrolysis liquid cracking, collects supernatant after centrifugal;

Each experimental point is respectively got 15 μ g total proteins and is carried out electrophoretic separation, after separating, forwards on nitrocellulose filter with 12%SDS-PAGE degeneration glue;

Then hybridize take rabbit anti-cell pigment c antibody, anti-caspase 9 antibody of rabbit, the anti-Caspase-3 antibody of rabbit, mouse-anti PARP-1 antibody, mouse-anti beta-actin antibody as primary antibodie respectively, take fluorescein-labeled goat-anti rabbit or murine antibody as two anti-, finally carry out hybridization signal amplification with the chemiluminescent substrate of ECL.

Result:

Transfection miR491-5p is Caspase-3 in active cell, 9 and the cutter activation of PARP-1 significantly, can make cytochrome c in endochylema, discharge (Figure 10) by mitochondrion simultaneously.Illustrate that miR491-5p is the apoptosis that activates pancreatic cancer cell SW1990 by regulating and controlling intrinsic the mitochondrial pathways.

Embodiment 8.miR491-5p can suppress PI-3K/Akt and the activation of STAT3 signal path

Whether the protein cleavage sample of embodiment 7 is also used for detecting miR491-5p has impact to classical proliferation signal path.

Equally, use g) the transfection SW1990 cell of miR491-5p(0,4,8 μ of the chemosynthesis of ascending-dose;

After 48 hours, collecting cell is also used cell pyrolysis liquid cracking, collects supernatant after centrifugal;

Each experimental point is respectively got 15 μ g total proteins and is carried out electrophoretic separation, after separating with 12%SDS-PAGE degeneration glue, forward on nitrocellulose filter (Amersham Biosciences), then respectively with the anti-Akt antibody of rabbit, the anti-phosphorylation Akt(p-Akt of rabbit) antibody, the anti-ERK1/2 antibody of rabbit, the anti-phosphorylation ERK1/2(p-ERK1/2 of rabbit) antibody, mouse-anti STAT3 antibody, mouse-anti pSTAT3 (p-STAT3) antibody, mouse-anti beta-actin antibody is that primary antibodie is hybridized, take fluorescein-labeled goat-anti rabbit or murine antibody as two anti-, finally carry out hybridization signal amplification with the chemiluminescent substrate of ECL.

Result:

MiR491-5p all has remarkable inhibitory action to phosphorylation and non-phosphorylating Akt, and is to suppress STAT3 phosphorylation level on the main manifestations that affects of STAT3 signal path, and the non-phosphoric acid level of STAT3 is not had to inhibitory action (Figure 11).Also detect and show, miR491-5p does not have remarkable inhibitory action to the activation of ERK, illustrates that miR491-5p is in the alternative activation that suppresses some proliferation signal path of cancer of pancreas SW1990 cell.

Discuss:

SW1990 cell line is by people such as Andreas P.Kyriazis, constructed from 56 years old male's pancreatic tumor tissue in nineteen eighty-three.In decades, always be quite valuable tumor cell line in human pancreatic adenocarcinoma research.SW1990 all can grow in tissue culture or in nude mice, and at aspects such as index, karyological character such as histologic characteristics, tumor growth characteristic, expression of enzymes spectrum, LDH and CEA all with cancerous cell in vivo without difference (people such as Andreas P.Kyriazis, 1983) very.Therefore, in the specific embodiment of the present invention, the each side effect that miR491-5p shows SW1990, by representing its in animal pattern, the even effect in human body.

As above shown in result, the inventor has found that microRNA molecules miR491-5p is at Pancreatic Adenocarcinoma and the differential expression in normal cell first.And further confirm the purposes of microRNA molecules miR491-5p in treatment and/or diagnosis and/or the prognosis of cancer of pancreas.The inventor uses the RNA shown in SEQ ID No.1 or the carrier containing the DNA shown in SEQ ID No.2 to experimenter, can statistically significantly suppress the propagation of pancreatic cancer cell and cause cancer cell-apoptosis.

