CN113735920A - Application of cyanogenic glycoside compound Menisdaurin F in preparation of anti-hepatitis B virus pharmaceutical composition - Google Patents
Application of cyanogenic glycoside compound Menisdaurin F in preparation of anti-hepatitis B virus pharmaceutical composition Download PDFInfo
- Publication number
- CN113735920A CN113735920A CN202111055432.9A CN202111055432A CN113735920A CN 113735920 A CN113735920 A CN 113735920A CN 202111055432 A CN202111055432 A CN 202111055432A CN 113735920 A CN113735920 A CN 113735920A
- Authority
- CN
- China
- Prior art keywords
- menisdaurin
- hepatitis
- cyanogenic glycoside
- preparation
- glycoside compound
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
- A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H1/00—Processes for the preparation of sugar derivatives
- C07H1/06—Separation; Purification
- C07H1/08—Separation; Purification from natural products
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H15/00—Compounds containing hydrocarbon or substituted hydrocarbon radicals directly attached to hetero atoms of saccharide radicals
- C07H15/20—Carbocyclic rings
- C07H15/22—Cyclohexane rings, substituted by nitrogen atoms
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Engineering & Computer Science (AREA)
- Virology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Communicable Diseases (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oncology (AREA)
- Saccharide Compounds (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses an application of a cyanogenic glycoside compound Menisdaurin F in preparing an anti-hepatitis B virus pharmaceutical composition, which takes HepG2.2.15 cells as a model and utilizes compounds with different concentrations to carry out an HBV replication inhibition experiment. The results show that the compounds with different concentrations have no inhibition effect on cell proliferation, the HBV DNA inhibition rate in the cell supernatant reaches 50% at 0.809mM, and the expression of X genes in the cells can be obviously reduced. The invention provides a lead compound for developing a new anti-hepatitis B virus medicament, and provides medicinal values in the aspect of anti-hepatitis B virus and liver cancer transformation.
Description
[ technical field ] A method for producing a semiconductor device
The invention relates to the technical field of anti-hepatitis B virus treatment medicines, and relates to an application of a cyanogenic glycoside compound Menisdaurin F in preparation of an anti-hepatitis B virus medicinal composition.
[ background of the invention ]
Viral Hepatitis B is caused by infection with Hepatitis B Virus (HBV), and is dominated by inflammatory lesions of the liver and impaired function of the liver and kidney. HBV long-term infection can progress into diseases related to hepatitis B, such as cirrhosis, hepatic fibrosis and primary hepatocellular carcinoma. More than 100 million patients with liver cancer caused by HBV die every year in the world, and 30 million patients in China. The basic purpose of treating hepatitis B is to eliminate or permanently inhibit the replication of HBV virus, and the antiviral drugs used clinically at present contain nucleoside analogues and interferon, but both of which cannot kill virus effectively for a long time, and the drug resistance and drug side effects caused by the antiviral drugs become the problems which cannot be ignored clinically. Therefore, the development of novel anti-hepatitis B drugs is urgently needed.
The long-term infection of HBV and the low cure rate of clinical drugs are caused by the stable existence of cccDNA which is a virus replication template. HBV virus is a DNA virus, the genetic material of which is double-stranded relaxed circular DNA, which is converted in the nucleus of a cell into free covalently closed circular DNA (cccDNA) after infecting the cell, wherein the X protein (HBx) encoded by the HBV genome can bind to cccDNA and is essential for initiating and maintaining transcription of the cccDNA template. Meanwhile, HBx can also act on host cells to mediate cell proliferation and apoptosis, inflammation invasion and body immune regulation processes and induce liver cancer. Therefore, the reduction of the expression of the X gene in the hepatitis B cell provides a new direction for the research and development of anti-hepatitis B medicines.
The western medicines mainly take antiviral treatment as main treatment, and the treatment methods adopted by the traditional Chinese medicines comprise antiviral treatment, anti-inflammatory treatment, liver protection treatment, hepatic fibrosis treatment and the like. Cyanogenic glycosides are nitrile group-containing compounds, and non-cyanogenic glycosides are not easily hydrolyzed or hydrolyzed without hydrogen cyanide, and are rare. Studies have been made on cyanogenic glycosides, such as Guohui, Zhang Ling, chemical composition and pharmacological action of sedum sarmentosum, Food and medicine Food and Drug 2006, volume 8, 01A19-22, introducing 1 water-soluble cyanogenic glycosides component from herba Sedi, named as stringy stonecrop herb glycoside, and determining its structure as 2-cyano-4-O-beta-D-glucose-trans-butene-2-ol, and its anti-hepatitis activity, clinical applicationThe research shows that the stringy stonecrop herb has certain curative effect on various hepatitis such as viral hepatitis, icterohepatitis and the like. For another example, chinese patent application CN201110150588 relates to a method for extracting cyanogenic glycoside from rhodiola rosea, which comprises the following process steps: taking rhodiola rosea roots, crushing, adding ethanol, putting into a microwave extraction device for microwave extraction, combining extract liquor, filtering, recovering ethanol under reduced pressure and concentrating, carrying out 4-8-grade countercurrent extraction by using ethyl acetate, adding into a macroporous adsorption resin column for adsorption, eluting by using 40-60% ethanol, collecting eluent with the volume of 3-8 times of the column volume, recovering a solvent under reduced pressure and concentrating, adding methanol for crystallization, separating and crystallizing, washing and drying to obtain cyanogenic glycoside (Heterodendrin), wherein the molecular formula is as follows: c11H19NO6Molecular weight: 261.274, CAS registry number: 66465-22-3, mainly exist in Crassulaceae, Gramineae, Leguminosae multiple plants, wherein Crassulaceae plant Rhodiola sachalinensis Rhodiola henryi (Diels) S.H.Fu is rich in content, modern research shows that cyanogenic glycoside has antitumor effect, and it also can be used as raw material for synthesizing other active derivatives.
The sedum sarmentosum glycoside separated from the rhodiola rosea belongs to cyanogen glycoside compounds, is proved to have obvious protective effect on carbon tetrachloride liver injury, can increase the contents of glycogen, glucose-6-phosphatase and lactate dehydrogenase in liver cells, enhances the activity of succinate dehydrogenase and ATP enzyme in the liver cells, and possibly plays a role in protecting the liver through the way, thereby researching and developing the anti-hepatitis B virus medicament.
[ summary of the invention ]
Aiming at the problem that non-cyanogenic glycosides in the prior art are not easy to be subjected to enzymolysis, hydrolysis or no generation of hydrogen cyanide after hydrolysis, the research shows that the application of the cyanogenic glycoside compound Menisdaurin F in the preparation of the anti-hepatitis B virus pharmaceutical composition is as follows: the expression of the X gene under the action of the cyanogenic glycoside compound Menisdaurin F is measured by utilizing a reverse transcription technology and a real-time fluorescent quantitative PCR technology. The results show that the cyanogenic glycoside compound Menisdaurin F can obviously reduce the expression level of HBx mRNA.
In order to achieve the purpose, the invention adopts the following technical scheme:
a cyanogenic glycoside compound Menisdaurin F has a chemical structural formula as follows:
the method for separating, purifying and identifying the cyanogenic glycoside compound Menisdaurin F comprises the following steps:
1) slicing fresh bruguiera gymnorrhiza embryonic axis, extracting with 95% industrial alcohol at a volume concentration of 1:3 for 7 days for 3 times, mixing extractive solutions, concentrating under reduced pressure to obtain crude extract, and directly locating the polarity range of cyanogenic glycosides by Agilent 1290-G6460A LC/MS, wherein the chromatographic column: ACQUITY UPLC BEH AMIDE 1.7 μm 2.1X 100mm, A: ultrapure water, pH7.0, and B is acetonitrile; gradient elution procedure: 0-4min, 40% B; 4-6min, 45% B-85% B; 6-14min, 85% B; 14-16min, 100% B; 18-20min, 100% B; the flow rate is 0.30 mL/min; the column temperature is 35 ℃; the sample injection volume is 2 mu L; the temperature of the autosampler is 4 ℃;
MS/MS conditions:
ionization mode of ion source: electrospray ionization; the scanning mode is as follows: scanning in a positive ion mode; capillary voltage: 3.5 Kv; the atomization gas pressure was 40 psi; the desolventizing air flow rate is 8L/min, and the temperature is 350 ℃; the drying airflow rate is 8L/min, 300 ℃; collision energy: 20 eV; crushing at 80V, and finding out cyanogenic glycoside compounds in 10-12 minutes;
2) sequentially extracting the crude extract with petroleum ether, ethyl acetate and n-butanol to obtain different polarity extraction parts, subjecting the n-butanol extraction part to forward silica gel column chromatography, and purifying with chloroform-methanol (CHCl)3-MeOH) system (CHCl)3The MeOH is eluted by an elution solvent of 10:0,10:1,5:1,20:7,0:10 and V: V), 83 fractions are collected, and the fractions with similar component polarities are combined according to TLC analysis results to obtain 13 crude fractions (Z1-Z13);
3) the component Z10 is separated by gel column chromatography (methanol column, Vaeffectively is 1024 cm)3) Methanol is used as an elution solvent, the flow rate is 5-7s/d, 8-10mL of one fraction is obtained, 256 fractions are obtained in total, and the fractions are combined into 11 components (through a silica gel thin layer plate)a1-a11), component a3 is separated in an isocratic gradient using a semi-preparative liquid phase under MeOH/H conditions2O90: 10(V: V), and the compound (20.00mg, tR 10.78min) was obtained and identified as compound Menisdaurin F by high resolution mass spectrometry and nuclear magnetic spectrometry.
The application of the cyanogenic glycoside compound Menisdaurin F in preparing the anti-hepatitis B virus pharmaceutical composition.
The anti-hepatitis B virus comprises: inhibiting hepatitis B virus replication, and reducing X gene in hepatitis B cell to exert hepatitis B resisting effect.
The invention detects the HBV DNA level in cell supernatant under the action of different drug concentrations of the cyanogenic glycoside compound Menisdaurin F by utilizing a real-time fluorescent quantitative PCR technology, and the experimental result proves the function of the cyanogenic glycoside compound Menisdaurin F in resisting the replication of hepatitis B virus.
The invention utilizes the reverse transcription technology and the real-time fluorescent quantitative PCR technology to measure the expression of the X gene under the action of the cyanogen glycoside compound Menisdaurin F, and the result shows that the cyanogen glycoside compound Menisdaurin F can obviously reduce the expression level of HBx mRNA, which indicates that the cyanogen glycoside compound Menisdaurin F can play the role of hepatitis B resistance by reducing the X gene in hepatitis B cells.
Further, the application of the cyanogenic glycoside compound Menisdauurin F in preparing the anti-hepatitis B virus pharmaceutical composition is characterized in that the pharmaceutical composition is a clinically acceptable pharmaceutical preparation prepared by taking the cyanogenic glycoside compound Menisdauurin F as a main component and adding pharmaceutically acceptable auxiliary materials or auxiliary components, wherein the content of the cyanogenic glycoside compound Menisdauurin F in the pharmaceutical composition is usually 0.1-95.0% (w/w).
Furthermore, the application of the cyanogenic glycoside compound Menisdaurin F in preparing the anti-hepatitis B virus pharmaceutical composition comprises two dosage forms of an oral preparation and an injection preparation.
Further, the application of the cyanogenic glycoside compound Menisdaurin F in preparing the anti-hepatitis B virus pharmaceutical composition is that the oral preparation is an oral capsule, and the injection preparation is intravenous injection.
Generally, the drugs are clinically applied after being prepared into preparations. The pharmaceutical composition of the present invention can be prepared according to a method known in the art as a pharmaceutical composition. The pharmaceutical compositions of the present invention may be formulated into any dosage form suitable for human or animal use by combining them with one or more pharmaceutically acceptable solid or liquid excipients and/or adjuvants. The pharmaceutical composition of the invention or the pharmaceutical composition containing the same can be administered in unit dosage form, and the administration route can be intestinal or parenteral, such as oral administration, intravenous injection, intramuscular injection, subcutaneous injection, nasal cavity, oral mucosa, eye, lung and respiratory tract, skin, vagina, rectum and the like.
The dosage form for administration may be a liquid dosage form, a solid dosage form, or a semi-solid dosage form. The liquid dosage forms can be solution (including true solution and colloidal solution), emulsion (including o/w type, w/o type and multiple emulsion), suspension, injection (including water injection, powder injection and infusion), eye drop, nose drop, lotion, liniment, etc.; the solid dosage form can be tablet (including common tablet, enteric coated tablet, buccal tablet, dispersible tablet, chewable tablet, effervescent tablet, orally disintegrating tablet), capsule (including hard capsule, soft capsule, and enteric coated capsule), granule, powder, pellet, dripping pill, suppository, pellicle, patch, aerosol (powder), spray, etc.; semisolid dosage forms can be ointments, gels, pastes, and the like.
The pharmaceutical composition can be prepared into common preparations, sustained release preparations, controlled release preparations, targeting preparations and various particle delivery systems. For tableting the pharmaceutical composition of the present invention, a wide variety of excipients known in the art may be used, including diluents, binders, wetting agents, disintegrants, lubricants, glidants. The diluent can be starch, dextrin, sucrose, glucose, lactose, mannitol, sorbitol, xylitol, microcrystalline cellulose, calcium sulfate, calcium hydrogen phosphate, calcium carbonate, etc.; the wetting agent can be water, ethanol, isopropanol, etc.; the adhesive can be starch slurry, dextrin, syrup, Mel, glucose solution, microcrystalline cellulose, acacia slurry, gelatin slurry, sodium carboxymethylcellulose, methylcellulose, hydroxypropyl methylcellulose, ethyl cellulose, acrylic resin, carbomer, polyvinylpyrrolidone, polyethylene glycol, etc.; the disintegrant may be dry starch, microcrystalline cellulose, low-substituted hydroxypropyl cellulose, crosslinked polyvinylpyrrolidone, crosslinked sodium carboxymethylcellulose, sodium carboxymethyl starch, sodium bicarbonate and citric acid, polyoxyethylene sorbitol fatty acid ester, sodium dodecyl sulfate, etc.; the lubricant and glidant may be talc, silicon dioxide, stearate, tartaric acid, liquid paraffin, polyethylene glycol, and the like.
The tablets may be further formulated into coated tablets, such as sugar-coated tablets, film-coated tablets, enteric-coated tablets, or double-layer and multi-layer tablets.
In order to encapsulate the administration unit, the pharmaceutical composition of the present invention as an active ingredient may be mixed with a diluent and a glidant, and the mixture may be directly placed in a hard capsule or a soft capsule. Or the active ingredients of the pharmaceutical composition of the invention can be prepared into granules or pellets with diluent, adhesive and disintegrating agent, and then placed into hard capsules or soft capsules. The various diluents, binders, wetting agents, disintegrants, glidants used for preparing the pharmaceutical composition tablets of the invention can also be used for preparing capsules of the pharmaceutical composition of the invention.
In order to prepare the pharmaceutical composition of the invention into injection, water, ethanol, isopropanol, propylene glycol or a mixture thereof can be used as a solvent, and a proper amount of solubilizer, cosolvent, pH regulator and osmotic pressure regulator which are commonly used in the field can be added. The solubilizer or cosolvent can be poloxamer, lecithin, hydroxypropyl-beta-cyclodextrin, etc.; the pH regulator can be phosphate, acetate, hydrochloric acid, sodium hydroxide, etc.; the osmotic pressure regulator can be sodium chloride, mannitol, glucose, phosphate, acetate, etc. For example, mannitol and glucose can be added as proppant for preparing lyophilized powder for injection.
In addition, colorants, preservatives, flavors, or other additives may also be added to the pharmaceutical preparation, if desired.
Compared with the prior art, the invention has the following advantages:
1. compared with the conventional extraction method, the method for separating, purifying and identifying the cyanogenic glycoside compound Menisdaurin F is simpler, firstly uses high-resolution mass spectrometry to position the cyanogenic glycoside compound, then uses high performance liquid chromatography to directionally obtain the cyanogenic glycoside compound, belongs to direct directional extraction to obtain the cyanogenic glycoside compound, and belongs to a new compound, and the report of the literature does not exist.
2. The cyanogenic glycoside compound Menisdaurin F has strong anti-hepatitis B virus replication activity, and the activity of the compound is reported for the first time.
[ description of the drawings ]
FIG. 1 is a diagram showing the chemical structural formula of a cyanogenic glycoside compound Menisdaurin F obtained in example 1 of the present invention.
FIG. 2 is a graph showing the effect of the cyanogenic glycoside compound Menisdaurin F obtained in example 1 of the present invention on HBx gene expression in HepG2.2.15 cells.
[ detailed description ] embodiments
The following examples are provided to further illustrate the embodiments of the present invention.
Example 1:
a method for separating, purifying and identifying a cyanogenic glycoside compound Menisdaurin F comprises the following steps:
1) slicing fresh bruguiera gymnorrhiza embryonic axis, extracting with 95% industrial alcohol at a volume concentration of 1:3 for 7 days for 3 times, mixing extractive solutions, concentrating under reduced pressure to obtain crude extract, and directly locating the polar region of cyanogenic glycoside compounds as high-polar part by high performance liquid chromatography and high resolution mass spectrometry, wherein the chromatographic column comprises: ACQUITY UPLC BEH AMIDE 1.7 μm 2.1X 100mm, A: ultrapure water, pH7.0, and B is acetonitrile; gradient elution procedure: 0-4min, 40% B; 4-6min, 45% B-85% B; 6-14min, 85% B; 14-16min, 100% B; 18-20min, 100% B; the flow rate is 0.30 mL/min; the column temperature is 35 ℃; the sample injection volume is 2 mu L; the temperature of the autosampler is 4 ℃;
MS/MS conditions:
ionization mode of ion source: electrospray ionization; the scanning mode is as follows: scanning in a positive ion mode; capillary voltage: 3.5 Kv; the atomization gas pressure was 40 psi; the desolventizing air flow rate is 8L/min, and the temperature is 350 ℃; the drying airflow rate is 8L/min, 300 ℃; collision energy: 20 eV; crushing at 80V, and finding out cyanogenic glycoside compounds in 10-12 minutes;
2) sequentially extracting the crude extract with petroleum ether, ethyl acetate and n-butanol to obtain different polarity extraction parts, subjecting the n-butanol extraction part to forward silica gel column chromatography, and purifying with chloroform-methanol (CHCl)3-MeOH) system (CHCl)3The MeOH is eluted by an elution solvent of 10:0,10:1,5:1,20:7,0:10 and V: V), 83 fractions are collected, and the fractions with similar component polarities are combined according to TLC analysis results to obtain 13 crude fractions (Z1-Z13);
3) the component Z10 is separated by gel column chromatography (methanol column, Vaeffectively is 1024 cm)3) Methanol is used as an elution solvent, the flow rate is 5-7s/d, 8-10mL of one fraction is obtained, 256 fractions are obtained in total, silica gel thin-layer plates are combined to form 11 components (a1-a11), the component a3 is subjected to equal gradient separation by using a semi-preparative liquid phase, and the liquid phase separation conditions are MeOH H2O90: 10(V: V), the compound was obtained (20.00mg, tR 10.78min), pale yellow crystals,
ESI-MS m/z:314.1[M-H]the formula C14H21NO7；1H NMR(DMSO-d6，700MHz):δ(ppm)5.56(1H,d,J＝1.48Hz,H-2)，4.92(1H d,J＝4.57Hz,2'-OH)，4.93(2H,dd,J＝9.41,4.72Hz,3'-OH,4'-OH)，4.76(1H,d,J＝5.08Hz,5-OH)，4.48(1H,ddd,J＝9.00,4.57,1.37Hz,H-1')，4.34(1H,t,6'-OH)，4.31(1H,d,H-5)，3.72(1H,tq,J＝8.43,4.14Hz,H-6')，
3.65(1H,ddt,J＝11.67,5.86,2.98Hz,H-6')，3.43(1H,dt,J＝11.38,5.49,5.49Hz,H-3')，3.16(1H,td,J＝8.79,3.02Hz,H-8)，3.11(2H,ddt,J＝12.04,6.17,3.05,3.05Hz,H-2',H-5')，3.04(1H,td,J＝9.14,9.10,3.97Hz,H-4')，2.48(1H,ddd,H-4)，
2.11(2H,tdd,J＝10.30,10.30,4.79,2.59Hz,H-7,H-4)，1.78(1H,ddtd,J＝12.31,6.05,4.34,4.30,1.49Hz,H-5)，1.60(1H,dt,J＝12.91,8.64,8.64Hz,H-7)，1.38(1H,m,H-5),13CNMR(176MHz,DMSO-d6)δ116.6(C-1)，96.1(C-2)，172.1(C-3)，39.5(C-4)，70.5(C-5)，30.2(C-6), 27.3(C-7), 75.1(C-8), 110.2(C-1'), 74.2(C-2'), 78.0(C-3'), 71.5(C-4'), 81.5(C-5'), 61.2(C-6'), identified as compound Menisdaurin F by high resolution mass spectrometry and nuclear magnetic spectroscopy.
Example 2:
an application of a cyanogenic glycoside compound Menisdaurin F in preparing a hepatitis B virus resistant pharmaceutical composition:
experimental methods
A cyanogenic glycoside compound Menisdaurin F has a chemical structural formula shown in figure 1 (hereinafter referred to as cyanogenic glycoside compound).
2-cyanogenic glycoside compound inhibiting hepatitis B virus replication
2.1 Main test materials
2.1.1 HepG2.2.15 cells: the AIDS prevention and treatment research of Guangxi medical university is given as a gift by Fomentality professor in laboratory.
2.1.2 Primary reagents
DMEM medium, fetal bovine serum, streptomycin, biological grade dimethyl sulfoxide (DMSO) purchased from Gibco, usa; thiazole blue (MTT) was purchased from Sigma, Geneticin (G418), lamivudine (3TC) was purchased from Mecang Biotech, Inc., Shanghai, and HBV DNA quantitative determination kit was purchased from Santa Clarita Biotech, Inc., Hunan.
2.2 toxicity test of Cyanoglycosides to cells
The toxic effect of the cyanogenic glycoside compound on cells is detected by utilizing an MTT colorimetric method. The method specifically comprises the following steps: when the HepG2.2.15 cell coverage of good growth state is 80-90%, 0.25% pancreatin is added for digestion, the digestion is stopped immediately after the cell falls off, and a fresh culture medium is added to prepare single cell suspension. Counting with cell counting plate, diluting to 5 × 104Inoculating single cell suspension/mL into 96-well culture plate, adding 100 μ L of cell suspension per well, standing at 37 deg.C and 5% CO2Incubate 24h in the incubator, add drug-containing culture solution (2. mu.M, 1. mu.M, 0.5. mu.M, 0.25. mu.M, 0.125. mu.M, 0.0625. mu.M), positive drug (3 TC. mu.g 100/mL) and negative culture solution with different drug concentrations when the cells grow adherently. After 72h incubation, 20. mu.L of 5mg/mL MTT solution was added to each well and incubated at 37 ℃ for 4 h. Terminating the culture, removing the solution from the wells by aspiration, addingAdd 150. mu.L of DMSO solvent crystals. Placing the cell culture plate on an oscillator, oscillating for 10min, selecting 490nm wavelength, measuring the light absorption value (OD value) of each hole on an enzyme-labeling instrument, and calculating the cell survival rate:
cell survival (%) (OD value of experimental group/OD value of negative control well) × 100
2.3 inhibition experiment of Cyanoglycosides to HBV DNA replication
The detection index of HBV DNA is a critical index for judging the infectivity of hepatitis B and examining the antiviral efficacy. HepG2.2.15 cells in good growth state were diluted to a single cell suspension and the cell density was adjusted to 5X 104one/mL, 100 μ L each was inoculated into 96-well plates. The adherent cells were cultured for 24h, and drug-containing media (1. mu.M, 0.5. mu.M, 0.25. mu.M, 0.125. mu.M, 0.0625. mu.M), positive drug (3 TC. mu.g 100/mL) and negative media of different drug concentrations were replaced. The liquid medicine was changed every 3 days, and cell supernatant was collected after 6 days. According to the kit operation instruction, 5 mu L of nucleic acid releasing agent and 5 mu L of cell supernatant are sequentially added for reaction for 10min, then 40 mu L of PCR-mix (reaction solution 38 mu L/person + enzyme mixed solution 2 mu L/person + HBV-internal standard 2 mu L/person) is added, and real-time fluorescence PCR amplification is carried out after centrifugation. After the reaction is finished, analyzing data by using LightCycler480 software to obtain HBV DNA copy number, and calculating HBV DNA inhibition rate:
HBV DNA inhibition (%) as ═ HBV DNA copy number in negative control well-HBV DNA copy number in experimental well)/HBV DNA copy number in negative control well X100%
2.4 test results
The results show that the compound has little toxic and side effect on cells, has no inhibition effect on cell proliferation within the concentration range of 0-2mM and IC50Value of>2 μ M. In the concentration range of 0-0.125mM, the compound has no inhibitory effect on the secretion of HBV DNA by cells, and as the concentration is increased, the concentration of HBV DNA in cell supernatant is decreased, and the EC of the compound is50The value was 0.809mM, TI value>2, the compound is an effective low-toxicity compound.
Inhibition of HepG2.2.15 cell proliferation and secretion of HBV DNA by Compounds of Table 1: (
n＝3)
Inhibition effect of 3-cyanogenic glycoside compound on X gene expression of hepatitis B cell
3.1 Primary reagents
AxyPrep Total RNA miniprep kit was purchased from Corning, USA; ReverTra
The qPCR RT Kit and SYBRGreen real RCPMaster Mix were purchased from Toyobo, Japan, and the PCR primers were synthesized by Kinshire Biotech, Inc. at Shanghai.
3.1 cell Collection
HepG2.2.15 cells were seeded in 24-well plates at a cell density of 5X 104each/mL, at 37 ℃ and 5% CO2Culturing for 24h in the incubator until the cells adhere to the wall. Setting negative control hole, positive control hole and sample hole, replacing corresponding medicated culture solution, culturing, replacing medicated culture solution every 3 days, discarding cell supernatant after 6 days, and collecting cells.
3.2 extraction of Total RNA
(1) After the cells were collected, the medium was discarded as much as possible, 300. mu.l of Buffer R-I was added to each well, and the cell suspension was transferred to a 1.5ml centrifuge tube (provided in the kit) by pipetting 8 to 10 times with a pipette. Add 110. mu.l Buffer R-II and centrifuge at 12000rpm for 5min with vortexing for 15-30s (centrifugation at 4 ℃). Placing the preparation tube in a 2mI centrifuge tube (provided in a reagent box), transferring the mixed solution into the preparation tube, and centrifuging at 6000rpm for 1 min;
(2) discarding the filtrate, placing the preparation tube back into a 2mI centrifuge tube, adding 500 μ l of BufferW1A into the preparation tube, and centrifuging at 12000rpm for 1 min;
(3) the filtrate was discarded, the preparation tube was returned to a 2mI centrifuge tube, and 700. mu.l of BufferW2A was added to the preparation tube, centrifuged at 12000rpm for 1min, and washed once with 700. mu.l of BufferW2A in the same manner. Discarding the filtrate, putting the preparation tube back into a 2ml centrifuge tube, and centrifuging at 12000rpm for 1 min;
(4) the preparation tube was placed into a clean 1.5mL centrifuge tube (provided in the kit) and 70-100. mu.l Buffer TE was added to the center of the membrane of the preparation tube. Standing at room temperature for 1min, centrifuging at 12000rpm for 1min, and eluting to obtain RNA.
3.3 Synthesis of cDNA
3.3.1 reverse transcription reaction System
3.3.2 conditions of reverse transcription
42℃60min，70℃5min
3.4 Real-time PCR analysis
3.4.1 primers
| Primer and method for producing the same | Sequence of |
| β-actin F | CTCCATCCTGGCCTCGCTGT |
| β-actin R | GCTGTCACCTTCACCGTTCC |
| HBx F | TCTCAGCAATGTCAACGAC |
| HBx R | TTTATGCCTACAGCCTCCT |
3.4.2 Real-time PCR reaction system
| Reagent | Volume of |
| 2×Real-time PCR Master Mix | 10μL |
| F/R Primer(10μM) | 1μL each |
| cDNA Template(1:100dilution) | 1μL |
| ddH2O | To 20μL |
3.4.3 Real-time PCR reaction conditions
After the reaction is finished, recording Ct values of each group according to a target gene (n) to a Ct reference gene (n) of the delta Ct (n) ═ Ct; Δ Ct (n) ═ Δ Ct (n) — Δ Ct (1) and the 2- Δ Ct (n) value was calculated.
3.5 test results
As shown in FIG. 2, the expression level of HBx mRNA in the cells of the negative control group was assigned as 1, and both 3TC and the compound significantly inhibited the expression of X gene of hepatitis B cells (P <0.05) as compared to the negative control. Wherein the HBx mRNA expression level under the action of 3TC is 0.83(P <0.05), the HBx mRNA expression level under the action of the compound is 0.72(P <0.01), and the expression level of X gene of hepatitis B cell can be obviously inhibited.
And (4) conclusion:
1. the cyanogenic glycoside compound Menisdauurin F obtained by the invention detects the HBV DNA level in cell supernatant under the action of different medicine concentrations of the cyanogenic glycoside compound Menisdauurin F by utilizing a real-time fluorescent quantitative PCR technology, and experimental results prove that the cyanogenic glycoside compound Menisdauurin F has the function of resisting the replication of hepatitis B virus.
2. The cyanogenic glycoside compound Menisdaurin F obtained by the invention utilizes a reverse transcription technology and a real-time fluorescent quantitative PCR technology to measure the expression of the X gene under the action of the cyanogenic glycoside compound Menisdaurin F, and the result shows that the cyanogenic glycoside compound Menisdaurin F can obviously reduce the expression level of HBx mRNA, which indicates that the cyanogenic glycoside compound Menisdaurin F can play the role of hepatitis B resistance by reducing the X gene in hepatitis B cells.
The above description is intended to describe in detail the preferred embodiments of the present invention, but the embodiments are not intended to limit the scope of the claims of the present invention, and all equivalent changes and modifications made within the technical spirit of the present invention should fall within the scope of the claims of the present invention.
Claims (9)
1. A cyanogenic glycoside compound Menisdaurin F, which is characterized in that: the chemical structural formula is as follows:
2. the method for separating, purifying and identifying a cyanogenic glycoside compound Menisdaurin F according to claim 1, wherein: the method comprises the following steps:
1) slicing fresh bruguiera gymnorrhiza embryonic axis, extracting with 95% industrial alcohol at a volume concentration of 1:3 for 7 days for 3 times, mixing extractive solutions, concentrating under reduced pressure to obtain crude extract, and directly locating the polar region of cyanogenic glycoside compounds as high-polar part by high performance liquid chromatography and high resolution mass spectrometry, wherein the chromatographic column comprises: ACQUITY UPLC BEH AMIDE 1.7 μm 2.1X 100mm, A: ultrapure water, pH7.0, and B is acetonitrile; gradient elution procedure: 0-4min, 40% B; 4-6min, 45% B-85% B; 6-14min, 85% B; 14-16min, 100% B; 18-20min, 100% B; the flow rate is 0.30 mL/min; the column temperature is 35 ℃; the sample injection volume is 2 mu L; the temperature of the autosampler is 4 ℃;
MS/MS conditions:
ionization mode of ion source: electrospray ionization; the scanning mode is as follows: scanning in a positive ion mode; capillary voltage: 3.5 Kv; the atomization gas pressure was 40 psi; the desolventizing air flow rate is 8L/min, and the temperature is 350 ℃; the drying airflow rate is 8L/min, 300 ℃; collision energy: 20 eV; crushing at 80V, and finding out cyanogenic glycoside compounds in 10-12 minutes;
2) sequentially extracting the crude extract with petroleum ether, ethyl acetate and n-butanol to obtain different polar extraction parts, subjecting the n-butanol extraction part to forward silica gel column chromatography, eluting with chloroform-methanol system as eluting solvent, and eluting with CHCl3Collecting 83 parts of MeOH (10: 0), 10:1,5:1,20:7,0:10 and V: V), combining the parts with similar component polarities according to TLC analysis result, and roughly dividing the mixture into 13 components which are respectively components Z1-Z13;
3) the component Z10 is separated by gel column chromatography, methanol is filled in the column, and Viffect is 1024cm3Methanol is used as an elution solvent, the flow rate is 5-7s/d, 8-10mL of one fraction is obtained, 256 fractions are obtained in total, 11 fractions are combined through silica gel thin layer plates and are respectively a component a1-a11, the component a3 is subjected to equal gradient separation by using a semi-prepared liquid phase, and the liquid phase separation condition is MeOH H2O90: 10V: V, 20.00mg of this compound was obtained, tR 10.78min, and identified as compound Menisdaurin F by high resolution mass spectrometry and nuclear magnetic spectroscopy.
3. The use of a cyanogenic glycoside compound Menisdaurin F according to claim 1 in the preparation of a pharmaceutical composition against hepatitis B virus.
4. The use of a cyanogenic glycoside compound Menisdaurin F according to claim 3 in the preparation of anti-HBV pharmaceutical composition, wherein: the anti-hepatitis B virus has an inhibiting effect in the replication process of the hepatitis B virus and plays a role in resisting the hepatitis B by reducing X genes in hepatitis B cells.
5. The use of a cyanogenic glycoside compound Menisdaurin F according to claim 4 in the preparation of anti-HBV pharmaceutical composition, wherein: the inhibition effect in the process of replicating hepatitis B virus is to detect the HBV DNA level in cell supernatant under the action of different drug concentrations of cyanogenic glycoside compounds Menisdaurin F by using a real-time fluorescent quantitative PCR technology.
6. The use of a cyanogenic glycoside compound Menisdaurin F according to claim 4 in the preparation of anti-HBV pharmaceutical composition, wherein: the X gene in the hepatitis B cell is reduced to play a role in resisting hepatitis B, the expression of the X gene under the action of the cyanogenic glycoside compound Menisdaurin F is determined by utilizing a reverse transcription technology and a real-time fluorescent quantitative PCR technology, and the cyanogenic glycoside compound Menisdaurin F is shown to be capable of obviously reducing the expression level of HBx mRNA.
7. The use of a cyanogenic glycoside compound Menisdaurin F according to claim 3 in the preparation of anti-HBV pharmaceutical composition, wherein: the pharmaceutical composition is a clinically acceptable pharmaceutical preparation prepared by taking a cyanogenic glycoside compound Menisdaurin F as a main component and adding pharmaceutically acceptable auxiliary materials or auxiliary components, wherein the content of the cyanogenic glycoside compound Menisdaurin F in the pharmaceutical composition is 0.1-95.0% w/w.
8. The use of a cyanogenic glycoside compound Menisdaurin F according to claim 7 in the preparation of anti-HBV pharmaceutical composition, wherein: the pharmaceutical preparation comprises two dosage forms of an oral preparation and an injection preparation.
9. The use of a cyanogenic glycoside compound Menisdaurin F according to claim 8 in the preparation of anti-HBV pharmaceutical composition, wherein: the oral preparation is an oral capsule, and the injection preparation is intravenous injection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111055432.9A CN113735920B (en) | 2021-09-09 | 2021-09-09 | Application of cyanogenic glycoside compound Menisdaurin F in preparation of anti-hepatitis B virus pharmaceutical composition |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111055432.9A CN113735920B (en) | 2021-09-09 | 2021-09-09 | Application of cyanogenic glycoside compound Menisdaurin F in preparation of anti-hepatitis B virus pharmaceutical composition |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113735920A true CN113735920A (en) | 2021-12-03 |
| CN113735920B CN113735920B (en) | 2023-03-21 |
Family
ID=78737741
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111055432.9A Active CN113735920B (en) | 2021-09-09 | 2021-09-09 | Application of cyanogenic glycoside compound Menisdaurin F in preparation of anti-hepatitis B virus pharmaceutical composition |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113735920B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE10120627A1 (en) * | 2001-04-26 | 2002-10-31 | Cmi Ag | Use of phyllanthus components for the treatment or prophylaxis of infections caused by hepatitis B viruses |
| CN1422156A (en) * | 2000-02-14 | 2003-06-04 | 法马西亚公司 | Use of N-substituted-1,5-dideoxy-1,5-imino-D-glucitol compounds for treating hepatitis virus infections |
| CN104374890A (en) * | 2011-06-16 | 2015-02-25 | 东莞市岭奥生物科技有限公司 | Ilex kudingcha C. J. Tseng extract |
| CN109512829A (en) * | 2017-09-19 | 2019-03-26 | 复旦大学 | Luteolin 7-O- glucoside is preparing the application in anti-hepatic-B virus medicine |
-
2021
- 2021-09-09 CN CN202111055432.9A patent/CN113735920B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1422156A (en) * | 2000-02-14 | 2003-06-04 | 法马西亚公司 | Use of N-substituted-1,5-dideoxy-1,5-imino-D-glucitol compounds for treating hepatitis virus infections |
| DE10120627A1 (en) * | 2001-04-26 | 2002-10-31 | Cmi Ag | Use of phyllanthus components for the treatment or prophylaxis of infections caused by hepatitis B viruses |
| CN104374890A (en) * | 2011-06-16 | 2015-02-25 | 东莞市岭奥生物科技有限公司 | Ilex kudingcha C. J. Tseng extract |
| CN109512829A (en) * | 2017-09-19 | 2019-03-26 | 复旦大学 | Luteolin 7-O- glucoside is preparing the application in anti-hepatic-B virus medicine |
Non-Patent Citations (3)
| Title |
|---|
| MOHAMMAD K. PARVEZ，ET AL.: ""Plant-derived antiviral drugs as novel hepatitis B virus inhibitors: Cell culture and molecular docking study"", 《SAUDI PHARMACEUTICAL JOURNAL》 * |
| XIANG-XI YI，ET AL.: ""Four New Cyclohexylideneacetonitrile Derivatives from the Hypocotyl of Mangrove (Bruguiera gymnorrhiza)"", 《MOLECULES》 * |
| 陈志勇 等: ""木榄胚轴中一个新生物碱及其抗乙肝病毒活性研究"", 《广西植物》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113735920B (en) | 2023-03-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102219725B (en) | Benzohetercyclic compound as well as preparation method and applications thereof | |
| CN113491703A (en) | Application of phenylethanoid glycosides compounds and compositions thereof in preparation of drugs for preventing and treating new coronary pneumonia | |
| WO2006069512A1 (en) | Methods for preparing dehydrocavidine, dehydroapocavidine or their composition, their use and medicinal composition containing them | |
| EP4036078A1 (en) | Crystalline form of capsid protein assembly inhibitor containing n hetero five-membered ring, and application thereof | |
| WO2023138049A1 (en) | Biflavone compound against i-type herpes simplex virus, and preparation method therefor and use thereof | |
| CN105646611B (en) | Two caffeoyl spermidine derivatives glucosides of one kind and application thereof | |
| CN108752208B (en) | Extraction method of caffeoylquinic acid compounds, and product and application thereof | |
| CN113735920B (en) | Application of cyanogenic glycoside compound Menisdaurin F in preparation of anti-hepatitis B virus pharmaceutical composition | |
| CN106831840A (en) | One class has micromolecular compound, preparation method and its medicinal usage of anti-inflammatory activity | |
| CN103908447B (en) | The application of shrubby sophora extract and Vexibinol in anti-EV71 virus infection | |
| CN109867649B (en) | Biflavonoid compound and preparation method and application thereof | |
| CN113563296B (en) | Anti-neocoronarism application and preparation method of phloroglucinol heteroterpenoid | |
| CN110063960B (en) | Pharmaceutical application of 3-hydrogenated pinolenic acid B cyanomethyl ester | |
| CN115466248A (en) | Diterpenoid compound and extraction method and application thereof | |
| CN113278044A (en) | Toad skin sterene total lactone extract, sterene lactone monomer compound and application thereof in resisting influenza virus | |
| CN102532156A (en) | Swerilactones H-K, 1-4 and medicinal composition and application thereof | |
| CN102603522B (en) | Phenol derivatives and application thereof in preparation of anti-HBV (hepatitis B virus) medicines | |
| EP3909951A1 (en) | Dihydroisoquinoline compound | |
| CN108785317B (en) | Use of cortex Periplocae Radicis C21 steroid compound in preparation of IDO inhibitor | |
| CN111297847A (en) | Application of amomum kravanh extract in preparation of α -glucosidase inhibitor medicine | |
| CN115429790B (en) | Application of isoflavone compound in preparing medicament for preventing or treating alcoholic liver injury or dispelling alcohol effect and protecting liver | |
| CN105663110A (en) | Application of lignan compound 4-keto pinoresinol in preparing anti-hepatitis B virus medicine | |
| CN113603711B (en) | Bisindole alkaloid compound and preparation method and application thereof | |
| CN115703788B (en) | Cinnamyl streptomycin and application thereof | |
| CN113773354B (en) | Lepidium-amaranthum butanedioic acid compound, and extraction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |