CN113735979A

CN113735979A - Recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein and use thereof

Info

Publication number: CN113735979A
Application number: CN202110802140.0A
Authority: CN
Inventors: 肖业臣; 宗文博; 辛本凯
Original assignee: Jilin University
Current assignee: Jilin University
Priority date: 2021-07-15
Filing date: 2021-07-15
Publication date: 2021-12-03

Abstract

The invention relates to the field of biotechnology, in particular to a recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein and use thereof, wherein the fusion protein consists of PDGF-BB and human IgG Fc1 fragments, and the nucleotide sequence of the fusion protein is shown as SEQ ID NO: 1. The fusion protein can be efficiently expressed in yeast cells, and the purification process is simple, thereby being beneficial to further large-scale preparation. Compared with the natural PDGF-BB, the rhPDGF-BB-Fc obtained by the invention can effectively improve the half-life period in the body of the medicine and reduce the dosage of the medicine, and simultaneously has the biological activity which is similar to that of the natural PDGF-BB on the same medicine dosage; can shorten the wound healing time, reduce the drug cost and meet the needs of industrial development.

Description

Recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein and use thereof

Technical Field

The invention relates to the technical field of genetic engineering drugs, in particular to a recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein and use thereof.

Background

Platelet-derived growth factor (PDGF) is a cytokine secreted mainly by platelets at the site of injury. PDGF has been found to have a wide range of biological activities, and in particular to play an important role in promoting nerve regeneration, angiogenesis and wound repair. PDGF as nerve growth and trophic factor can be used for postoperative treatment of central and peripheral nerve injury, ischemic encephalopathy, cerebral trauma and apoplexy sequelae, cerebral hypoplasia, epilepsy, cerebellar atrophy, dementia, hemiplegia, spinal cord trauma, etc.; as a blood vessel forming and regenerating factor, can be used for treating diseases such as chronic myocardial ischemia (coronary heart disease), acute and chronic myocardial infarction and the like; PDGF can promote the proliferation of fibroblasts, smooth muscle cells and capillary endothelial cells and accelerate the formation of wound granulation tissues as a tissue repair factor for wound healing, and can be used for treating various wound surfaces such as skin injury, burn and scald, ulcer (such as corneal ulcer, gastric ulcer, duodenal ulcer and ulcerative colitis), bedsore, wounds after plastic cosmetology and the like, so that the PDGF has wide clinical application value.

As a bioactive molecule, ensuring its bioactivity, the necessary conditions are correct three-dimensional conformation and glycosylation modification. Having a complete post-translational modification function is the reason why eukaryotic expression vectors are chosen as the host for expression of most biological drug proteins. The pichia pastoris expression vector is adopted, so that the yield of the dimeric protein can be improved, the biological activity of the recombinant protein is ensured, and the pichia pastoris expression vector is suitable for large-scale production. The key to the research and development of recombinant PDGF protein drugs is to ensure the yield and biological activity and improve the half-life of the PDGF protein drugs in vivo.

The Fc comes from human immunoglobulin IgG, and the half-life of the Fc is prolonged through an FcRn-mediated recycling mechanism, so that the Fc can be used as a chaperone protein to prolong the half-life of a target protein in vivo. In addition, the Fc forms a dimer by itself, thereby facilitating the formation of a dimeric protein and enhancing the biological activity of the dimeric protein.

In the prior art, the recombinant platelet derived factor (PDGF) has the problems of low expression level, difficult purification and short half-life, and needs to be optimized and improved.

Disclosure of Invention

The first purpose of the invention is to provide a recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein, which solves the problems of low expression level, difficult purification and short half-life of the recombinant platelet-derived factor (PDGF) in the prior art.

The second purpose of the invention is to provide a preparation method of recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein.

The third purpose of the invention is to provide a purification method of recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein.

The fourth purpose of the invention is to provide a protein gel containing recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein and application thereof in promoting wound healing.

In order to achieve the technical purpose and achieve the technical effect, the invention is realized by the following technical scheme:

according to the purpose of the invention, the invention provides a recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein, which consists of human PDGF-BB and a human IgG Fc1 fragment.

Further, the nucleotide sequence of the recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein is shown in SEQ ID NO. 1.

Contains the recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein.

Further, the recombinant expression vector is a pichia pastoris expression vector.

According to the object of the present invention, the present invention provides a method for preparing a recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein, comprising the steps of:

1) constructing a gene expression vector for coding the rhPDGF-BB-Fc fusion protein:

obtaining a gene for coding the rhPDGF-BB-Fc fusion protein by adopting a synthetic method, and obtaining a recombinant expression vector containing the rhPDGF-BB-Fc fusion protein gene;

specifically, the steps of constructing the gene expression vector for encoding rhPDGF-BB-Fc fusion protein are as follows: according to the preferred codon of yeast and the characteristics of host cells, the fusion gene is optimized and modified, and the recombinant expression plasmid is obtained by adopting an artificial synthesis method. The plasmid expression vector is pPICA alpha;

2) stable expression of rhPDGF-BB-Fc fusion protein in yeast cells:

transferring an expression vector containing the rhPDGF-BB-Fc fusion protein gene into a yeast cell, and screening a strain of the rhPDGF-BB-Fc fusion protein which is stably expressed;

specifically, the transfection method adopts an electrical transformation method, and the recombinant pichia pastoris strain with high efficiency and stable expression is screened out by using bleomycin (Zeocin).

3) High density culture of rhPDGF-BB-Fc fusion protein:

culturing the screened stable strain in a fermentation tank at high density, and collecting the culture solution supernatant containing the rhPDGF-BB-Fc fusion protein;

specifically, after the stable strains selected above were amplified using a shake flask, inducible expression was performed using a fermenter. And (3) obtaining the culture solution supernatant of the high-expression rhPDGF-BB-Fc fusion protein by optimizing the fermentation conditions.

According to the object of the present invention, the present invention provides a method for purifying a recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein, the method comprising the steps of:

1) primary treatment of rhPDGF-BB-Fc fusion protein fermentation liquor:

performing microfiltration (0.22 μ M) and ultrafiltration (5kDa) on the supernatant of the fermentation liquor by using a tangential flow filtration device;

2) ProteinA affinity chromatography:

and (3) performing microfiltration and ultrafiltration treatment on the supernatant, centrifuging and collecting, and performing affinity ProteinA column chromatography according to the characteristics of the fusion protein coupled Fc fragment.

In accordance with the purpose of the present invention, there is provided a protein gel comprising a pharmaceutically acceptable excipient and an effective amount of the recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein of claim 1 as an active ingredient of the protein gel.

The protein gel is applied to promoting wound healing.

The invention has the beneficial effects that:

1. the Fc fragment of human IgG is fused at the C end of PDGF-BB, and the fusion gene is optimized and modified according to the yeast preferred codon and the characteristics of host cells. Obtaining the rhPDGF-BB-Fc fusion protein by using a pichia pastoris expression system. The fusion protein has three functions, namely, the Fc fragment can enhance the long-acting property and stability of PDGF-BB, promote the stability of the PDGF-BB in vivo and increase the half-life; the Fc often forms a dimer, and the PDGF-BB can only form the dimer and has higher biological activity, so that the fusion expression of the Fc and the PDGF-BB is beneficial to the formation of the PDGF-BB dimer; thirdly, the immune system at the wound site needs to be activated for anti-inflammatory and antibacterial effects, and Fc can enhance the wound-promoting effect of PDGF-BB by activating the immune system.

2. The recombinant protein prepared by the invention has better application prospect and market development value. The recombinant protein is further taken as a core to prepare a gel dosage form suitable for external application, and the gel dosage form is subjected to pharmacodynamic and toxicological researches before clinic, and is finally expected to be developed into a novel medicine in the field of wound repair.

Of course, it is not necessary for any one product that embodies the invention to achieve all of the above advantages simultaneously.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art that other drawings can be obtained according to the drawings without creative efforts.

FIG. 1 is a PDGF-B-Fc double enzyme digestion verification and sequencing diagram;

FIG. 2 is an identification diagram of rhPDGF-BB-Fc recombinant yeast;

FIG. 3 is a graph showing the results of SDS-PAGE measurement of the expression of fermentation supernatants;

FIG. 4 is a diagram of the results of the Westernblot validation of fermentation supernatants;

FIG. 5 is a graph showing the results of SDS-PAGE detection of protein A purification;

FIG. 6 is a diagram showing the results of Westernblot validation of protein A purification;

FIG. 7 is a graph of the activity of CCK8 in detecting rhPDGF-BB-Fc;

FIG. 8 is a graph of an in vivo half-life assay for rhPDGF-BB-Fc;

FIG. 9 is a graph showing the results of rhPDGF-BB-Fc protein gel promoting the healing of rat skin.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1

Yeast transformation and identification of PDGF-B-Fc recombinant plasmid

1) Thawing frozen X33 strain on ice, sucking 100 μ L of bacterial liquid, inoculating to 5mLYPD liquid culture medium, shaking overnight at 28 deg.C and 200 rpm.

2) And (3) sucking 500 mu L of cultured bacterial liquid, inoculating the bacterial liquid into 250mLYPD liquid culture medium, shaking the culture medium at 28 ℃ and 200rpm for 16h by a shaking table, and starting to prepare competence when the bacterial liquid OD600 reaches 1.3-1.5.

3) The bacterial liquid is placed on ice for 30min, centrifuged at 4000rpm of a 4 ℃ centrifuge for 5min, and the precipitate is collected and resuspended in 40mL of 0 ℃ ultrapure water.

4) Centrifuge 4000rpm at 4 ℃ for 5min, collect the pellet, and resuspend 40mL of 0 ℃ sorbitol (1M).

5) Centrifuging at 4 deg.C with 4000rpm centrifuge for 5min, collecting precipitate, and gently pumping 300 μ L sorbitol (1M).

6) Add 10. mu.L of the linear recombinant plasmid into 90. mu.L of the competent yeast, mix well, transfer to an electric rotor, and stand on ice for 5 min.

7) Competent electric shock transformation, 270V, 11ms, 1mL sorbitol (1M) was added immediately in an electric rotor, and the mixture was allowed to stand at a constant temperature of 28 ℃ for 1 hour.

8) The mixture was transferred to a centrifuge tube, centrifuged at low speed, the supernatant discarded, and 100. mu.L of the bacterial suspension was spread on YPD plates containing 100. mu.g/mLzeocin. And (3) carrying out inverted culture in a constant temperature incubator at 28 ℃ for 48 h. The colony status was observed.

9) The primer sequence is as follows:

α-factorP1：F-5’-ACAACAGAAGATGAAACGGCACA-3’，

PDGFP2：R-5’-GGAAGTTGGCGTCAGTACGGTCA-3’。

10) the PCR reaction was carried out in the following Table 1 (20. mu.L system):

TABLE 1

Composition (I)	Volume of
		Upstream primer	1μL
Downstream primer	1μL
		DNA template	2μL
ddH₂O	6μL
		2×Mix	10μL

11) Randomly picking 4 monoclonal colonies on YPD plate, dipping a small amount of thallus and placing in 10. mu.L ddH₂In O, the cells were dissolved in water and used as DNA templates for colony PCR.

12) PCR was set for 30 cycles and the procedure is shown in table 2 below:

TABLE 2

Step (ii) of	Temperature of	Time
			Complete melting	94℃	5min
Untwisting	94℃	30s
			Annealing	58℃	30s
Extension	72℃	1min
			Is fully extended	72℃	10min

13) After the PCR was completed, 1% agarose gel electrophoresis was performed.

Example 2

Fermentation and identification of PDGF-BB-Fc recombinant protein

The experiment uses the Shanghai Baoxing full-automatic 7L fermentation tank, and adopts a methanol induction method to realize high expression of target protein by controlling indexes such as pH value, DO value, tank pressure, temperature, ventilation capacity and the like of fermentation liquor. The pilot fermentation process is divided into two stages of biomass accumulation and methanol induced expression, and the specific experimental method is as follows:

(1) and (4) preparing a seed solution. Firstly, taking strains from an ultra-low temperature refrigerator, inoculating the strains into a 10mLYPD liquid culture medium according to a ratio of 1:100, culturing for 24h at 30 ℃ and 220rpm, then carrying out secondary amplification to a 200mLBMGY culture medium, culturing for 24h at 30 ℃ and 220rpm, taking 1mL of bacterial liquid to add into 1L of BMGY culture medium when OD600 is 2-6, and collecting the bacterial liquid as upper tank seed liquid when OD600 is about 5.

(2) Fermentation production

The fermentation tank was set with the following parameters: the temperature is 30 ℃, the rotating speed is 600rpm, the ventilation volume is 14L/min, and the tank pressure is 0.068 MPa. After the culture medium is cooled, the inoculation port is opened under the protection of alcohol flame, the seed liquid is poured into the tank, then the inoculation cover is screwed tightly, and the flame ring is removed. And setting a fermentation batch number, checking the pipeline connection condition, and starting fermentation after the completion of confirmation.

1) Accumulation of biomass

At this stage, sampling was performed 1 time every 6 hours, OD600 and wet weight of the cells were measured, and the growth state of yeast in the fermenter was analyzed. The Dissolved Oxygen (DO) concentration was gradually decreased after inoculation and the DO level was maintained above 20% by gradually increasing the stirring speed. When glycerol was depleted from the fermentation starter medium, the DO value rose dramatically. Feeding a fed-batch culture medium containing 50% of glycerol, feeding the glycerol at a speed of 12mL/h by using a feed pump, and in the glycerol feeding process, increasing the rotating speed or introducing oxygen to ensure that the DO value is not lower than 20%. When the wet weight of the thalli reaches 100g/L, no glycerol is added, starvation culture is continued, and after 1h, a methanol induction stage is carried out.

2) Methanol induced expression

And (3) a methanol induction stage, sampling once every 12h, measuring OD600 and the wet weight of the thalli, reserving the sample, and detecting the protein expression condition by electrophoresis. And monitoring the fluctuation of the DO value and the temperature change of the fermentation liquor to judge whether the methanol in the fermentation liquor is excessive. If the carbon source is limited, the feeding speed of the feeding culture medium containing 50 percent of methanol is increased, and if the methanol is excessive, the feeding speed of the feeding culture medium containing 50 percent of methanol is adjusted slowly until the proper speed is reached.

Expression was induced by feeding 50% methanol feed to the fermentor at an initial rate of 6mL/h, with DO maintained between 20% and 40%, to acclimatize the yeast to methanol as the sole carbon source. During this period, the DO value is unstable, relatively large fluctuation is generated, and low-flow oxygen is introduced to keep the DO value stable. And after the yeast adapts to methanol as a unique carbon source, maintaining the DO value stable, increasing the speed of methanol supplement until the speed reaches 10mL/h, ensuring the DO value stable by using the methanol flow acceleration speed and the oxygen introduction amount, wherein the process needs 18h, and the wet weight of the thalli reaches more than 200 g/L. After that, the speed of methanol supplement is constant at 12mL/h, DO is maintained between 20% and 30%, methanol induction is carried out for 48h, the wet weight is 342g/L, and the fermentation is finished.

SDS-PAGE electrophoresis and Westernblot were performed to determine the molecular weight and expression of PDGF-BB-Fc in the fermentation broth, and the results are shown in FIGS. 3 and 4.

Example 3

Purification and identification of PDGF-BB-Fc recombinant protein

PDGF-BB-Fc recombinant protein is subjected to microfiltration and ultrafiltration treatment, and then purified by protein affinity chromatography.

1) Column balancing: before use, the ProteinA needs to be removed 20% ethanol, washed with 5-10 column volumes of deionized water, washed with at least 5 column volumes of equilibration buffer, and equilibrated with the equilibration buffer until the absorbance of the detector is zero.

2) And (3) loading the concentrated fermentation broth supernatant into a ProteinA affinity chromatography column at the flow rate of 3 mL/min.

3) Washing: about 5 column volumes were washed with equilibration buffer.

4) And (3) elution: eluting with citric acid eluent at flow rate of 1mL/min, and collecting eluates of each stage according to elution peak.

5) And (5) detecting the purification condition of the protein in the collected elution peak by SDS-PAGE electrophoresis and Western blot. The results are shown in FIGS. 5 and 6.

6) And (3) chromatographic column preservation: the column was washed with equilibration buffer, about 10 column volumes. Washing with 5-10 column volumes of deionized water, balancing the chromatographic column with at least 5 column volumes of 20% ethanol, and storing in a 4 deg.C chromatographic cabinet.

Example 4

Analysis of biological Activity of rhPDGF-BB-Fc

Referring to an international universal activity test method, NIH3T3 cells are taken as a research object, PBS is taken as a blank control, commercial hPDGF-BB is taken as a positive control, and the in-vitro proliferation promoting capacity of the rhPDGF-BB-Fc on the NIH3T3 cells is detected by a CCK8 method.

The results of this example are shown in FIG. 7.

Example 5

rhPDGF-BB-Fc in vivo pharmacokinetic assay

Female 5-6 week old Balb/c mice were selected, injected subcutaneously with rhPDGF-BB-Fc at 5mg/kg body weight (with the same amount of rhPDGF-BB injected as a control), and subjected to ELISA at 2,4,8,24,48,72, and 144h for blood withdrawal.

Example 6

Preparation of rhPDGF-BB-Fc protein gel

1) 0.105g of carbomer 940 is taken and dispersed in a mixture of 15mL of glycerol and 5mL of propylene glycol, stirred uniformly and dispersed uniformly, the pH is adjusted to 6.5 by using 0.1mol/L NaHCO3, and the mixture is heated in a water bath at 80 ℃ for 30 min.

2) Autoclaving at 121 deg.C for 30 min.

3) After the gel is cooled, adding recombinant PDGF-BB-Fc proteins with different concentrations of 0 mug/mL, 2 mug/mL and 10 mug/mL respectively, adding heparin sodium and human serum albumin as protective agents, stirring uniformly, and subpackaging and storing under an aseptic condition.

Example 7

Pharmacodynamic research of rhPDGF-BB-Fc protein gel

1) A total of 8 cleaning-grade SD rats are selected, randomly grouped, and divided into two groups of high-dose gel and low-dose gel.

2) The skin on both sides of the spine of the rat is depilated by adopting a homosomatic left and right self-contrast method.

3) The skin on both sides of the back was subjected to a damage treatment using 5% chloral hydrate anesthesia and the area of damage was recorded.

4) After the preparation of the damaged skin model is completed, back skin smearing is immediately carried out, excipient control (gel matrix without PDGF-BB-Fc) and PDGF-BB-Fc gel are respectively and directly coated on the surface of wound skin on the left side and the right side of the skin of each rat, vaseline gauze is pasted on the wound surface, and the rat is fed in a single cage.

5) Wound healing area was recorded daily, dressing changes were made every other day, wound healing effect was observed and wound healing time was recorded.

The results of this example are shown in FIG. 9.

The preferred embodiments of the invention disclosed above are intended to be illustrative only. The preferred embodiments are not intended to be exhaustive or to limit the invention to the precise embodiments disclosed. Obviously, many modifications and variations are possible in light of the above teaching. The embodiments were chosen and described in order to best explain the principles of the invention and the practical application, to thereby enable others skilled in the art to best utilize the invention. The invention is limited only by the claims and their full scope and equivalents.

SEQUENCE LISTING

<110>

<120> a recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein and use thereof

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 1074

<212> DNA

<213> Artificial sequence

<400> 1

atgagtcttggttccctgactattgctgagccagctatgattgctgaatgtaagactcgt 60

actgaagttttcgaaatttcccgtcgtcttattgaccgtactaacgccaacttcctggtt 120

tggccaccatgtgttgaagttcaacgttgttctggttgttgtaacaaccgtaacgttcaa 180

tgtcgtccta ctcaagttca actgcgtcca gttcaagtta gaaagattga aattgttaga 240

aagaagccaa tttttaagaa ggctactgtt actctggaag accaccttgc ttgtaagtgt 300

gaaactgttg ctgctgctcg tccagttact ggtggtggtg gttctggtgg tggtggttct 360

ggtggtggtg gttctgaacc aaagtcttgt gataagactc acacttgtcc accatgtcca 420

gctcctgaac ttctgggtgg accatctgtc tttcttttcc caccaaaacc taaggacact 480

cttatgattt cccgtactcc tgaagtcact tgtgttgttg tggacgtgag tcacgaagac 540

cctgaggtca agttcaactg gtacgttgac ggtgttgaag ttcataatgc caagactaag 600

cctcgtgaag agcaatacaa cagtacttac cgtgttgtca gtgtccttac cgtcctgcac 660

caggactggc tgaatggtaa ggagtacaag tgtaaggtct ccaacaaggc ccttccagcc 720

ccaatcgaga agaccatctc caaagccaag ggtcaaccac gtgaaccaca agtttacacc 780

ctgcctccat cccgtgagga gatgaccaag aaccaggtca gtctgacttg tctggtcaag 840

ggtttctatc cttccgacat cgctgttgag tgggagtcca acggtcaacc agaaaacaac 900

tacaagacca cccctccagt tcttgactcc gacggttcct tcttccttta ctccaagctt 960

accgttgaca agtccagatg gcaacaaggt aacgttttct catgttccgt tatgcacgaa 1020

gctctgcaca accactacac tcaaaagagc ctttccctgt ccccaggtaa gtaa 1074

<210> 2

<211> 356

<212> PRT

<213> Artificial sequence

<400> 2

Ser Leu Gly Ser Leu Thr Ile Ala Glu Pro Ala Met Ile Ala Glu Cys

1 5 10 15

Lys Thr Arg Thr Glu Val Phe Glu Ile Ser Arg Arg Leu Ile Asp Arg

20 25 30

Thr Asn Ala Asn Phe Leu Val Trp Pro Pro Cys Val Glu Val Gln Arg

35 40 45

Cys Ser Gly Cys Cys Asn Asn Arg Asn Val Gln Cys Arg Pro Thr Gln

50 55 60

Val Gln Leu Arg Pro Val Gln Val Arg Lys Ile Glu Ile Val Arg Lys

65 70 75 80

Lys Pro Ile Phe Lys Lys Ala Thr Val Thr Leu Glu Asp His Leu Ala

85 90 95

Cys Lys Cys Glu Thr Val Ala Ala Ala Arg Pro Val Thr Gly Gly Gly

100 105 110

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Pro Lys Ser

115 120 125

Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu

130 135 140

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu

145 150 155 160

Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser

165 170 175

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu

180 185 190

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr

195 200 205

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn

210 215 220

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro

225 230 235 240

Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln

245 250 255

Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val

260 265 270

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val

275 280 285

Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro

290 295 300

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr

305 310 315 320

Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val

325 330 335

Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu

340 345 350

Ser Pro Gly Lys

355

Claims

1. A recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein, comprising: the fusion protein consists of PDGF-BB and human IgG Fc1 fragments.

2. The recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein of claim 1, wherein: the nucleotide sequence of the fusion protein is shown as SEQ ID NO. 1.

3. A recombinant expression vector comprising the recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein of claim 2.

4. The recombinant expression vector of claim 3, wherein: the recombinant expression vector is a pichia pastoris expression vector.

5. A method of producing the fusion protein of claim 1, wherein: the preparation method comprises the following steps:

2) stable expression of rhPDGF-BB-Fc fusion protein in yeast cells:

3) high density culture of rhPDGF-BB-Fc fusion protein:

and (3) culturing the screened stable strain in a fermentation tank at high density, and collecting a culture solution supernatant containing the rhPDGF-BB-Fc fusion protein.

6. A method of purifying the fusion protein of claim 1, wherein: the purification method comprises the following steps:

1) primary treatment of rhPDGF-BB-Fc fusion protein fermentation liquor:

performing microfiltration and ultrafiltration treatment on the supernatant of the fermentation liquor by using a tangential flow filtration device;

2) ProteinA affinity chromatography:

7. A protein gel is characterized in that: the protein gel comprises pharmaceutically acceptable excipient, and effective amount of recombinant human platelet-derived factor (rhPDGF-BB) -Fc fusion protein as claimed in claim 1, which is used as active ingredient of protein gel.

8. Use of a protein gel according to claim 7 for promoting wound healing.