In addition, the inventor has also further set forth the mechanism of miR491-5p the treatment of cancer of pancreas from molecule aspect.The inventor proves, miR491-5p is the people such as targeting anti-apoptotic genes expression Bcl-XL(Nakano H simultaneously, 2010) and 3 ' noncoding region (3 ' UTR) of antioncogene TP53.Study on Molecular Mechanism shows that miR491-5p is the apoptosis that brings out pancreatic cancer cell by the intrinsic path of mitochondrial regulation, and miR491-5p can suppress PI-3K and STAT3 signal path to specificity.The present invention likely produces actively impact to the Clinics and Practices of following cancer of pancreas.

List of references

Bartel,D.P.MicroRNAs:genomics,biogenesis,mechanism,and?function.Cell2004,116,281-297

Kim,V.N.;Han,J.;Siomi,M.C.Biogenesis?of?small?RNAs?in?animals.Nat?Rev?Mol?Cell?Biol?2009,10,126-139

Lee,Y.;Ahn,C.;Han,J.;Choi,H.;Kim,J.;Yim,J.;Lee,J.;Provost,P.;Radmark,O.;Kim,S.;Kim,V.N.The?nuclear?RNase?III?Drosha?initiates?microRNA?processing.Nature?2003,425,415-419

Han,J.;Lee,Y;Yeom,K.H.;Kim,Y.K.;Jin,H.;Kim,V.N.The?Drosha-DGCR8complex?in?primary?microRNA?processing.Genes?Dev?2004,18,3016-3027

Lund,E.;Guttinger,S.;Calado,A.;Dahlberg,J.E.;Kutay，U.Nuclear?export?of?microRNA?precursors.Science(New?York，N.Y.）2004,303,95-98

Bohnsack,M.T.;Czaplinski,K.;Gorlich,D.Exportin?5?is?a?RanGTP-dependentdsRNA-binding?protein?that?mediates?nuclear?export?of?pre-miRNAs.RNA?2004,10,185-191

Ketting,R.F.;Fischer,S.E.;Bernstein,E.;Sijen,T.;Hannon,G.J.;Plasterk,R.H.Dicer?functions?in?RNA?interference?and?in?synthesis?of?small?RNA?involved?in?developmental?timing?in?C.elegans.Genes?Dev?2001,15,2654-2659

Hutvagner,G.;McLachlan,J.;Pasquinelli,A.E.;Balint,E.;Tuschl,T.;Zamore,P.D.A?cellular?funnction?for?the?RNA-interference?enzyme?Dicerin?the?maturation?of?the?let-7small?temporal?RNA.Science(New?York，N.Y.）2001,293,834-838

Maniataki,E.;Mourelatos,Z.A?human,ATP-independent,RISC?assembly?machine?fueled?by?pre-miRNA.Genes?Dev?2005,19,2979-2990

Gregory，R.I.;Chendrimada,T.P.;Cooch,N.;Shiekhattar,R.Human?RISC?couples?microRNA?biogenesis?and?posttranscriptional?gene?silencing.Cell?2005,123,631-640

Chendrimada,T.P.;Gregory，R.I.;Kumaraswamy，E.;Norman,J.;Cooch,N.;Nishikura,K.;Shiekhattar,R.TRBP?recruits?the?Dicer?complex?to?Ago2?for?microRNA?processing?and?gene?silencing.Nature?2005,436,740-744

Jemal,A.;Siegel,R.;Xu,J.;Ward,E.Cancer?statistics,2010.CA?Cancer?J?Clin2011,60,277-300

Krejs,G.J.Pancreatic?cancer:epidemiology?and?risk?factors.Dig?Dis?2010,28,355-358

Lowenfels,A.B.;Maisonneuve,P.Epidemiology?and?risk?factors?for?pancreatic?cancer.Best?Pract?Res?Clin?Gastroenterol?2006,20,197-209

Wang,J.;Sen,S.MicroRNA?functional?network?in?pancreatic?cancer:from?biology?to?biomarkers?of?disease.J?Biosci?2011,36,481-491

Bloomston,M.;Frankel,W.L.;Petrocca,F.;Volinia,S.;Alder,H.;Hagan,J.P.;Liu,C.G.;Bhatt,D.;Taccioli,C.;Croce,C.M.MicroRNA?expression?patterns?to?differentiate?pancreatic?adenocarcinoma?from?normal?pancreas?and?chronic?pancreatitis.JAMA?2007,297,1901-1908

