CN103861121B - The purposes of microRNA molecules miR491-5p in the treatment of cancer of pancreas and/or diagnosis and/or prognosis - Google Patents
The purposes of microRNA molecules miR491-5p in the treatment of cancer of pancreas and/or diagnosis and/or prognosis Download PDFInfo
- Publication number
- CN103861121B CN103861121B CN201210530716.3A CN201210530716A CN103861121B CN 103861121 B CN103861121 B CN 103861121B CN 201210530716 A CN201210530716 A CN 201210530716A CN 103861121 B CN103861121 B CN 103861121B
- Authority
- CN
- China
- Prior art keywords
- mir491
- cell
- seqidno
- pancreas
- cancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The present invention relates to the purposes of microRNA molecules miR491-5p in the treatment of cancer of pancreas and/or diagnosis and/or prognosis, specifically, the invention discloses the purposes of microRNA molecules miR491-5p in the medicine for the preparation for the treatment of cancer of pancreas; The invention also discloses the purposes of microRNA molecules miR491-5p in the device for the preparation of diagnosis and/or prognosis cancer of pancreas.MiR491-5p of the present invention is differential expression in Normal Pancreas and Pancreatic Adenocarcinoma, can be used as diagnosis of pancreatic cancer mark, also can as active component for the preparation of the medicine being used for the treatment of cancer of pancreas.
Description
Technical field
The present invention relates to biomedicine field, relate to gene therapy and/or gene diagnosis field; In particular to microRNA molecules in the purposes in the device for the preparation of diagnosis and/or prognosis cancer of pancreas for the preparation of the purposes for the treatment of in the medicine of cancer of pancreas and microRNA molecules; More specifically, miR491-5p is related in the purposes in the device for the preparation of diagnosis and/or prognosis cancer of pancreas for the preparation of the purposes for the treatment of in the medicine of cancer of pancreas and miR491-5p.
Background technology
Microrna (microRNA or miRNA) be a kind of can active participate to the novel gene regulation factor of physiology and pathological process.Such RNA is the non-coding tiny RNA that a class length is about 21-25 nucleotide (nt), and its function is in expression (Bartel, D.P., 2004 of post-transcriptional level regulation and control target gene; The people such as Kim, V.N., 2009).
Although the generation of functional miRNA is defined as several different stage, as initial miRNA(pi-miRNA), precursor miRNA (pre-miRNA) and ripe miRNA etc., but in cell this process be in fact one by the Continuous maching process of kytoplasm to karyon.In nucleus, first transcription product forms the initial pi-miRNA that has neck ring structure, pi-miRNA processes hair fastener type intermediate product into about 70nt through the double-stranded RNA nucleic acid enzyme Drosha of nucleoprotein DGCR8 and karyon subsequently, the miRNA before maturation, be referred to as precursor miRNA and pre-miRNA(Lee, Y. people is waited, 2003; The people such as Han, J., 2004).The outer turning egg(s) white 5(exportin5 of Pre-miRNA on nucleopore) and the combined effect of GTP-Ran be transported to endochylema (people such as Lund, E., 2004; The people such as Bohnsack, M.T., 2004).At endochylema, pre-miRNA is processed into the people such as ripe miRNA(Ketting, the R.F. of 21-25nt, 2001 by another double-stranded RNA nucleic acid enzyme Dicer; The people such as Hutvagner, G., 2001).Except Dicer, the silencing complex (RISC) of the RNA induction formed also comprises Ago protein family member, and its effect takes ripe miRNA to target gene mRNA(Maniataki, the people such as E., 2005; The people such as Gregory, R.I., 2005; The people such as Chendrimada, T.P., 2005).
Cancer of pancreas does not a kind ofly have early symptom and the affecting conditions that fatality rate is very high in crowd (people such as Jemal, A., 2010; Krejs, G.J.2010; The people such as Lowenfels, A.B., 2006).Normal Pancreas mainly contains the formations such as ductal epithelial cell, islet cells and acinus, has the cell of 70-80% to be beta Cell of islet in islets of langerhans.The cancer of pancreas of 80% is brought out by ductal epithelial cell.Due to the screening of cancer of pancreas biomarker to the early diagnosis of disease and prognosis all very important, therefore this respect work received very large concern (people such as Wang, J., 2011) in the last few years.Cancer of pancreas and the control tissue sample thereof of paraffin-embedded cancer of pancreas sample and excision is fixed with formaldehyde, miRNA chip carries out extensive miRNA expression pattern analysis research discovery has at least 40 kinds of miRNA significantly raised or lower (Bloomston, M. people is waited, 2007; The people such as Szafranska, A.E, 2007; The people such as Jiao, L.R., 2012; The people such as Ali, S., 2012; The people such as Papaconstantinou, I.G., 2012).MiRNA such as miR-21, miR-155 of some variant expression may be relevant with the propagation of tumor and poor prognosis with miR-196a-2.
But, do not detect in these extensive miRNA chip examination processes that hsa-miR491-5p(is called for short miR491-5p) dependency that occurs with cancer of pancreas.The research display of the present inventor, miR49-5p expression in normal person's pancreatic tissue is very high, and expression is lower in pancreatic cancer cell, therefore have the effect suppressing cancer of pancreas propagation potentially, likely producing the treatment of cancer of pancreas and diagnosis and/or prognosis actively affects.
Summary of the invention
According to an aspect of the present invention, the invention provides the purposes of microRNA molecules miR491-5p in the medicine for the preparation for the treatment of cancer of pancreas.
In the embodiment that some are concrete, wherein said miR491-5p is selected from one or more of following form: the precursor miRNA of initial miRNA, miR491-5p of miR491-5p or ripe miR491-5p.
In a preferred embodiment, described miR491-5p is ripe miR491-5p.
In the embodiment that some are concrete, ripe miR491-5p is the RNA as shown in SEQIDNO:1.
In the embodiment that other are concrete, ripe miR491-5p processes the RNA of the DNA freely shown in SEQIDNO:2.
Sequence SEQIDNO:1 as above is made up of 23 nucleotide, and its 3 ' end nucleotide acid sequence can form about 7 nucleotide with target gene 5 ' end and mate completely, forms Seed Sequences (seedsequence).
