CN113730584B

CN113730584B - Application of disulfiram combined copper supplement in preparation of anti-RNA virus medicines

Info

Publication number: CN113730584B
Application number: CN202111020170.2A
Authority: CN
Inventors: 林柏霖; 徐路燕
Original assignee: ShanghaiTech University
Current assignee: ShanghaiTech University
Priority date: 2021-09-01
Filing date: 2021-09-01
Publication date: 2022-11-01
Anticipated expiration: 2041-09-01
Also published as: CN113730584A

Abstract

The invention discloses application of a disulfiram combined copper supplement in preparation of a medicament for resisting RNA viruses. The present inventors have unexpectedly discovered that when two agents, disulfiram and copper supplement, are used simultaneously against RNA virus, the EC on SARS-CoV-2 is measured at the cellular level₅₀Up to 0.154. Mu.M, in vivo metabolites of both or derivatives thereof, e.g. Cu (DDC-OH)₂EC against SARS-CoV-2 at the cellular level₅₀Can reach 1.035 μ M.

Description

Application of disulfiram combined copper supplement in preparation of anti-RNA virus medicines

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to an application of a disulfiram combined copper supplement in preparation of an anti-RNA virus medicament.

Background

With global climate and environmental changes, humans are at almost every second time threatened by infectious diseases caused by viruses. RNA viruses are viruses whose genetic material is RNA, and RNA polymerase (RdRP) is responsible for replication and transcription of viral genomes. RNA viruses are many, most of which are highly virulent, and besides the new coronavirus SARS-CoV-2 which is currently rolling on the world, other widely known RNA viruses include SARS coronavirus SARS-CoV, middle east respiratory syndrome coronavirus MERS-CoV, human Immunodeficiency Virus (HIV), rabies virus, influenza A virus (InflunzaA virus), measles virus (Rubeola), hepatitis C virus, dengue virus, and the like. No specific medicine has been found for SARS-CoV-2 virus. Therefore, the development of drugs that can inhibit RdDP activity is an important strategy to address RNA viruses.

The only anti-RNA virus drugs currently approved on the market for RdRP are reiscivir (Remdesivir). Reidesciclovir is a nucleoside compound that participates in the synthesis of RNA strands by its in vivo metabolites having a structure similar to nucleoside triphosphates, thereby preventing viral replication. Ruidexie Wei Xian is used for treating Ebola hemorrhagic fever, and is approved by FDA for treating COVID-19 in urgent need of 5/1/2020 due to shortage of primary treatment means of new crown epidemic situation. However, the results of a global large clinical trial of "solidary" by the world health organization WHO, on 20/3/2020, showed that ridciclovir might shorten the recovery time for new crown patients, but showed no effect on reducing mortality (Pan H, peto R, karim Q a, et al. Reprocessed anti viral drugs for covi-19-inter WHO solidary trial [ J ]. MedRxiv,2020. Https:// 3238 zx3238/content/10.1101/2020.10.15.09202817 v1.Full. Pdf.). Therefore, there is an urgent need to develop drugs that can more effectively inhibit new coronavirus against RdRP.

The zinc finger domain recognizes a specific site of DNA or RNA and is an important building block for viral RNA synthesis. A number of important proteins of RNA viruses contain zinc finger domains. For example, rdRP and PL of new coronavirus^proAnd/nsp 3, nsp10, helicase/nsp13, and 3'-to-5' exonuclease/nsp 14. Although it is possible to bring about the effect of inhibiting RNA virus in principle by changing the structure of the zinc finger domain, no anti-RNA virus drug of a corresponding mechanism has been discovered so far. This may be related to the tight conservation of the zinc-sulfur site inherent to the zinc finger domain by the reductive barrier based on high concentrations of Glutathione (GSH) within the cell (Xu L, xu J, zhu J, et al. Universal anti Cu (DTC) 2 proteins between sulfur and zinc (II) salts oxidation [ J]Angew. Chem. Int. Ed.,2019,58 (18): 6070-3.). GSH is the major redox buffer in cells (Aoyama K, nakaki T. Glutathione in cellular redox mediators: association with the exitatary amino acid carrier 1 (EAAC 1) [ J]Molecules,2015,20 (5): 8742-8758.) except that the proton is replaced with a zinc ion as compared to the thiol bond of the cysteine residue at the zinc finger site. Therefore, drugs that chemically react with zinc-sulfur sites also typically react with GSH, and the high intracellular concentration of GSH results in a significant reduction in the efficacy of the drug.

The weakening phenomenon of the intracellular reductive protection mechanism on the activity of the medicine is also observed in the research of medicines taking protein cysteine sulfydryl as a target point. Yang Haitao et al resolved the crystal complex structure of SARS-CoV-2 major protease Mpro for the first time and screened for the old drug disulfiram by enzyme activity assay, which had an IC50 for SARS-CoV-2Mpro of 9.35. Mu.M (Jin Z, du X, xu Y, et al. Disulfiram is an anti-alcohol drug which is used for nearly 70 years, and is reliable in safety, cheap and easy to obtain. However, in another study on the inhibition of the activity of SARS-CoV-2Mpro enzyme, some molecules including Disulfiram completely lost the inhibitory activity of the enzyme by adding a reducing agent such as glutathione GSH, DTT, etc. to the system (Ma C, hu Y, townsend J A, et al Ebselen, disulfiam, carmofur, PX-12, tideglusib, and Shikonin Are Nonspecific Promiscouus SARS-CoV-2Main Protease inhibitors [ Hibitors ] J.ACS. Pharmacol.Transl. Sci, 2020,3 (6): 1265-1277.). While at the cellular level, disulfiram has been reported to have an EC50 of only 17.45. Mu.M for SARS-CoV-2 (Sargsian K, lin C, chen T, et al. Multi-targeting of functional cyclines in multiple connected SARS-CoV-2domains by clinical safe Zn-subjects [ J ]. Chemical Science,2020,11 (36): 9904-9909.).

Therefore, there is a need in the art for other drugs that are effective against RNA viruses.

Disclosure of Invention

The invention aims to overcome the defect that the prior art is lack of a medicine capable of effectively treating RNA viruses, and provides an application of disulfiram and/or a structural derivative DSF-OH thereof in combination with a copper supplement in preparation of an anti-RNA virus medicine, in particular an application in preparation of a medicine for treating diseases caused by RNA viruses.

The invention mainly solves the technical problems through the following technical scheme:

the invention provides an application of disulfiram (DSF, CAS number: 97-77-8) and/or a structural derivative DSF-OH thereof in preparing a medicament for preventing and treating diseases related to RNA viruses in combination with copper supplement.

The structural formula of the structural derivative DSF-OH is as follows:

the RNA virus of the present invention may be a RNA virus conventional in the art, the genetic material of which is ribonucleic acid (RNA), preferably a coronavirus. Among them, coronaviruses are well known in the art and belong to the phylogenetic group of the order of the nested viruses (Nidovirales) Coronaviridae (Coronaviridae) Coronaviridae (Orthophthonaviridae). Coronaviruses are RNA viruses having envelope (envelope) and single-stranded positive strand genomes, and are a large group of viruses widely existing in nature.

The invention provides in particular potential treatment regimens for diseases caused by coronavirus infection. The coronavirus of the present invention preferably belongs to the subfamily orthocoronaviruses (orthocoronaviridae), more preferably to the genus Alpha coronavirus, the genus Beta coronavirus, the genus Gamma coronavirus or the genus Delta coronavirus.

In a preferred embodiment of the invention, the disulfiram and/or its structural derivative DSF-OH combined copper supplement can be used for treating severe infectious diseases caused by other coronaviruses SARS-CoV (Beta coronavirus genus) and MERS-CoV, in addition to diseases caused by SARS-CoV-2 (Beta coronavirus genus), and can also be used as common cold drugs for treating diseases caused by coronaviruses such as HCoV-HKU1 (Human coronavirus HKU1; beta coronavirus genus), HCoV-NL63 (Human coronavirus NL63; alpha coronavirus genus), HCoV-OC43 (Human coronavirus OC 43) and HCoV-229E (Human coronavirus 22E; can also be used as veterinary drug for treating animal diseases such as Transmissible gastroenteritis virus (TGEV; genus Alpha coronavirus), porcine epidemic diarrhea virus (PEDV; genus Alpha coronavirus), porcine Delta coronaviruses (PDCoV; genus Delta coronavirus), feline Infectious peritonitis virus (FIPV; genus Alpha coronavirus), avian Infectious bronchitis virus (IBV; genus Gamma coronavirus), etc.

Thus, the coronavirus of the invention is preferably selected from SARS-CoV-2, SARS-CoV, MERS-CoV, HCoV-HKU1, HCoV-NL63, HCoV-OC43, HCoV-229E, TGEV, PEDV, PDCoV, FIPV or IBV.

In a certain aspect, the disulfiram of the invention and/or its structural derivative DSF-OH in combination with a copper supplement is present in the form of a pharmaceutical composition comprising the same; preferably, the pharmaceutical composition takes disulfiram and/or a structural derivative DSF-OH thereof in combination with a copper supplement as a main active ingredient of the pharmaceutical composition. Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier, such as a pharmaceutically acceptable pharmaceutical excipient.

In a certain aspect, the disulfiram and/or its structural derivative DSF-OH in combination with a copper supplement of the invention is present in the form of a kit comprising the same, said kit further comprising a medicament for the treatment of a disease associated with coronaviruses and/or a medicament for the treatment of a disease caused by other viruses.

The dosage, the use proportion, the use time sequence, the period and the like of the disulfiram and/or the structural derivative DSF-OH thereof and the copper supplement are specifically adjusted according to the specific patient condition, the copper is supplemented to the patient lacking the copper, then the disulfiram is taken, and the disulfiram and the copper supplement simultaneously play the best effect at the virus infection part.

With respect to the relative amounts of disulfiram and/or its structural derivative DSF-OH and copper extender, in a specific embodiment of the invention the relative amounts are 500.

The pharmaceutical forms of disulfiram and/or its structural derivative DSF-OH and copper supplement described in the present invention include but are not limited to various pharmaceutical dosage forms such as tablets, capsules, preparations, etc.

The invention also provides application of the disulfiram and/or the product of the DSF-OH and the copper supplement or the derivative thereof in preparing a medicament for preventing and treating diseases related to RNA viruses.

The products described in the present invention may be conventional in the art, for example, the products formed by the chemical reaction of disulfiram and/or its structural derivative DSF-OH under specific conditions, also referred to the disulfiram with the copper supplementThe in vivo metabolite is synthesized, for example, copper dimethyldithiocarbamate (Cu (DDC)₂). Derivatives of said products are, for example, cu (DDC-OH)₂。

In the present invention, the derivative of the product of disulfiram and/or its structural derivative DSF-OH with a copper supplement may refer to a pharmaceutically acceptable salt thereof, a solvate of a pharmaceutically acceptable salt thereof, a nanoparticle, or a crystalline form thereof.

In the invention, the medicine can be prepared and administrated by means of adding auxiliary materials, introducing carriers, applying nanotechnology and the like.

The administration modes of the disulfiram and/or the structural derivative DSF-OH thereof and the copper supplement, or the two products or the derivative thereof in the invention include but are not limited to oral administration, intravenous injection, local injection and other various administration modes.

In the present invention, the copper supplement may be conventional in the art, such as copper gluconate, copper acetate or copper citrate. For illustrative purposes in the present invention, the copper supplement used is copper gluconate.

Preferably, the disease is a mammalian or avian disease.

The pharmaceutical combinations and treatment regimens provided by the invention include, in addition to human, other veterinary treatments for animals, such as pigs, cats, dogs, etc.

The dosage form of the medicine is oral dosage form or injection dosage form.

The pharmaceutical compositions of the present invention containing various compounds of the present invention as active ingredients can be prepared according to methods known in the art. The compounds of the invention may be formulated into any dosage form suitable for human or animal use. The compounds of the present invention are generally present in the pharmaceutical compositions in an amount of 0.1 to 99.0% by weight.

The pharmaceutically acceptable carrier can be a carrier conventional in the art, and the carrier can be any suitable physiologically or pharmaceutically acceptable pharmaceutical adjuvant. The pharmaceutical excipients are conventional pharmaceutical excipients in the field, and preferably comprise pharmaceutically acceptable excipients, fillers or diluents and the like. More preferably, the pharmaceutical composition comprises 0.01-99.99% of the protein and/or the antibody drug conjugate, and 0.01-99.99% of a pharmaceutical carrier, wherein the percentage is the mass percentage of the pharmaceutical composition.

The compounds of the present invention, medicaments or pharmaceutical compositions containing them can be administered in unit dosage form, either enterally or parenterally, for example orally, topically, intravenously, intramuscularly, subcutaneously, nasally, oromucosally, ocularly, pulmonary and respiratory, dermally, vaginally, rectally, etc., preferably by oral or topical administration.

The dosage form for administration may be a liquid dosage form, a solid dosage form, or a semi-solid dosage form. The liquid dosage forms can be solution (including true solution and colloidal solution), emulsion (including o/w type, w/o type and multiple emulsion), suspension, injection (including water injection, powder injection and infusion), eye drop, nose drop, lotion, liniment, etc.; the solid dosage form can be tablet (including common tablet, enteric coated tablet, buccal tablet, dispersible tablet, chewable tablet, effervescent tablet, orally disintegrating tablet), capsule (including hard capsule, soft capsule, and enteric coated capsule), granule, powder, pellet, dripping pill, suppository, pellicle, patch, aerosol (powder), spray, etc.; semisolid dosage forms can be ointments, gels, pastes, and the like.

The medicine or the medicine composition can be prepared into common preparations, sustained release preparations, controlled release preparations, targeting preparations and various particle delivery systems.

"pharmaceutically acceptable carrier" refers to inactive ingredients in a pharmaceutical composition that do not cause significant irritation to an organism and do not interfere with the biological activity and properties of the administered compound, such as, but not limited to: calcium carbonate, calcium phosphate, various sugars (e.g., lactose, mannitol, etc.), starch, cyclodextrin, stearin, cellulose, carbonate, acrylic or methacrylic polymers, gelatin, water, polyethylene glycol, propylene glycol, ethylene glycol, EZ sesame oil or hydrogenated EZ or polyethoxylated hydrogenated EZ sesame oil, corn oil, peanut oil, and the like.

The aforementioned drugs may include, in addition to pharmaceutically acceptable carriers, adjuvants commonly used in pharmacology, such as: antibacterial agents, antifungal agents, antimicrobial agents, shelf-stable agents, hueing agents, solubilizing agents, thickening agents, surfactants, complexing agents, proteins, amino acids, fats, sugars, vitamins, minerals, trace elements, sweeteners, pigments, flavors or combinations thereof, and the like.

The term "control" is conventionally understood in the art, i.e.: preventing and treating diseases.

The term "treatment" refers to therapeutic therapy. Where specific conditions are involved, treatment refers to: alleviating one or more biological manifestations of a disease or disorder, (2) interfering with (a) one or more points in a biological cascade leading to or causing the disorder or (b) one or more biological manifestations of the disorder, (3) ameliorating one or more symptoms, effects, or side effects associated with the disorder, or one or more symptoms, effects, or side effects associated with the disorder or treatment thereof, or (4) slowing the progression of one or more biological manifestations of the disorder or disorder.

The term "solvate" refers to a substance formed by combining a compound of the present invention with a stoichiometric or non-stoichiometric amount of a solvent. The solvent molecules in the solvate may be present in an ordered or unordered arrangement. Such solvents include, but are not limited to: water, methanol, ethanol, and the like.

The terms "pharmaceutically acceptable salt" and "solvate" of the "solvate of a pharmaceutically acceptable salt" as used herein refer to a substance formed by combining a compound of the present invention with a stoichiometric or non-stoichiometric amount of a relatively non-toxic, pharmaceutically acceptable acid or base, prepared therefrom. The "solvate of a pharmaceutically acceptable salt" includes, but is not limited to, the hydrochloride monohydrate of the compound of the present invention.

The terms "compound," "pharmaceutically acceptable salt," "solvate," and "solvate of a pharmaceutically acceptable salt" may exist in crystalline or amorphous form. The term "crystal form" refers to a form in which ions or molecules are arranged strictly periodically in a three-dimensional space in a defined manner and have a periodic recurring pattern at certain intervals; due to the above described periodic arrangement, various crystal forms, i.e. polymorphism, may exist. The term "amorphous" refers to a state in which ions or molecules are distributed in a disordered manner, i.e., the ions or molecules do not have a periodic arrangement.

In the present invention, the term "comprising, including or containing" may mean that other components exist in addition to the components listed below; it may also mean "consisting of … …", i.e. comprising only the ingredients listed later without the other ingredients being present.

The positive progress effects of the invention are as follows:

the inventors have surprisingly found that when two medicaments, disulfiram (or its structural derivative DSF-OH) and copper supplement, are used simultaneously against RNA viruses, the EC against SARS-CoV-2 is at the cellular level₅₀Up to 0.154. Mu.M, in vivo metabolites of both or derivatives thereof, e.g. Cu (DDC-OH)₂EC against SARS-CoV-2 at the cellular level₅₀Can reach 1.035 μ M.

Drawings

FIG. 1 shows disulfiram, cu (DDC)₂、Cu(DDC-OH)₂And DSF-OH molecular structure.

FIG. 2 shows the inhibition concentration curve of a compound against SARS-CoV-2 at the cellular level and EC₅₀The value is obtained.

FIG. 3 shows Cu (DDC) after mixing disulfiram with copper gluconate₂The UV-Vis characteristic absorption peak at 433nm rises continuously.

FIG. 4 shows the kinetic study of UV-Vis on the mixing of disulfiram with copper gluconate to form Cu (DDC)₂。

FIG. 5 shows the average nanosize change log of DLS after mixing disulfiram with copper gluconate, resulting in Cu (DDC)₂The nanoparticles precipitate out and have a tendency to aggregate and settle.

Detailed Description

The invention is further illustrated by the following examples, which are not intended to limit the scope of the invention.

EXAMPLE 1 drug cell level test for efficacy against SARS-CoV-2 Virus

SARS-CoV-2 is derived from clinical virus isolate (SARS-CoV-2/SH 01/human/2020/CHN, genBank MT 121215). The virus was purified by phagocytosis, then replicated in Vero-E6 cells and stored at-80 ℃ for use. The active compounds were diluted in a gradient and mixed with an equal volume of SARS-CoV-2 (100 TCID 50) virus (virus diluted in serum-free DMEM medium) and incubated at 37 ℃ for 1h. The 96-well plate (vero-E6 cells at 1X 10)⁴/well) and 100. Mu.L of a mixture of active compound and virus are added, and the cells are incubated at 37 ℃ for 1h. At the end of the incubation, 100. Mu.L of DMEM +2 FBS medium was added to each well plate. After the cells were subsequently cultured in the cell incubator for 48h, the detection was performed by collecting the cell supernatant. SARS-CoV-2 virus RNA was extracted from the cell supernatant using TRIzol LS reagent (Invitrogen) according to the manufacturer's instructions. PrimeScript^TMRT Kit (Takara, japan, cat. # RR 047A) Kit and TB

Premix DimerEraser^TM(Takara, japan, cat. # RR 091A) was used to test real-time quantitative PCR (RT-PCR). The reaction program of RT-PCR was set as: 15min at 37 ℃; 5s at 85 ℃;4 ℃, 5min; the TB-Greenq PCR reaction program was set as: pre-denaturation at 95 ℃ for 30s; PCR reaction procedure: (95 ℃,5s,55 ℃,30s,72 ℃,30 s). Times.40 cycles. Data were collected using a BIO-RAD fluorescent quantitative PCR instrument.

The primers for PCR were: GGGGAACTTCTCCTGCTAGAAT; SARSCoV-2-N-R CAGACATTTTGCTCTC AAGCTG. All experiments were performed in triplicate.

Table 1 shows the virus inhibitory effect of each cell type on SARS-CoV-2 at 10. Mu. Mol. Wherein, under the condition of single concentration of 10 mu mol, the inhibiting effect of the independent disulfiram or copper gluconate is poor, and the highest inhibiting effect is only about 70 percent; the inhibiting effect of the combination of disulfiram and copper gluconate under 10 mu M reaches more than 99 percent, and the activity of resisting new coronavirus is obviously improved. The two drug combinations measured the EC on SARS-CoV-2 at the cellular level₅₀It was 0.154. Mu.M (FIG. 2).

Table 2 shows the half inhibitory concentration EC of the cell level against SARS-CoV-2 for each class₅₀。

TABLE 1

TABLE 2

Example 2 reaction kinetics study of disulfiram with copper supplement

According to the experimental conditions of the cell level, DMSO stock solutions of disulfiram and copper gluconate are prepared in a chemical laboratory, diluted to 10 mu mol in PBS buffer solution and mixed, the reaction system change is observed by using an ultraviolet visible spectrophotometer UV-Vis and dynamic light scattering DLS, and the experimental result shows that Cu (DDC) is observed by the UV-Vis₂The characteristic absorption peak at 433nm continued to rise, indicating Cu (DDC)₂Constantly generated (FIG. 3), while DLS observed Cu (DDC) generated₂The process of generating the nano particles is accompanied with precipitation in the generation process.

The disulfiram and the copper supplement slowly generate Cu (DDC) in the reaction system₂(FIG. 4), and Cu (DDC)₂The antiviral effect can be achieved by oxidizing the zinc-sulfur sites by circumventing the intracellular reductive protection mechanism. The present inventors have found that Cu (DDC)₂Inhibitory Effect (EC) on New coronavirus at cellular level₅₀=2.048 μ M) (fig. 2) is significantly better than disulfiram and copper gluconate, each used alone.

The invention also finds that Cu (DDC)₂Has strong hydrophobicity, and Cu (DDC) is carried out along with the reaction₂After growth slowly precipitated and formed particles ranging in size from 0 to 2000 nm (fig. 5).

Derivatives of disulfiram with copper supplements in vivo metabolites (active ingredients) may also overcome intracellular reductive protection mechanisms to achieve anti-RNA viral effects. For example Cu (DDC)₂Derivative of (3) Cu (DDC-OH)₂(FIG. 1), EC against SARS-CoV-2 at the cellular level₅₀1.035. Mu.M (FIG. 2).

Example 3 oral disulfiram and copper gluconate combination treatment of RNA virus related diseases

The patient is given 3mg of copper supplement and 500mg of disulfiram tablet per day, and the patient takes the copper supplement first and then the disulfiram or half an hour at intervals in that order. Alcohol consumption is prohibited during administration of disulfiram. It should be noted that the dosages of the drugs used herein are within safe limits and that the particular implementation of the regimen will require the guidance of the clinician.

The above examples are the embodiments of the present invention with better safety, and the skilled person can further study the present invention, but it should be understood that the invention is not limited by the content of the claims.

While specific embodiments of the invention have been described above, it will be understood by those skilled in the art that this is by way of example only, and that the scope of the invention is defined by the appended claims. Various changes and modifications to these embodiments may be made by those skilled in the art without departing from the spirit and scope of the invention, and these changes and modifications are within the scope of the invention.

Claims

1. The application of Disulfiram (DSF) and copper gluconate in preparing medicine for treating SARS-CoV-2 is disclosed.

2. Use of disulfiram and/or its structural derivative DSF-OH and copper supplement product or its derivative in the manufacture of a medicament for the treatment of SARS-CoV-2, wherein the product is Cu (DDC)₂The derivative is Cu (DDC-OH)₂。

3. The use of claim 1 or 2, wherein the medicament further comprises a pharmaceutically acceptable carrier, excipient and/or solvent.