Szafranska,A.E.;Davison,T.S.;John,J.;Cannon,T.;Sipos,B.;Maghnouj,A.;Labourier,E.;Hahn,S.A.MicroRNA?expression?alterations?are?linked?to?tumorigenesisand?non-neoplastic?processes?in?pancreatic?ductal?adenocarcinoma.Oncogene?2007,26,4442-4452

Jiao,L.R.;Frampton,A.E.;Jacob,J.;Pellegrino,L.;Krell,J.;Giamas,G.;Tsim,N.;Vlavianos,P.;Cohen,P.;Ahmad,R.;Keller,A.;Habib,N.A.;Stebbing,J.;Castellano,L.MicroRNAs?targeting?oncogenes?are?down-regulated?in?pancreatic?malignant?transformation?from?benign?tumors.PLoS?One?2012,7,e32068

Ali,S.;Saleh,H.;Sethi,S.;Sarkar,F.H.;Philip,P.A.MicroRNA?profiling?of?diagnostic?needle?aspirates?from?patients?with?pancreatic?cancer.Br?J?Cancer?2012,107,1354-1360

Papaconstantinou,I.G.;Manta,A.;Gazouli,M.;Lyberopoulou,A.;Lykoudis,P.M.;Polymeneas,G.;Voros,D.Expression?of?MicroRNAs?in?Patients?With?Pancreatic?Cancer?and?Its?Prognostic?Significance.Pancreas?2012?Jul?30.[Epub?ahead?ofprint]

Zhang,J.;Du,Y.Y.;Lin,Y.F.;Chen,Y.T.;Yang,L.;Wang,H.J.;Ma,D.The?cell?growth?suppressor,mir-126,targets?IRS-1.Biochem?Biophys?Res?Commun?2008,377,136-140

Sambrook，J.，Russell，David?W.，Molecular?Cloning:A?Laboratory?Manual，3 ^rdedition，2001，NY，Cold?Spring?Harbor

Andreas?P?Kyriazis,William?B?McCombs?III,Avery?A?Sandberg,Aikaterini?A?Kyriazis,Nathan?H?Sloane?and?Ross?Lapera.Establishment?and?Characterization?of?Human?Pancreatic?Adenocarcinoma?Cell?Line?SW-1990?in?Tissue?Culture?and?the?Nude?Mouse.CANCER?RESEARCH.1983?43:4393-4401

Nakano?H,Miyazawa?T,Kinoshita?K,Yamada?Y,Yoshida?T.Functional?screening?identifies?a?microRNA,miR-491?that?induces?apoptosis?by?targeting?Bcl-X(L)?incolorectal?cancer?cells.Int?J?Cancer.2010?Sep?1;127(5):1072-80.

Claims (8)

1. the purposes of microRNA molecules miR491-5p in the medicine for the preparation for the treatment of cancer of pancreas.

2. purposes according to claim 1, wherein said miR491-5p is selected from one or more of following form: the precursor miRNA of initial miRNA, the miR491-5p of miR491-5p or ripe miR491-5p; Preferably, described miR491-5p is ripe miR491-5p.

3. purposes according to claim 2, wherein said ripe miR491-5p is selected from following one or more: with the RNA shown in SEQ ID NO:1; Or processing is from the RNA of the DNA shown in SEQ ID NO:2.

4. the purposes of microRNA molecules miR491-5p in the device for the preparation of diagnosis and/or prognosis cancer of pancreas.

5. purposes according to claim 4, wherein said miR491-5p is selected from one or more of following form: the precursor miRNA of initial miRNA, the miR491-5p of miR491-5p or ripe miR491-5p; Preferably, described miR491-5p is ripe miR491-5p.

6. purposes according to claim 5, wherein said ripe miR491-5p is selected from following one or more: with the RNA shown in SEQ ID NO:1; Or processing is from the RNA of the DNA shown in SEQ ID NO:2.

7. purposes according to claim 4, wherein said device is test kit, it comprises that RNA extracts reagent, buffer system, reverse transcription reagent, pcr amplification reagent, primer pair and operation instructions for miR491-5p.

8. purposes according to claim 7, the wherein said primer pair for miR491-5p is the DNA shown in SEQ ID NO:3 and SEQ ID NO:4.

Images