Sequence SEQIDNO:2 is a size is the sequence of 1470-bp, and it is positioned on people's No. 9 chromosomes.SEQIDNO:2 is after suitable vector expression, the initial miRNA(that can produce miR491-5p also makes pi-miR491-5p herein), and then be processed into the precursor miRNA (also making pre-miR491-5p herein) of miR491-5p, be finally processed as the RNA shown in ripe miR491-5p(and SEQIDNO:1).
Therefore, some preferred embodiment in, miR491-5p is ripe miR491-5p.
Described ripe miR491-5p can be the miR491-5p of rna form, the RNA namely as shown in SEQIDNO:1; It can be natural generation or synthetic.In the embodiment that some are concrete, the RNA shown in SEQIDNO:1 is synthetic.
In the embodiment that other are concrete, described ripe miR491-5p can process the RNA from the DNA shown in sequence SEQIDNO:2; Preferably, obtain by being present in the DNA processing shown in the SEQIDNO:2 in expression vector; Described expression vector can be viral vector or carrier for expression of eukaryon.
Viral vector can be any suitable carrier, includes but not limited to retroviral vector, adenovirus vector, adeno-associated virus (AAV) carrier, herpesvirus (such as herpes simplex virus, vaccinia virus and Epstein-Barr virus) carrier, alphavirus vectors.In the embodiment that some are concrete, expression vector is retroviral vector pLNCX2.
Carrier for expression of eukaryon can be any suitable expression vector, include but not limited to pCMV-Myc expression vector, pcDNA3.0 expression vector, pcDNA3.1 expression vector, pEGFP expression vector, pEFBos expression vector, pTet expression vector, pTRE expression vector or the carrier through transforming on the basis of known expression vector, such as pBin438, pCAMBIA1301 etc.
Although in some embodiments, expression vector is retroviral vector pLNCX2, but should be understood to, those skilled in the art can select suitable carrier according to factors such as experimenter to be administered, sequence to be administered, pending disease, route of administration.
In the embodiment that some are concrete, described medicine comprises miR491-5p; Preferably, described medicine comprises ripe miR491-5p, namely comprises the RNA as shown in SEQIDNO:1.
In the embodiment that other are concrete, described medicine comprises the expression vector comprising the DNA shown in SEQIDNO:2.
When needing, one or more pharmaceutically acceptable carriers can also be added in described medicine.Described pharmaceutically acceptable carrier includes but not limited to diluent, buffer agent, suspensoid, Emulsion, granule, encapsulation agents, excipient, filler, binding agent, spray, cutaneous permeable agent, wetting agent, disintegrating agent, absorption enhancer, surfactant, coloring agent, correctives or absorption carrier.
In the embodiment that some are concrete, described medicine can be made and include but not limited to microinjection agent, be suitable for the dosage form of transfection, injection, tablet, powder, granule, capsule.The medicine of above-mentioned various dosage form all can be prepared according to the conventional method of pharmaceutical field.
In the embodiment that some are concrete, described medicine can be used separately; Or carry out combined administration with antibiotic, immunostimulant etc.
In the embodiment that some are concrete, described medicine can be used (exvivo approach) in vitro: by miR491-5p or import in vitro containing the carrier of the DNA shown in SEQIDNo.2 or transfection human body self or variant cell (or heterogenous cell), after vitro cell expansion, defeated the Huis' body.In the embodiment that some are concrete, miR491-5p or the carrier containing the DNA shown in SEQIDNo.2 are used to cell by vitro approach.
In the embodiment that other are concrete, described medicine can be used in body (invivo approach): miR491-5p or the carrier containing the DNA shown in SEQIDNo.2 directly import in body.This carrier can be virus type or non-viral, or even naked DNA or RNA.
Described experimenter is selected from the mankind, mice, Canis familiaris L., rabbit, cattle or monkey; The preferred mankind, monkey or mice; The most preferably mankind.In the embodiment that some are concrete, experimenter is the mankind; More specifically, be organ, tissue, the cell of the mankind; Preferred human pancreatic, pancreatic tissue, pancreatic cell; More preferably, the pancreas of the mankind of cancer of pancreas, Pancreatic Adenocarcinoma, pancreatic cancer cell is suffered from; Most preferably, human pancreatic cancer cell.
It will be appreciated by those skilled in the art that the amount of the miR491-5p that uses to experimenter or the carrier containing the DNA shown in SEQIDNo.2, be one as calculated, the predetermined amount of active substance of the therapeutical effect needed for generation.For purposes of the invention, the miR491-5p used to experimenter or the amount of carrier containing the DNA shown in SEQIDNo.2, referring to can statistically remarkable anticancer propagation and/or cause cancer cell-apoptosis and predetermined amount for pin.For the manufacture of in the medicine for purposes of the present invention, based on the factor such as Subject characteristics's (than age as known in the art, sex, body weight, complication, medical history, inherited genetic factors, Other diseases etc.), disease severity, support, route of administration, general medical personnel can determine the amount of the miR491-5p that uses to experimenter or the carrier containing the DNA shown in SEQIDNo.2.
According to a further aspect in the invention, the invention provides the purposes of microRNA molecules miR491-5p in the device for the preparation of diagnosis and/or prognosis cancer of pancreas.
Wherein said miR491-5p is selected from one or more of following form: the precursor miRNA of initial miRNA, miR491-5p of miR491-5p or ripe miR491-5p.
In a preferred embodiment, described miR491-5p is ripe miR491-5p.
In the embodiment that some are concrete, ripe miR491-5p is the RNA as shown in SEQIDNO:1.Although in some detailed description of the invention use ripe miR491-5p as shown in SEQIDNO:1, but those skilled in the art it is expected to, initial miRNA(pi-miR491-5p), precursor miRNA (pre-miR491-5p) can obtain the technique effect same with ripe miR491-5p, because cell is had the ability further by initial miRNA(pi-miR491-5p), precursor miRNA (pre-miR491-5p) is processed as ripe miR491-5p.
In the embodiment that other are concrete, ripe miR491-5p is the RNA of processing from the DNA shown in SEQIDNO:2.
In the embodiment that some are concrete, described device is test kit, it comprise RNA extract reagent, buffer system, Reverse Transcription, pcr amplification reagent, for the primer pair of miR491-5p and operation instructions.
In the embodiment that some are concrete, the primer pair for miR491-5p is the DNA shown in SEQIDNO:3 and SEQIDNO:4.
Below in conjunction with the drawings and specific embodiments, the present invention is described in further details.
Accompanying drawing explanation
Fig. 1 shows the histiocyte expression pattern analysis of miR491-5p, the differential expression of A:miR491-5p in adult's tissue; The differential expression of B:miR491-5p in the 18 kinds of tissues reported; The differential expression of C:miR491-5p in adult's tissue, embryonal tissue and pancreatic cancer cell.
Fig. 2 shows miR491-5p differential expression in normal person's pancreas and human pancreatic cancer cell.
The expression of Fig. 3 Explicit Expression carrier pLNCX2-G491 in 293 cells.
Fig. 4 shows miR491-5p in the forecast analysis of TP53 and Bcl-XL gene 3 ' UTR target site.
Fig. 5 show, by semi-quantitative RT-PCR analysis result, the transfection of the RNA shown in carrier pLNCX2-G491 or SEQIDNo.1 to the inhibitory action of the expression of target gene TP53 and Bcl-XL, A: the transfection of carrier pLNCX2-G491; The transfection of the RNA shown in B:SEQIDNo.1.
Fig. 6 show, by real-time quantitative RT-PCR analysis result, the transfection of the RNA shown in carrier pLNCX2-G491 or SEQIDNo.1 to the inhibitory action of the expression of target gene TP53 and Bcl-XL, A: the transfection of carrier pLNCX2-G491; The transfection of the RNA shown in B:SEQIDNo.1.
After Fig. 7 shows the RNA shown in transfection carrier pLNCX2-G491 or SEQIDNo.1, the protein expression level of target gene TP53 and Bcl-XL, A: the transfection of carrier pLNCX2-G491; The transfection of the RNA shown in B:SEQIDNo.1.
Fig. 8 to show after the RNA shown in each dosage pLNCX2-G491 or SEQIDNo.1 of transfection 24,48 and 72 hours, to the inhibitory action of the propagation of SW1990 cell.
After Fig. 9 shows the RNA shown in each dosage SEQIDNo.1 of transfection, the fluidic cell figure of A: pancreatic cancer cell SW1990; The positive ratio (early apoptosis) of B:SW1990 cell annexin V list; C: annexin V/PI two positive ratio (late apoptic).
After Figure 10 shows each dosage miR491-5p of transfection, participate in the albumen of apoptosis pathway or the expression of the factor of intrinsic mitochondrion mediation, beta-actin is as internal reference, and left side numeral is molecular weight.
After Figure 11 shows each dosage miR491-5p of transfection, participate in the albumen of PI-3K/Akt and STAT3 signal path or the expression of the factor, beta-actin is as internal reference, and left side numeral is molecular weight.
Detailed description of the invention
Term
Term " miR491-5p " unless otherwise as used herein, when mentioning miR491-5p, it initial miRNA(comprising miR491-5p also makes pi-miR491-5p), the precursor miRNA (also making pre-miR491-5p) of miR491-5p and ripe miR491-5p.
Term " processing " refers to the process obtaining ripe miR491-5p from DNA as used herein; With regard to current scientific and technological level, it has been generally acknowledged that processing comprises the steps: that DNA obtains pri-miRNA, pri-miRNA and in nucleus, cut into pre-miRNA, pre-miRNA through transcribing by Drosha produce ripe miRNA by forwarding in core in kytoplasm, then being cut further by Dicer under the effect of transport protein exportin-5; Wherein said DNA can from chromosomal DNA or exchromosomal DNA or even from carrier DNA; It will be appreciated by those skilled in the art that, although the detailed process details of " processing " described herein and concrete mechanism thereof are not disclosed fully up hill and dale by the research worker of global range, the realization that but this does not hinder " processing ", in the middle of eukaryotic cell, cell can complete " processing " voluntarily and produce pri-miRNA, pre-miRNA described herein and ripe miRNA.
Embodiment
The following provide the concrete material and source thereof that use in embodiment of the present invention.But should be understood that, these are only exemplary, be not intended to limit the present invention, all may be used for implementing the present invention with the type of such as undertissue, cell, reagent and instrument, model, quality, character or the same or analogous material of function.
In following embodiment, method therefor is conventional method if no special instructions, and concrete steps can see " MolecularCloning:ALaboratoryManual " (Sambrook, J., Russell, DavidW., 2001).The primer and DNA, RNA sequence are by the raw work synthesis in Shanghai.
Material:
Note:
1. the chemistry that unless otherwise, the present invention is used, biological reagent can be any suitable commercial reagent;
2. above-mentioned cell line all can commercially availablely obtain.
The histiocyte expression pattern analysis of embodiment 1.miR491-5p detects
Be handled as follows:
Increase human embryonic kidney cell line 293, human hepatoma cell line HepG2, human lung cancer cell line A549, human pancreatic cancer cell Cap-1 and SW1990 in Tissue Culture Dish; Often kind of a cell collects at least 5 × 10
6individual; With 1mLTRIzol process, add 150 μ l chloroforms, centrifuging and taking supernatant after mixing; In supernatant, add isopyknic isopropanol precipitating, obtain cell total rna;
Extract normal adult tissue (people's lung, people's kidney, human brain, people liver, people's spleen and human pancreas) and normal person's embryo tissue (people's embryo liver, people's embryo spleen and people's embryo pancreas) total serum IgE;
Getting 100ng total serum IgE is that template carries out poly(A) RT-qPCR analyzes people such as (, 2008) Zhang, J., and instrument is iQ5 Real Time PCR Detection System (U.S. Bio-Rad laboratory), and the primer is:
SEQIDNo.3:5 '-agtggggaacccttccatga-3 ' (forward primer)
SEQIDNo.4:5 '-tctcagggtccgaggtattc-3 ' (reverse primer);
Under the guiding of 5 '-cgactcgatccagtctcagggtccgaggtattcgatcgagtcgcactttttttttt t-3 ' (SEQIDNo.5), be fitted together to method with SYBRGreenI and carry out one-step method reverse transcription-polymerase chain reaction detection miR-491-5p expression, take U6snRNA as internal reference, the amplimer sequence of U6snRNA is:
SEQIDNo.6:5 '-ctcgcttcggcagcaca-3 ' (forward primer)
SEQIDNo.7:5 '-aacgcttcacgaatttgcgt-3 ' (reverse primer)
Reverse transcription reaction condition is: first 42 DEG C, 5 minutes; PCR condition is: 95 DEG C 10 seconds; 95 DEG C 5 seconds, 60 DEG C 10 seconds, repeat 40 circulations;
The condition of dissociating of reactant is 55 DEG C to 95 DEG C and heats up 0.2 DEG C for every 10 seconds.
Result:
Display miR-491-5p all has higher expression in adult pancreas, people's embryo pancreas, adult brain tissue, wherein with the highest (Fig. 1 of the expression in adult pancreas, A), once detected that the expression of miR-491-5p in adult pancreas was higher than its level about 4800 times (Fig. 1, C) in adult human liver.(Fig. 1 is found by the tissue specific expression spectrum of miRNAmap analysis software retrieval miR-491-5p, B), in 18 kinds that reported detected tissues, the expression the highest http://mirnamap.mbc.nctu.edu.tw/php/mirna_entry.php acc=MI0003126 of miR-491-5p in brain.
Embodiment 2.miR491-5p and cancer of pancreas generation correlation detection
Extraction pancreatic carcinoma Cap-1, pancreatic carcinoma SW1990 are outer, the total serum IgE of pancreatic carcinoma Mia, pancreatic carcinoma AsPC-1;
Obtain normal human islets β cell total rna, normal person's sternzellen total serum IgE;
With poly(A) RT-qPCR detects.
Result:
MiR491-5p is high expressed in normal person's pancreatic tissue, and the expression in pancreatic carcinoma Mia and AsPC-1 cell is also very low, and detection beta Cell of islet and pancreatic stellate cells miR491-5p expression also maintain lower level (Fig. 2).Show that the unconventionality expression of miR491-5p is probably relevant to the generation of cancer of pancreas.
The structure of embodiment 3.miR-491-5p expression vector and detection
The position of miR-491-5p on genome and concrete sequence information (SEQIDNo.2) is found from (http://microrna.sanger.ac.uk/sequences/) miRNA data base;
According to genome sequence, determine the particular location of pri-miR491-5p;
500-800bp block design Auele Specific Primer in pri-miR-491-5p site upstream and downstream: SEQIDNo.8:5 '-ttagatctacagaagctgcacacataca-3 ' (forward primer)
SEQIDNo.9:5 '-ttgtcgactatctcaactgctgccatca-3 ' (reverse primer);
With the genomic DNA of HEK293T cell for template carries out the pcr amplification of target sequence, amplification condition is 94 DEG C of degeneration 5 minutes, then 94 DEG C 30 seconds, 50 DEG C 30 seconds, 72 DEG C 90 seconds, totally 35 circulations, last 72 DEG C 10 minutes;
1% agarose gel electrophoresis detection is carried out to pcr amplification product;
Reclaim test kit recovery length with DNA be about 1470bp object fragment and carry out purification to it;
Recovery fragment is carried out T-A clone with pMD-18Tsimple test kit connect, form carrier pMD-18T-G491;
It is the sequence of SEQIDNO:2 really that gained PCR primer is examined in order-checking;
By the G491 sequence product of confirmation after BglII/SalI is double digested, carry out 1% agarose gel electrophoresis detection;
Reclaim test kit with DNA and reclaim the object fragment that length is about 1470bp;
The 1470bp product of purification is subcloned into the BglII/SalI site of pLNCX2 carrier, forms expression vector pLNCX2-G491;
By 5 × 10
6the 293T cell of/mL is laid in 35mm culture dish;
When cell covers 80%, adopt transfection reagent Vigofect that the pLNCX2-G491 carrier DNA of 3 μ g is proceeded to 293T cell;
Transfection is after 48 hours, and collecting cell is in 1.5ml centrifuge tube;
With 1mLTRIzol process cell, add 150 μ l chloroforms, centrifuging and taking supernatant after mixing, adds the isopropanol precipitating of equivalent, obtains total serum IgE after high speed centrifugation;
The method of embodiment 1 is adopted to detect the expression of miR-491-5p in 293T cell.
Result:
Transfected expression vector pLNCX2-G491 significantly can promote the expression (Fig. 3) of miR491-5p in 293T cell effectively, and this experiment proves the artificial feasibility improving intracellular ripe miR491-5p level.
Embodiment 4.miR-491-5p can effectively identify target gene TP53 and Bcl-XL and suppress it to express
Because miR-491-5p has obvious differential expression at normal pancreatic tissue and Pancreatic Adenocarcinoma, therefore miR-491-5p likely plays antioncogene effect in normal pancreatic tissue.Inventor utilizes bioinformatic analysis software to predict the potential target gene of miR-491-5p.For improving the accuracy of software prediction, three kinds of miRNA forecasting softwares (DIANA-MICROT, MICRORNA, TARGETSCAN) are used for finding the miR-491-5p target gene relevant to cancer of pancreas simultaneously.
Inventor's setting only has the target gene by two or more analysis software is predicted as high score simultaneously just can be defined as positive target gene.Final confirmation TP53(nt1382-1404 (NM_000546)) and Bcl-XL(nt1503-1525 (NM_138578)) 3 ' UTR contain the potential recognition site (Fig. 4) of miR-491-5p.
Two kinds of methods are adopted to detect the inhibitory action (with the RNA as shown in SEQIDNo.1 of constructed expression vector pLNCX2-G491 or synthetic distinguish transfection SW1990) of miR-491-5p to TP53 and Bcl-XL gene expression:
By 5 × 10
6the SW1990 cell of/mL is laid in 35mm culture dish;
When cell covers 80%, RNA by shown in transfection reagent with the pLNCX2-G491(of various dose or the SEQIDNo.1 of synthetic) mix rear transfectional cell respectively, in order to keep the total amount of application of each experimental group identical, with empty carrier pLNCX2 or as negative control sequence miRNANC(5 '-uucuccgaacgugucacguuu-3 ') carry out polishing, miRNANC is one section of synthetic, in cell without any the random sequence of function;
Incubated at room, after 15 minutes, dropwise adds the SW1990 cell newly changing liquid;
37 DEG C hatch 2 hours after, change whole serum culture fluid;
After 48 hours by cell harvesting in 1.5ml centrifuge tube;
Part cell 1mLTRIzol process, add 150 μ l chloroforms, centrifuging and taking supernatant after mixing, adds the isopropanol precipitating of equivalent, obtains total serum IgE after high speed centrifugation;
Another part cell cell pyrolysis liquid ice bath carries out full lysis, after high speed centrifugation, collects cell lysate supernatant, detects the protein concentration of lysate by BCA method;
Detect miR-491-5p to the impact of the expression of target gene by sxemiquantitative and real-time quantitative RT-PCR method, the primer is:
TP53 gene:
SEQIDNo.10:5 '-atcacactggaagactccag-3 ' (forward primer)
SEQIDNo.11:5 '-ctgacgcacacctattgcaa-3 ' (reverse primer);
Bcl-XL gene:
SEQIDNo.12:5 '-ggtggttgactttctctcct-3 ' (forward primer)
SEQIDNo.13:5 '-gcatctccttgtctacgctt-3 ' (reverse primer);
Internal reference contrast beta-actin:
SEQIDNo.14:5 '-cacactgtgcccatctacga-3 ' (forward primer)
SEQIDNo.15:5 '-ctgcttgctgatccacatct-3 ' (reverse primer);
Reverse transcription reaction condition is: first 50 DEG C 35 minutes; Then 94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 40 seconds, totally 25 circulations, last 72 DEG C 10 minutes;
After reaction terminates, carry out 1% agarose gel electrophoresis detection to pcr amplification product, result as shown in Figure 5 A and 5B;
In addition, protein level detection is carried out to collection sample, each experimental point is respectively got 15 μ g total proteins and is carried out electrophoretic separation, forward on nitrocellulose filter (AmershamBiosciences) after being separated with 12%SDS-PAGE degeneration glue, then hybridize for primary antibodie with rabbit anti-TP53 antibody, the anti-Bcl-XL antibody of rabbit, mouse-anti beta-actin antibody respectively, with fluorescein-labeled goat-anti rabbit or sheep anti-mouse antibody be two resist, finally carry out hybridization signal amplification with the chemiluminescent substrate of ECL.
Result:
Semi-quantitative RT-PCR analysis shows, and the mrna expression level strengthening visible endogenous TP53 and Bcl-XL of pLNCX2-G491 transfection dosage has the trend (Fig. 5, A) of successively decreasing.The amount of application increasing the RNA shown in SEQIDNo.1 of synthetic also significantly can suppress the mrna expression level (Fig. 5, B) of endogenous TP53 and Bcl-XL.
Real-time quantitative RT-PCR analysis shows, and transfection 4 μ gpLNCX2-G491 can significantly suppress TP53 and Bcl-XL gene expression, but increases the transfection dosage of pLNCX2-G491 and have no gene expression and be subject to further suppression (Fig. 6, A); And the miR491-5p of transfection synthesis can have certain dosage effect (Fig. 6, B) to TP53 and Bcl-XL gene expression.
Protein level detection display, be no matter the miR491-5p of transfection pLNCX2-G491 expression vector dna or transfection synthetic, the protein expression level of TP53 and Bcl-XL is with the increase of transfection dosage significantly successively decrease (Fig. 7, A and Fig. 7, B).
Embodiment 5.miR-491-5p can suppress the propagation of pancreatic cancer cell SW1990
Cell counting Kit CCK-8 is adopted to detect cell proliferative conditions:
By about 5x10
6individual SW1990 cell is laid in 24 hole culture dishs;
With Vigofect reagent to every hole SW1990 transit cell dye incremental change carrier pLNCX2-G491(0,5 and 10 μ g) or synthesis SEQIDNo.1 shown in RNA(0,4 and 8 μ g), in order to keep total amount of application of each experimental group identical, use empty carrier pLNCX2 or miRNANC polishing respectively;
Respectively at after transfection 24 hours, 48 hours and 72 hours, water-soluble tetrazolium salts WST-8 dyestuff is added in each hole;
Detect absorbance 450nm with light splitting range meter and detect the change of WST-8 dye colour to evaluate the ratio of every hole cell number alive.
Result:
Compared with the control, transfection after 24 hours the propagation of RNA to SW1990 cell shown in visible each amount of application pLNCX2-G491 and SEQIDNo.1 have significant inhibitory action.PLNCX2-G491 transfection only has remarkable antiproliferative effect at high dose (10 μ g) in 48 hours, and having no on cell proliferation in low dosage (0 μ g, 5 μ g) transfection 48 hours or the transfection sample of 72 hours has obvious suppression (the left figure of Fig. 8).RNA shown in transfection SEQIDNo.1 had no obvious cell inhibitory effect at 48 hours, and only remarkable suppression (the right figure of Fig. 8) detected in high dose group (8 μ g) at 72 hours.
The explanation of this experimental result, no matter be with the rna form shown in the SEQIDNo.1 of synthetic, or the miR491-5p form produced from the DNA processing expression vector, the targeting while that miR491-5p being in SW1990 cell also suppresses TP53 and Bcl-XL gene expression, there is the whole structure of antiproliferative effect, and this depression effect has the feature of TP53 dependent/non-dependent.
Embodiment 6.miR-491-5p can bring out the apoptosis of pancreatic cancer cell SW1990
Detect the main two transfection reagent box of AnnexinV-FITC/PI that adopts to apoptosis to detect.With the RNA(0 shown in the SEQIDNo.1 of the synthetic of ascending-dose, 4,8 μ g) transfection SW1990 cell, in order to keep total amount of application of each experimental group identical, use miRNANC polishing.Transfection is after 48 hours, and collecting cell is also resuspended in 50 μ l binding buffer liquid, and add the annexin V-FITC of 200ng in this cell suspension, room temperature reaction adds the propidium iodide of 200ng for 15 minutes again.Product FACSARIA flow cytometer (BectonDickenson company of the U.S.) is analyzed.
Result:
With the increase of the RNA dosage shown in SEQIDNo.1, the positive ratio (early apoptosis) of SW1990 cell annexin V list and the two positive ratio (late apoptic) of annexin V/PI increase obviously (Fig. 9, A).Statistical analysis shows, the RNA(8 μ g when shown in high dose SEQIDNo.1), SW1990 early apoptosis of cells and late apoptic ratio have statistical significance (Fig. 9, B and 9, C) compared with matched group.
Embodiment 7.miR491-5p activates SW1990 apoptosis by the intrinsic the mitochondrial pathways of cell
With the miR491-5p(0 of the chemosynthesis of ascending-dose, 4,8 μ g) transfection SW1990 cell;
After 48 hours, collecting cell also uses cell pyrolysis liquid cracking, collects supernatant after centrifugal;
Each experimental point is respectively got 15 μ g total proteins and is carried out electrophoretic separation, forwards nitrocellulose filter on after being separated with 12%SDS-PAGE degeneration glue;
Then hybridize for primary antibodie with rabbit anti-cell pigment c antibody, rabbit anti-caspase 9 antibody, the anti-Caspase-3 antibody of rabbit, mouse-anti PARP-1 antibody, mouse-anti beta-actin antibody respectively, with fluorescein-labeled goat-anti rabbit or murine antibody be two resist, finally carry out hybridization signal amplification with the chemiluminescent substrate of ECL.
Result:
Transfection miR491-5p can remarkable Caspase-3 in active cell, 9 and the cutter activation of PARP-1, cytochrome c can be made in endochylema, to discharge (Figure 10) by mitochondrion simultaneously.Illustrate that miR491-5p is the apoptosis activating pancreatic cancer cell SW1990 by regulating and controlling intrinsic the mitochondrial pathways.
Embodiment 8.miR491-5p can suppress PI-3K/Akt and STAT3 signal path to activate
Whether the protein cleavage sample of embodiment 7 is also used for detecting the proliferation signal path of miR491-5p on classics has impact.
Equally, with the miR491-5p(0 of the chemosynthesis of ascending-dose, 4,8 μ g) transfection SW1990 cell;
After 48 hours, collecting cell also uses cell pyrolysis liquid cracking, collects supernatant after centrifugal;
Each experimental point is respectively got 15 μ g total proteins and is carried out electrophoretic separation, forward on nitrocellulose filter (AmershamBiosciences) after being separated with 12%SDS-PAGE degeneration glue, then respectively with the anti-Akt antibody of rabbit, the anti-phosphorylation Akt(p-Akt of rabbit) antibody, the anti-ERK1/2 antibody of rabbit, the anti-phosphorylated CREB 1/2(p-ERK1/2 of rabbit) antibody, mouse-anti STAT3 antibody, mouse-anti pSTAT3 (p-STAT3) antibody, mouse-anti beta-actin antibody is that primary antibodie is hybridized, with fluorescein-labeled goat-anti rabbit or murine antibody be two resist, finally carry out hybridization signal amplification with the chemiluminescent substrate of ECL.
Result:
MiR491-5p all has remarkable inhibitory action to phosphorylation and non-phosphorylating Akt, and is suppress STAT3 phosphorylation level on the main manifestations that affects of STAT3 signal path, and does not have inhibitory action (Figure 11) to the non-phosphoric acid water of STAT3 is flat.Detect and also show, the activation of miR491-5p to ERK does not have remarkable inhibitory action, illustrates that miR491-5p suppresses the activation of some proliferation signal path in cancer of pancreas SW1990 cell alternative.
Discuss:
SW1990 cell line is by people such as AndreasP.Kyriazis, in nineteen eighty-three from constructed by the pancreatic tumor tissue of 56 years old male.In decades, quite valuable tumor cell line in human pancreatic adenocarcinoma research always is.SW1990 all can grow in tissue culture or in nude mice, and in index, the karyological characters etc. such as histologic characteristics, tumor growth characteristic, expression of enzymes spectrum, LDH and CEA all with in vivo cancerous cell without very difference (people such as AndreasP.Kyriazis, 1983).Therefore, in the specific embodiment of the present invention, each side effect that miR491-5p shows SW1990, will represent its effect in animal pattern, even in human body.
As above, shown in result, the present inventor's Late Cambrian microRNA molecules miR491-5p is at Pancreatic Adenocarcinoma and the differential expression in normal cell.And further demonstrate that the purposes of microRNA molecules miR491-5p in the treatment of cancer of pancreas and/or diagnosis and/or prognosis.The present inventor uses the RNA shown in SEQIDNo.1 or the carrier containing the DNA shown in SEQIDNo.2 to experimenter, can statistically significantly suppress the propagation of pancreatic cancer cell and cause cancer cell-apoptosis.
In addition, the present inventor has also set forth the mechanism of miR491-5p the treatment of cancer of pancreas from molecule aspect further.The present inventor proves, miR491-5p can the simultaneously people such as targeting anti-apoptotic genes expression Bcl-XL(NakanoH, 2010) and the 3 ' noncoding region (3 ' UTR) of antioncogene TP53.Study on Molecular Mechanism display miR491-5p brings out the apoptosis of pancreatic cancer cell by the intrinsic path of mitochondrial regulation, and miR491-5p can suppress PI-3K and STAT3 signal path to specificity.The present invention likely produces actively impact to the Clinics and Practices of following cancer of pancreas.
List of references
Bartel,D.P.MicroRNAs:genomics,biogenesis,mechanism,andfunction.Cell2004,116,281-297
Kim,V.N.;Han,J.;Siomi,M.C.BiogenesisofsmallRNAsinanimals.NatRevMolCellBiol2009,10,126-139
Lee,Y.;Ahn,C.;Han,J.;Choi,H.;Kim,J.;Yim,J.;Lee,J.;Provost,P.;Radmark,O.;Kim,S.;Kim,V.N.ThenuclearRNaseIIIDroshainitiatesmicroRNAprocessing.Nature2003,425,415-419
Han,J.;Lee,Y;Yeom,K.H.;Kim,Y.K.;Jin,H.;Kim,V.N.TheDrosha-DGCR8complexinprimarymicroRNAprocessing.GenesDev2004,18,3016-3027
Lund,E.;Guttinger,S.;Calado,A.;Dahlberg,J.E.;Kutay，U.NuclearexportofmicroRNAprecursors.Science(NewYork，N.Y.）2004,303,95-98
Bohnsack,M.T.;Czaplinski,K.;Gorlich,D.Exportin5isaRanGTP-dependentdsRNA-bindingproteinthatmediatesnuclearexportofpre-miRNAs.RNA2004,10,185-191
Ketting,R.F.;Fischer,S.E.;Bernstein,E.;Sijen,T.;Hannon,G.J.;Plasterk,R.H.DicerfunctionsinRNAinterferenceandinsynthesisofsmallRNAinvolvedindevelopmentaltiminginC.elegans.GenesDev2001,15,2654-2659
Hutvagner,G.;McLachlan,J.;Pasquinelli,A.E.;Balint,E.;Tuschl,T.;Zamore,P.D.AcellularfunnctionfortheRNA-interferenceenzymeDicerinthematurationofthelet-7smalltemporalRNA.Science(NewYork，N.Y.）2001,293,834-838
Maniataki,E.;Mourelatos,Z.Ahuman,ATP-independent,RISCassemblymachinefueledbypre-miRNA.GenesDev2005,19,2979-2990
Gregory，R.I.;Chendrimada,T.P.;Cooch,N.;Shiekhattar,R.HumanRISCcouplesmicroRNAbiogenesisandposttranscriptionalgenesilencing.Cell2005,123,631-640
Chendrimada,T.P.;Gregory，R.I.;Kumaraswamy，E.;Norman,J.;Cooch,N.;Nishikura,K.;Shiekhattar,R.TRBPrecruitstheDicercomplextoAgo2formicroRNAprocessingandgenesilencing.Nature2005,436,740-744
Jemal,A.;Siegel,R.;Xu,J.;Ward,E.Cancerstatistics,2010.CACancerJClin2011,60,277-300
Krejs,G.J.Pancreaticcancer:epidemiologyandriskfactors.DigDis2010,28,355-358
Lowenfels,A.B.;Maisonneuve,P.Epidemiologyandriskfactorsforpancreaticcancer.BestPractResClinGastroenterol2006,20,197-209
Wang,J.;Sen,S.MicroRNAfunctionalnetworkinpancreaticcancer:frombiologytobiomarkersofdisease.JBiosci2011,36,481-491
Bloomston,M.;Frankel,W.L.;Petrocca,F.;Volinia,S.;Alder,H.;Hagan,J.P.;Liu,C.G.;Bhatt,D.;Taccioli,C.;Croce,C.M.MicroRNAexpressionpatternstodifferentiatepancreaticadenocarcinomafromnormalpancreasandchronicpancreatitis.JAMA2007,297,1901-1908
Szafranska,A.E.;Davison,T.S.;John,J.;Cannon,T.;Sipos,B.;Maghnouj,A.;Labourier,E.;Hahn,S.A.MicroRNAexpressionalterationsarelinkedtotumorigenesisandnon-neoplasticprocessesinpancreaticductaladenocarcinoma.Oncogene2007,26,4442-4452
Jiao,L.R.;Frampton,A.E.;Jacob,J.;Pellegrino,L.;Krell,J.;Giamas,G.;Tsim,N.;Vlavianos,P.;Cohen,P.;Ahmad,R.;Keller,A.;Habib,N.A.;Stebbing,J.;Castellano,L.MicroRNAstargetingoncogenesaredown-regulatedinpancreaticmalignanttransformationfrombenigntumors.PLoSOne2012,7,e32068
Ali,S.;Saleh,H.;Sethi,S.;Sarkar,F.H.;Philip,P.A.MicroRNAprofilingofdiagnosticneedleaspiratesfrompatientswithpancreaticcancer.BrJCancer2012,107,1354-1360
Papaconstantinou,I.G.;Manta,A.;Gazouli,M.;Lyberopoulou,A.;Lykoudis,P.M.;Polymeneas,G.;Voros,D.ExpressionofMicroRNAsinPatientsWithPancreaticCancerandItsPrognosticSignificance.Pancreas2012Jul30.[Epubaheadofprint]
Zhang,J.;Du,Y.Y.;Lin,Y.F.;Chen,Y.T.;Yang,L.;Wang,H.J.;Ma,D.Thecellgrowthsuppressor,mir-126,targetsIRS-1.BiochemBiophysResCommun2008,377,136-140
Sambrook，J.，Russell，DavidW.，MolecularCloning:ALaboratoryManual，3
rdedition，2001，NY，ColdSpringHarbor
AndreasPKyriazis,WilliamBMcCombsIII,AveryASandberg,AikateriniAKyriazis,NathanHSloaneandRossLapera.EstablishmentandCharacterizationofHumanPancreaticAdenocarcinomaCellLineSW-1990inTissueCultureandtheNudeMouse.CANCERRESEARCH.198343:4393-4401
NakanoH,MiyazawaT,KinoshitaK,YamadaY,YoshidaT.FunctionalscreeningidentifiesamicroRNA,miR-491thatinducesapoptosisbytargetingBcl-X(L)incolorectalcancercells.IntJCancer.2010Sep1;127(5):1072-80.
Claims (6)
1. the purposes of the ripe miR491-5p of microRNA molecules in the medicine for the preparation for the treatment of cancer of pancreas.
2. purposes according to claim 1, wherein said ripe miR491-5p is the RNA shown in SEQIDNO:1.
3. the purposes of the ripe miR491-5p of microRNA molecules in the device for the preparation of diagnosis and/or prognosis cancer of pancreas.
4. purposes according to claim 3, wherein said ripe miR491-5p is the RNA shown in SEQIDNO:1.
5. purposes according to claim 3, wherein said device is test kit, it comprise RNA extract reagent, buffer system, Reverse Transcription, pcr amplification reagent, for the primer pair of ripe miR491-5p and operation instructions.
6. purposes according to claim 5, the wherein said primer pair for ripe miR491-5p is the DNA shown in SEQIDNO:3 and SEQIDNO:4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210530716.3A CN103861121B (en) | 2012-12-10 | 2012-12-10 | The purposes of microRNA molecules miR491-5p in the treatment of cancer of pancreas and/or diagnosis and/or prognosis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210530716.3A CN103861121B (en) | 2012-12-10 | 2012-12-10 | The purposes of microRNA molecules miR491-5p in the treatment of cancer of pancreas and/or diagnosis and/or prognosis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103861121A CN103861121A (en) | 2014-06-18 |
| CN103861121B true CN103861121B (en) | 2016-02-24 |
Family
ID=50900504
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210530716.3A Active CN103861121B (en) | 2012-12-10 | 2012-12-10 | The purposes of microRNA molecules miR491-5p in the treatment of cancer of pancreas and/or diagnosis and/or prognosis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103861121B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105497919A (en) * | 2015-12-22 | 2016-04-20 | 中国人民解放军第三军医大学第一附属医院 | Application of miR-506 in preparation of drug for preventing or/and treating pancreatic cancer |
| CN106566884A (en) * | 2016-11-04 | 2017-04-19 | 邱宾涛 | Application of C17orf99 in preparation of reagent for monitoring relapse and metastasis of pancreas cancer |
| CN106755309A (en) * | 2016-11-18 | 2017-05-31 | 北京致成生物医学科技有限公司 | Application of the molecular marked compound in cancer of pancreas prognosis evaluation product is prepared |
| CN108531587A (en) * | 2018-04-09 | 2018-09-14 | 贵州医科大学附属医院 | Detection methods of the microRNA -138-5p to human pancreatic cancer cell Apoptosis under hypoxemia |
| CN109295220B (en) * | 2018-09-28 | 2021-11-19 | 北京致成生物医学科技有限公司 | Application of miR-495-5p in preparation of products for diagnosing, prognosing, preventing or treating pancreatic cancer |
| CN109486952A (en) * | 2018-12-20 | 2019-03-19 | 中国医学科学院北京协和医院 | MiR-495 is preparing the application in Pancreatic Neuroendocrine Tumors diagnostic tool |
| CN112391470A (en) * | 2020-11-11 | 2021-02-23 | 广东医科大学 | Pancreatic cancer miRNA prognosis model establishment and targeted gene screening method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009044895A1 (en) * | 2007-10-03 | 2009-04-09 | Kyowa Hakko Kirin Co., Ltd. | Composition inhibiting the expression of target gene |
| GB2465088A8 (en) * | 2008-10-30 | 2010-12-01 | Caris Mpi Inc | Methods for assessing RNA patterns |
| CA2795776A1 (en) * | 2010-04-06 | 2011-10-13 | Caris Life Sciences Luxembourg Holdings, S.A.R.L. | Circulating biomarkers for disease |
-
2012
- 2012-12-10 CN CN201210530716.3A patent/CN103861121B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009044895A1 (en) * | 2007-10-03 | 2009-04-09 | Kyowa Hakko Kirin Co., Ltd. | Composition inhibiting the expression of target gene |
| GB2465088A8 (en) * | 2008-10-30 | 2010-12-01 | Caris Mpi Inc | Methods for assessing RNA patterns |
| CA2795776A1 (en) * | 2010-04-06 | 2011-10-13 | Caris Life Sciences Luxembourg Holdings, S.A.R.L. | Circulating biomarkers for disease |
Non-Patent Citations (4)
| Title |
|---|
| 293-siDrosha 稳定细胞系模型的建立及microRNA 相关功能的检测;郭蓉等;《基础医学与临床》;20120430;第32卷(第4期);381-385 * |
| Functional screening identifies a microRNA, miR-491 that induces apoptosis by targeting Bcl-XL in colorectal cancer cells.;Haruo N.等;《Int J Cancer》;20101231;第127卷(第5期);1072-1080 * |
| microRNA-491在胃癌中的表达和临床意义;杜宗敏;《中国优秀硕士学位论文全文数据库》;20101015;E072-107 * |
| 以hsa-miR-491-3p为靶标的反义寡核苷酸对NCI-H446细胞生物学特性的影响;官士珍等;《中国癌症杂志》;20111231;第21卷(第3期);171-176 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103861121A (en) | 2014-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103861121B (en) | The purposes of microRNA molecules miR491-5p in the treatment of cancer of pancreas and/or diagnosis and/or prognosis | |
| Li et al. | MicroRNA-9 and breast cancer | |
| Sabit et al. | Triple negative breast cancer in the era of miRNA | |
| Vandenboom Ii et al. | MicroRNA and cancer: tiny molecules with major implications | |
| Karius et al. | MicroRNAs in cancer management and their modulation by dietary agents | |
| US20140088170A1 (en) | Differentially expressed microrna molecules for the treatment and diagnosis of cancer | |
| Milani et al. | Targeting miR‑155‑5p and miR‑221‑3p by peptide nucleic acids induces caspase‑3 activation and apoptosis in temozolomide‑resistant T98G glioma cells | |
| WO2012083969A2 (en) | Microrna for diagnosis of pancreatic cancer | |
| Liu et al. | miR-371-5p down-regulates pre mRNA processing factor 4 homolog B (PRPF4B) and facilitates the G1/S transition in human hepatocellular carcinoma cells | |
| WO2008029790A1 (en) | Novel nucleic acid | |
| Zhou et al. | Exosomal circRNAs: emerging players in tumor metastasis | |
| Elkady et al. | miRNAs driving diagnosis, progression, and drug resistance in multiple myeloma | |
| WO2018028249A1 (en) | Mirna and use thereof in treatment of metabolic disease | |
| CN104208723B (en) | MiR-638 application in anti-acute myeloid leukemia | |
| WO2012082821A2 (en) | Melanoma treatments | |
| Allahyari et al. | RNA interference: Promising approach for breast cancer diagnosis and treatment | |
| CN106244688B (en) | A kind of marker for assessing adenocarcinoma of colon risk | |
| CN101886115A (en) | Application of three microRNAs in diagnosis and treatment of human acute myeloid leukemia | |
| Ge et al. | Exploring the mechanism of baicalin intervention in breast cancer based on MicroRNA microarrays and bioinformatics strategies | |
| CN101445534A (en) | Use of high efficiency siRNA for preparing tumor migration inhibition drug | |
| CN111020036B (en) | Application of human circ-STXBP5L and related product | |
| CN112375823B (en) | Application of miRNA inhibitor in preparation of medicine for treating and/or preventing lymphoma | |
| CN111172289B (en) | Marker of miRNA for diagnosing and treating liver cancer | |
| Khalid et al. | Validation of MicroRNAs (miRNAs) in the Early Diagnosis and Treatment of Hepatocellular Carcinoma (HCC) | |
| Khalid et al. | Validation of mRNAs in Early Diagnosis and Treatment of Hepatocellular Carcinoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |