CN113717959B - Phytase mutants - Google Patents

Phytase mutants Download PDF

Info

Publication number
CN113717959B
CN113717959B CN202110496409.7A CN202110496409A CN113717959B CN 113717959 B CN113717959 B CN 113717959B CN 202110496409 A CN202110496409 A CN 202110496409A CN 113717959 B CN113717959 B CN 113717959B
Authority
CN
China
Prior art keywords
leu
ala
thr
pro
gln
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110496409.7A
Other languages
Chinese (zh)
Other versions
CN113717959A (en
Inventor
李馨培
吴秀秀
黄亦钧
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qingdao Vland Biotech Group Co Ltd
Original Assignee
Qingdao Vland Biotech Group Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qingdao Vland Biotech Group Co Ltd filed Critical Qingdao Vland Biotech Group Co Ltd
Priority to PCT/CN2021/093532 priority Critical patent/WO2021233193A1/en
Publication of CN113717959A publication Critical patent/CN113717959A/en
Application granted granted Critical
Publication of CN113717959B publication Critical patent/CN113717959B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/02Thioester hydrolases (3.1.2)
    • C12Y301/02006Hydroxyacylglutathione hydrolase (3.1.2.6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/03Phosphoric monoester hydrolases (3.1.3)
    • C12Y301/030083-Phytase (3.1.3.8)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention relates to the field of biotechnology, in particular to a phytase mutant, a preparation method and application thereof, and a DNA molecule, a vector and a host cell for encoding the phytase mutant. The mutant provided by the invention comprises amino acid substitution at least one position selected from the group consisting of: 36 111, 202. The heat resistance of the mutant is obviously improved, so that the mutant is beneficial to the wide application of phytase in feed.

Description

Phytase mutants
Technical Field
The invention relates to the field of biotechnology, in particular to a phytase mutant, a preparation method and application thereof, and a DNA molecule, a vector and a host cell for encoding the phytase mutant.
Background
Phytase is a phosphatase capable of hydrolyzing phytic acid. It can degrade phytic acid phosphorus (inositol hexaphosphate) into inositol and inorganic phosphoric acid. The enzymes are divided into two classes, 3-phytase (EC.3.1.3.8) and 6-phytase (EC. 3.1.2.6). Phytases are widely found in plants, animals and microorganisms, such as higher plants like maize, wheat, etc., prokaryotic microorganisms like Bacillus subtilis, pseudomonas, lactobacillus, E.coli, etc., and eukaryotic microorganisms like yeast, rhizopus, aspergillus, etc.
In crop seeds such as grains, beans, oil and the like, the basic storage form of phosphorus is phytate phosphorus, the content of which is up to 1% -3%, and the phosphorus accounts for 60% -80% of the total phosphorus in plants. However, phosphorus in the form of phytic acid is difficult to be utilized due to the lack of enzymes capable of decomposing phytic acid in monogastric animals, and the utilization rate is only 0% -40%, so that a plurality of problems are caused: firstly, the waste of phosphorus source is caused, on one hand, the phosphorus source in the feed can not be effectively utilized, and on the other hand, in order to meet the requirement of animals on phosphorus, inorganic phosphorus is added into the feed, so that the feed cost is increased; secondly, high-phosphorus feces are formed to pollute the environment. About 85% of the phytate phosphorus in the feed can be directly discharged out of the body by animals, and a large amount of phytate phosphorus in the feces causes serious pollution to water and soil. In addition, phytate phosphorus is also an anti-nutritional factorSon, which is associated with a variety of metal ions such as Zn during digestion and absorption in the gastrointestinal tract of animals 2 + 、Ca 2+ 、Cu 2+ 、Fe 2+ Etc. and protein sequestration into corresponding insoluble complexes, reducing the effective use of these nutrients by animals.
The phytase can be used as a feed additive for monogastric animals, and the feeding effect of the phytase is confirmed worldwide. It can raise the utilization rate of phosphorus in plant feed by 60%, reduce the excretion of phosphorus by 40% and reduce the anti-nutrient effect of phytic acid. Therefore, the phytase is added into the feed, which has important significance for improving the production benefit of livestock and poultry industry and reducing the pollution of the phytate phosphorus to the environment.
The phytase produced industrially is mainly two kinds of fungal phytase from Aspergillus niger and bacterial phytase from colibacillus. Wherein, the phytase APPA from the escherichia coli has the characteristics of high specific activity, good digestive tract stability and the like. At present, the method is mainly applied to the feed industry by directly adding powder feed or spraying after pellet feed.
Because there is a short high temperature phase of 80-90 ℃ in the pellet feed production process. The bacterial phytase APPA has poor thermal stability, the residual enzyme activity of the aqueous solution is lower than 30% after the aqueous solution is kept at 70 ℃ for 5 minutes, and the residual enzyme activity is generally lower than 20% after the aqueous solution is directly added into animal feed for pelletization, so that the application of the APPA phytase in pellet feed is limited. The method of spraying phytase liquid onto feed after granulating the feed not only increases equipment investment, but also can not well ensure the stability of enzyme preparation and the uniformity of distribution in the feed. Therefore, the improvement of the heat stability has important practical significance for the current phytase for feed.
Disclosure of Invention
In view of the above, the invention provides a phytase mutant, which can obtain mutant protein and improve heat resistance, thereby being beneficial to wide application of phytase in the field of feed.
In order to achieve the above object, the present invention provides the following technical solutions:
the present invention relates to a phytase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID No. 3 and comprising a substitution of an amino acid at least one position selected from the group consisting of SEQ ID No. 3: 36, 111, 202.
In some embodiments of the invention, the amino acid sequence of the mutant has at least 91%,92%,93%,94%,95%,96%,97%,98%, or at least 99% identity as compared to SEQ ID NO. 3.
In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%,99.2%,99.3%,99.4%,99.5%,99.6%,99.7%,99.8%, or at least 99.9% identity compared to SEQ ID NO. 3.
In some embodiments of the invention, the mutant comprises a substitution of at least one amino acid in the group consisting of: a36P, T111P, a202P.
In some embodiments of the invention, the mutant comprises a substitution or combination of substitutions selected from the following substitutions and combinations of substitutions: A36P, T111P, A202P, A36P/T111P, A36P/A202P, T111P/A202P, A36P/T111P/A202P.
The invention also relates to a DNA molecule for encoding the phytase mutant.
The invention also relates to a recombinant expression vector comprising the DNA molecule.
The invention also relates to a host cell comprising the recombinant expression vector.
The plasmid is transferred into host cells, and the heat resistance of the recombinant phytase mutant is obviously improved.
In some embodiments of the invention, the host cell is Pichia pastorisPichia pastoris)。
In some embodiments of the invention, the host cell is Trichoderma reeseiTrichoderma reesei)。
The invention also provides a preparation method of the phytase mutant, which comprises the following steps:
step 1: obtaining a DNA molecule encoding a phytase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID No. 3 and comprising a substitution of at least one amino acid at least one position selected from the group consisting of SEQ ID No. 1: 36 A, 111, 202;
step 2: fusing the DNA molecule obtained in the step 1 with an expression vector, constructing a recombinant expression vector, and transforming a host cell;
step 3: inducing host cells containing the recombinant expression vector to express the fusion protein, and separating and purifying the expressed fusion protein.
In some embodiments of the invention, the phytase mutant described in step 1 comprises a substitution of at least one amino acid from the group consisting of: a36P, T111P, a202P.
In some embodiments of the invention, the host cell of step 2 is Pichia pastorisPichia pastoris)。
In some embodiments of the invention, the host cell of step 2 is Trichoderma reeseiTrichoderma reesei)。
The invention also provides application of the phytase mutant in feed.
The invention provides mutants comprising at least one mutation site in A36P, T111P, A202P based on phytase APPA-N0. Compared with APPA-N0, the heat resistance of the mutant is obviously improved. Wherein, after the treatment at 80 ℃ for 5min, the enzyme activity residual rates of mutants PHY-N1, PHY-N2 and PHY-N3 containing single point mutation of A36P, T111P, A P are respectively improved by 21.2%, 7.4% and 14.3%; the enzyme activity residual rates of the mutant PHY-N4, PHY-N5 and PHY-N6 respectively comprising the combination of the two mutation sites of A36P/T111P, A36P/A202P, T P/A202P and the mutant PHY-N7 respectively comprising the combination of the three mutation sites of A36P/T111P/A202P are respectively increased by 28.9%, 36.9%, 8.0% and 45.1%; after 5min of treatment at 85 ℃, the enzyme activity residual rates of the mutant PHY-N3 containing the A202P single point mutation, the mutant PHY-N4 and the mutant PHY-N5 containing the combination of the two mutation sites of A36P/T111P, A P/A202P and the mutant PHY-N7 containing the combination of the three mutation sites of A36P/T111P/A202P are respectively improved by 18.4%, 13.1%, 25.0% and 30.8%, and unexpected technical effects are obtained. The phytase mutant provided by the invention can be widely applied to the field of feed.
Detailed Description
The invention discloses a phytase mutant, a preparation method and application thereof, and DNA molecules, vectors and host cells for encoding the phytase mutant, and the phytase mutant can be properly improved by a person skilled in the art by referring to the content of the text. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the relevant art that variations and modifications can be made in the methods and applications described herein, and in the practice and application of the techniques of this invention, without departing from the spirit or scope of the invention.
In the present invention, the nomenclature used to define the amino acid positions is based on the amino acid sequence of the phytase of E.coli deposited with Genbank under the accession number ABF60232, which is given in the sequence listing as SEQ ID NO. 1 (amino acids 1-410 of SEQ ID NO. 1). Thus, in this context, the base SEQ ID NO:1, starting at Q1 (Gln 1) and ending at L410 (Leu 410). SEQ ID NO:1 serves as a criterion for position numbering and thus as a basis for naming.
The present invention uses conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as MOLECULAR CLONING: a LABORATORY MANUAL,3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art may adopt other conventional methods, experimental schemes and reagents in the art based on the technical scheme described in the present invention, and are not limited to the specific embodiments of the present invention. For example, the invention may be used with the following experimental materials and reagents:
strains and vectors: coli DH 5. Alpha., pichia pastoris GS115, vector pPIC9k, amp, G418 were purchased from Invitrogen corporation.
Enzyme and kit: the PCR enzyme and the ligase were purchased from Takara, the restriction enzyme from Fermentas, the plasmid extraction kit and the gel purification recovery kit from Omega, and the GeneMorph II random mutagenesis kit from Beijing Bomeis Biotechnology Co.
The formula of the culture medium comprises:
coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% nacl, ph 7.0);
yeast Medium (YPD Medium): 1% yeast extract, 2% peptone, 2% glucose;
yeast screening medium (MD medium): 2% peptone, 2% agarose;
BMGY medium: 2% peptone, 1% yeast extract, 100. 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4X 10-5 biotin, 1% glycerol;
BMMY medium: 2% peptone, 1% yeast extract, 100. 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4X 10-5 biotin, 0.5% methanol;
LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCL, 100. Mu.g/mL ampicillin, pH7.0;
LB-AMP plate: 0.5% yeast extract, 1% peptone, 1% NaCL,1.5% agar, 100. Mu.g/mL ampicillin, pH7.0;
upper medium: 0.1% MgSO 4 ,1%KH 2 PO 4 ,0.6%(NH 4 ) 2 SO 4 1% glucose, 18.3% sorbitol, 0.35% agarose;
lower medium plates: 2% glucose, 0.5% (NH 4 ) 2 SO 4 ,1.5%KH 2 PO 4 ,0.06%MgSO 4 ,0.06%CaCl 2 1.5% agar.
The invention is further illustrated by the following examples:
EXAMPLE 1 selection of thermostable mutants
The applicant mutates 10 positions (W46E, Q62W, G70E, A73P, T114H, N137V, D142R, S146E, R159Y and Y255D) of wild phytase APPA (the amino acid sequence is SEQ ID NO:1, the encoding nucleotide sequence is SEQ ID NO: 2) to obtain phytase mutant APPA-N0, the amino acid sequence is SEQ ID NO:3, and a coding nucleotide sequence is SEQ ID NO:4 is synthesized by referring to the sequence. Compared with phytase APPA, the heat resistance of the mutant APPA-N0 is obviously improved, the residual enzyme activity of the phytase APPA is less than 10% after the treatment for 5min at 75 ℃, and the residual enzyme activity of the mutant APPA-N0 is higher than 85%.
In order to further increase the thermostability of the phytase mutant APPA-N0, the applicant carried out a protein structural analysis of its gene, the protein having two domains: the 134 amino acid residues at the N end and the 152 amino acid residues at the C end form a structural domain 1 together, the remaining 124 amino acid residues form a structural domain 2, the conserved sequence and the active center are both positioned in the structural domain 1, and the gene is further mutated on the premise of not damaging the secondary structure and the active center of the protein.
1.1 designing PCR primers N0-F1, N0-R1:
N0-F1:GGCGAATTCCAGTCAGAACCAGAGTTGAAGTT (restriction enzyme EcoRI recognition site underlined);
N0-R1:ATAGCGGCCGCTTACAAGGAACAAGCAGGGAT (restriction endonuclease NotI recognition site underlined).
The APPA-N0 gene (SEQ ID NO: 4) is used as a template, the primers are used for carrying out PCR amplification by using a GeneMorph II random mutation PCR kit (Stratagene), PCR products are recovered by centrifugation, ecoRI and NotI are subjected to enzyme digestion treatment and then are connected with pET21a carriers subjected to the same enzyme digestion, the products are converted into escherichia coli BL21 (DE 3), the escherichia coli BL21 are coated on an LB+Amp flat plate, inverted culture is carried out at 37 ℃, after the transformants appear, the transformants are picked up to 96 pore plates one by using toothpicks, 150ul of LB+Amp culture medium containing 0.1mM IPTG is added into each pore, about 6 h is cultured at 37 ℃ at 220rpm, supernatant is removed by centrifugation, thalli are resuspended by using buffer solution, and cell walls of escherichia coli cells containing phytase are repeatedly frozen and melted.
Taking out 40ul of lysate to two new 96-well plates respectively, and treating one 96-well plate at 75 ℃ for 5min; then, 80ul of substrate was added to each of the two 96-well plates, and after 30min of reaction at 37 ℃,80 ul of stop solution (ammonium vanadate: ammonium molybdate: nitric acid=1:1:2) was added, and the resulting inorganic phosphorus content was measured. The activity that is maintained after the high temperature treatment of the different mutants is different.
Experimental results show that some mutations have no influence on the heat resistance of the phytase APPA-N0, some mutations even make the heat resistance or the enzyme activity worse, and other mutations can improve the temperature tolerance of the APPA-N0, but the enzymatic properties of the phytase after the mutations are obviously changed, so that the mutations are not satisfactory. Finally, the applicant obtains mutation sites which can not only remarkably improve the heat resistance of APPA-N0, but also can not influence the enzyme activity and the original enzymatic properties: a36P, T111P, a202P.
Based on phytase APPA-N0, the invention provides single point mutants respectively comprising single mutation sites of A36P, T111P, A P, which are named PHY-N1, PHY-N2 and PHY-N3, and the amino acid sequences of the single point mutants are respectively SEQ ID NO. 5, SEQ ID NO. 7 and SEQ ID NO. 9, and the coding nucleotide sequences of the single point mutants are respectively SEQ ID NO. 6, SEQ ID NO. 8 and SEQ ID NO. 10.
The invention further provides mutants comprising two mutation site combinations of A36P/T111P, A P/A202P, T P/A202P, which are named PHY-N4, PHY-N5 and PHY-N6, and the amino acid sequences of the mutants are SEQ ID NO. 11, SEQ ID NO. 13 and SEQ ID NO. 15, and the encoding nucleotide sequences of the mutants are SEQ ID NO. 12, SEQ ID NO. 14 and SEQ ID NO. 16.
The invention also provides a mutant comprising three mutation site combinations of A36P/T111P/A202P, which is named PHY-N7, the amino acid sequences of which are respectively SEQ ID NO. 17, and the encoding nucleotide sequences of which are SEQ ID NO. 18.
EXAMPLE 2 expression of Phytase mutants in Pichia pastoris
The gene sequence SEQ ID NO of APPA-N0 is respectively carried out according to the password preference of pichia pastoris: 4, and the gene sequence of the mutant are optimized and synthesized, and EcoRI and NotI two enzyme cutting sites are respectively added at the 5 'end and the 3' end of the synthesized sequence.
2.1 construction of expression vectors
The synthetic APPA-N0 and mutant gene sequences were digested with EcoRI and NotI, respectively, and then ligated with the digested pPIC-9K vector overnight at 16℃and transformed into E.coli DH5a, which was spread on LB+Amp plates, cultured in an inverted manner at 37℃and, after the transformants appeared, colony PCR (reaction system: template-picked monoclonal, rTaqDNA polymerase 0.5ul,10 Xbuffer 2.0. Mu.L, dNTPs (2.5 mM) 2.0. Mu.L, 5'AOX primer (10M): 0.5. Mu.L, 3'AOX primer: 0.5 mu L ddH 2 O14.5 μl, reaction procedure: pre-denaturation at 95 ℃ for 5min,30 cycles: 94℃30sec,55℃30sec,72℃2min,72℃10 min). And (3) verifying positive clones, and obtaining the correct recombinant expression plasmid after sequencing verification.
2.2 construction of Pichia pastoris engineering strains
2.2.1 Yeast competent preparation
Activating Pichia pastoris GS115 strain by YPD plates, culturing at 30 ℃ for 48 and h, inoculating activated GS115 monoclonal in 6 mL YPD liquid culture medium, culturing at 30 ℃ for about 12 h and then transferring the bacterial liquid into a triangular flask filled with 30mL YPD liquid culture medium, culturing at 30 ℃ for about 5 hours at 220rpm, detecting the bacterial density by an ultraviolet spectrophotometer, respectively collecting 4mL bacterial bodies into a sterilized EP tube after the OD600 value is in the range of 1.1-1.3, centrifuging at 4 ℃ for 2min at 9000rpm, lightly discarding the supernatant, sucking the residual supernatant with sterilized filter paper, re-suspending the bacterial bodies with precooled 1mL sterilized water for 2min at 4 ℃ and 9000rpm, lightly discarding the supernatant, re-multiplexing 1mL sterilized water for one time, centrifuging at 4 ℃ and 9000rpm for 2min, and lightly discarding the supernatant and lightly suspending the precooled 1mL sorbitol (1 mol/L); centrifuge at 9000rpm for 2min at 4℃and gently discard supernatant, gently resuspend pre-chilled 100-150. Mu.l sorbitol (1 mol/L).
2.2.2 transformation and screening
Linearizing the expression plasmid obtained by 2.1 respectively with Sac I, purifying and recovering linearization fragments, respectively transforming Pichia pastoris GS115 by electroporation, screening on MD plates to obtain recombinant Pichia pastoris strains, and screening on YPD plates (0.5 mg/mL-8 mg/mL) containing geneticin at different concentrations to obtain multicopy transformants.
Transferring the obtained transformants into BMGY culture medium respectively, and culturing at 30 ℃ and 250rpm in a shaking way for 1d; then transferring the strain into a BMMY culture medium, and carrying out shaking culture at 30 ℃ and 250 rpm; 0.5% methanol was added daily to induce expression 4 d; removing thalli by centrifugation at 9000rpm for 10min to obtain fermentation supernatant respectively containing phytase APPA-N0 and phytase mutant.
(1) Definition of Phytase Activity Unit
At 37℃and pH5.0, 1. Mu. Mol of inorganic phosphorus per minute was released from sodium phytate at a concentration of 5.0mmol/L, which is a phytase activity unit, denoted U.
(2) Phytase enzyme activity determination method
Two 25mL colorimetric tubes A and B were taken, 1.8mL of acetic acid buffer (pH 5.0) and 0.2mL of the sample reaction solution were added respectively, and the mixture was mixed uniformly and preheated at 37℃for 5min. Adding 4mL of substrate solution into the first tube, adding 4mL of stopping solution into the second tube, uniformly mixing, reacting for 30min at 37 ℃, adding 4mL of stopping solution into the first tube after the reaction is finished, adding 4mL of substrate solution into the second tube, and uniformly mixing. The mixture was allowed to stand for 10 minutes, and absorbance was measured at 415nm, respectively. 3 samples were prepared in parallel, the absorbance was averaged, and the phytase activity was calculated by a regression line equation using a standard curve.
Enzyme activity x=f×c/(m×30)
Wherein: x is enzyme activity unit, U/g (mL);
f, total dilution times before the reaction of the sample solution;
c, calculating the enzyme activity according to a linear regression equation according to the light absorption value of the actual sample liquid, and U;
m-sample mass or volume, g/mL;
30-reaction time.
And respectively carrying out phytase enzyme activity determination on the fermentation supernatant of the constructed pichia pastoris recombinant strain by adopting the method.
EXAMPLE 3 expression of Phytase mutants in Trichoderma reesei
According to the codon preference of trichoderma, the gene sequence SEQ ID NO:4, and the gene sequence of the mutant are optimally synthesized, and two restriction sites of KpnI and MluI are respectively added at the 5 'end and the 3' end of the synthesized sequence.
3.1 construction of expression vectors
The synthesized phytase gene fragment and pSC1G vector were digested with restriction enzymes KpnI and MluI (Fermentas), respectively, the digested products were purified using a gel purification kit, and the above phytase gene and the digested products of pSC1G vector were ligated with T4 DNA ligase (Fermentas), respectively, and E.coli Trans 5. Alpha (Transgen) was transformed, selected with ampicillin, and the clones were sequenced (Invitrogen) and verified. And after the sequencing is correct, the recombinant plasmid containing the phytase gene is obtained.
3.2 Construction of Trichoderma reesei recombinant strains
(1) Protoplast preparation
Taking host fungus Trichoderma reeseiTrichoderma reesei) The UE spore suspension is inoculated on a PDA plate and cultured for 6 days at 30 ℃; after the spore is produced in a rich way, cutting a colony with the length of about 1cm multiplied by 1cm, placing the colony in a liquid culture medium containing 120 mL YEG+U (0.5% yeast powder, 1% glucose and 0.1% uridine), and carrying out shaking culture at 30 ℃ and 220rpm for 14-16 h;
filtering and collecting mycelium with sterile gauze, and cleaning with sterile water once; mycelium was placed in a triangular flask containing 20 mL 10mg/mL of lyase solution (Sigma L1412), at 30℃and 90 rpm for 1-2 h; detecting the progress of protoplast transformation by microscopic observation;
precooling 20 mL of 1.2M sorbitol (1.2M sorbitol, 50 mM Tris-Cl,50 mM CaCl) 2 ) Adding into the above triangular flask, shaking gently, filtering with sterile Miracloth filter cloth, collecting filtrate, centrifuging at 3000 rpm at 4deg.C for 10 min; removing the supernatant, adding pre-cooled 5mL of 1.2M sorbitol solution to suspend the thalli, and centrifuging at 3000 rpm and 4 ℃ for 10 min; removing supernatant, adding appropriate amount of precooled 1.2. 1.2M sorbitol, suspending, and packaging (200 μl/tube, protoplast concentration of 10) 8 and/mL).
(2) Expression vector transformation
The following operations were all performed on ice, 10. Mu.g of the recombinant plasmid constructed above was added to a7 mL sterile centrifuge tube containing 200. Mu.L of protoplast solution, followed by 50. Mu.L of 25% PEG (25% PEG,50 mM Tris-Cl,50 mM CaCl) 2 ) Mixing the bottom of the flick pipe uniformly, and placing on ice for 20 min; adding 2mL of 25% PEG, uniformly mixing, and standing at room temperature for 5min; 4mL of 1.2M sorbitol was added, gently mixed, and poured into the upper medium which melted and maintained at 55 ℃; lightly mixing and spreading on a prepared lower layer culture medium plate, culturing at 30 ℃ for 5-7 d until the transformant grows out, and picking the grown transformant to the lower layerThe culture medium plate is re-screened, and the strain with smoother colony edge morphology is a positive transformant.
According to the method, the applicant respectively constructs and obtains the recombinant expression APPA-N0 and the Trichoderma reesei engineering strain of the phytase mutant.
(3) Fermentation verification and enzyme activity determination
Inoculating Trichoderma reesei engineering strain obtained by the above construction to PDA solid plate, culturing in a constant temperature incubator at 30deg.C for 6-7 days, respectively inoculating two pieces of mycelium blocks with diameter of 1cm to 50mL fermentation medium (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH) 4 ) 2 SO 4 ,0.09%MgSO 4 ,2%KH 2 PO 4 ,0.04%CaCl 2 0.018% tween-80,0.018% trace elements) was incubated at 30 ℃ for 48 hours, then at 25 ℃ for 48 hours. And centrifuging the fermentation liquor to obtain fermentation supernatant respectively containing phytase APPA-N0 and the phytase mutant.
The phytase enzyme activity was determined on the fermentation supernatants of the recombinant Trichoderma reesei strains thus constructed, respectively, by the method described in example 2.
Example 4 thermal stability analysis
Diluting the recombinant strain fermentation supernatants expressing the phytase mutants obtained above 10-fold with 0.25M sodium acetate buffer pre-warmed for 10min, pH 5.0; the diluted samples were then subjected to the following treatments, respectively: treating at 80deg.C for 5min, at 85deg.C for 5min, sampling at the end, and cooling to room temperature; the phytase activities of the samples after heat treatment were measured, and the enzyme activity residual rate was calculated by taking the enzyme activity of the untreated samples as 100%.
Enzyme activity residual ratio (%) =enzyme activity of untreated sample/enzyme activity of heat-treated sample×100%.
The results show that after the phytase mutant containing the single point mutation of A36P, T111P, A P provided by the invention is treated for 5min at 80 ℃, the enzyme activity residual rates of the phytase mutants PHY-N1, PHY-N2 and PHY-N3 are respectively improved by 21.2%, 7.4% and 14.3% compared with that of phytase APPA-N0; the heat resistance of the phytase mutants PHY-N4, PHY-N5 and PHY-N6 respectively comprising the combination of the two mutation sites A36P/T111P, A P/A202P, T P/A202P and the heat resistance of the phytase mutant PHY-N7 respectively comprising the combination of the three mutation sites A36P/T111P/A202P are further improved, and the enzyme activity residual rate is respectively improved by 28.9%, 36.9%, 8.0% and 45.1% compared with that of the phytase APPA-N0, so that unexpected technical effects are obtained.
After 5min of treatment at 85 ℃, the enzyme activity residual rates of the phytase mutant PHY-N3 containing the A202P single point mutation, the phytase mutants PHY-N4 and PHY-N5 containing the combination of two mutation sites of A36P/T111P, A P/A202P respectively, and the phytase mutant PHY-N7 containing the combination of three mutation sites of A36P/T111P/A202P are respectively improved by 18.4%, 13.1%, 25.0% and 30.8% compared with that of phytase APPA-N0, and unexpected technical effects are obtained.
In conclusion, the mutation site A36P, T111P, A P provided by the invention can obviously improve the heat resistance of phytase, thereby being beneficial to the wide application of phytase in feed.
Sequence listing
<110> Qingdao blue biological group Co.Ltd
<120> Phytase mutant
<160> 18
<170> SIPOSequenceListing 1.0
<210> 1
<211> 410
<212> PRT
<213> Escherichia coli (Escherichia coli)
<400> 1
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln
50 55 60
Arg Leu Val Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val
100 105 110
His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val Thr Asp Ala Ile
130 135 140
Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 2
<211> 1233
<212> DNA
<213> Escherichia coli (Escherichia coli)
<400> 2
cagagtgagc cggagctgaa gctggaaagt gtggtgattg tcagtcgtca tggtgtgcgt 60
gctccaacca aggccacgca actgatgcag gatgtcaccc cagacgcatg gccaacctgg 120
ccggtaaaac tgggttggct gacaccgcgc ggtggtgagc taatcgccta tctcggacat 180
taccaacgcc agcgtctggt agccgacgga ttgctggcga aaaagggctg cccgcagtct 240
ggtcaggtcg cgattattgc tgatgtcgac gagcgtaccc gtaaaacagg cgaagccttc 300
gccgccgggc tggcacctga ctgtgcaata accgtacata cccaggcaga tacgtccagt 360
cccgatccgt tatttaatcc tctaaaaact ggcgtttgcc aactggataa cgcgaacgtg 420
actgacgcga tcctcagcag ggcaggaggg tcaattgctg actttaccgg gcatcggcaa 480
acggcgtttc gcgaactgga acgggtgctt aattttccgc aatcaaactt gtgccttaaa 540
cgtgagaaac aggacgaaag ctgttcatta acgcaggcat taccatcgga actcaaggtg 600
agcgccgaca atgtctcatt aaccggtgcg gtaagcctcg catcaatgct gacggagata 660
tttctcctgc aacaagcaca gggaatgccg gagccggggt ggggaaggat caccgattca 720
caccagtgga acaccttgct aagtttgcat aacgcgcaat tttatttgct acaacgcacg 780
ccagaggttg cccgcagccg cgccaccccg ttattagatt tgatcaagac agcgttgacg 840
ccccatccac cgcaaaaaca ggcgtatggt gtgacattac ccacttcagt gctgtttatc 900
gccggacacg atactaatct ggcaaatctc ggcggcgcac tggagctcaa ctggacgctt 960
cccggtcagc cggataacac gccgccaggt ggtgaactgg tgtttgaacg ctggcgtcgg 1020
ctaagcgata acagccagtg gattcaggtt tcgctggtct tccagacttt acagcagatg 1080
cgtgataaaa cgccgctgtc attaaatacg ccgcccggag aggtgaaact gaccctggca 1140
ggatgtgaag agcgaaatgc gcagggcatg tgttcgttgg caggttttac gcaaatcgtg 1200
aatgaagcac gcataccggc gtgcagtttg taa 1233
<210> 3
<211> 410
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 3
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp Arg Gln
50 55 60
Arg Leu Val Ala Asp Glu Leu Leu Pro Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val
100 105 110
His His Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Val Ala Asn Val Thr Arg Ala Ile
130 135 140
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Asp Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 4
<211> 1230
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
caatctgaac cagaattgaa gttggaatct gttgttattg tttcccgtca cggtgttaga 60
gccccaacta aggctactca attgatgcaa gatgttactc cagatgcttg gccaacttgg 120
ccagttaagt tgggtgaatt gactccaaga ggtggtgaat tgattgctta cttgggtcat 180
tactggagac aaagattggt tgctgatgaa ttgttgccaa agaagggttg tccacaatct 240
ggtcaagttg ctattattgc tgatgttgat gaacgcacta gaaagaccgg tgaggctttt 300
gctgctggtt tggctccaga ttgtgctatt actgttcatc atcaagctga tacttcttcc 360
ccagatccat tgtttaaccc attgaagact ggtgtttgtc aattggatgt tgctaacgtt 420
actagagcta ttttggaaag agctggtggt tctattgctg attttactgg tcattaccaa 480
accgcctttc gtgaattgga aagagttttg aactttccac aatccaactt gtgtttgaag 540
agagaaaagc aagatgagtc ctgttccttg acccaagctc ttccatctga attgaaggtt 600
tctgctgata acgtttcttt gactggtgct gtttctttgg cttctatgtt gactgaaatt 660
ttcttgttgc agcaggctca aggtatgcca gaaccaggtt ggggtagaat tactgattct 720
catcaatgga acactttgtt gtctttgcat aacgctcaat ttgacttgtt gcaaagaact 780
ccagaagttg ctagatctag agctactcca ttgttggatt tgattaagac tgctttgact 840
ccacatccac cacaaaagca ggcttacggt gttactttgc caacttctgt tttgtttatt 900
gccggtcatg ataccaactt ggctaacttg ggtggtgctt tggaattgaa ctggactttg 960
ccaggtcaac cagataacac tccaccaggt ggtgaattgg tttttgaaag atggagaaga 1020
ttgtccgata actctcaatg gattcaagtt tctttggtct ttcagacctt gcagcaaatg 1080
agagataaga ctccattgtc tttgaacact ccaccaggtg aagttaagtt gactttggct 1140
ggttgtgaag aaagaaacgc tcaaggtatg tgttctttgg ctggttttac tcaaattgtc 1200
aacgaggcta gaatcccagc ttgttctttg 1230
<210> 5
<211> 410
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 5
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Pro Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp Arg Gln
50 55 60
Arg Leu Val Ala Asp Glu Leu Leu Pro Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val
100 105 110
His His Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Val Ala Asn Val Thr Arg Ala Ile
130 135 140
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Asp Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 6
<211> 1230
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
caatctgaac cagaattgaa gttggaatct gttgttattg tttcccgtca cggtgttaga 60
gccccaacta aggctactca attgatgcaa gatgttactc cagatccatg gccaacttgg 120
ccagttaagt tgggtgaatt gactccaaga ggtggtgaat tgattgctta cttgggtcat 180
tactggagac aaagattggt tgctgatgaa ttgttgccaa agaagggttg tccacaatct 240
ggtcaagttg ctattattgc tgatgttgat gaacgcacta gaaagaccgg tgaggctttt 300
gctgctggtt tggctccaga ttgtgctatt actgttcatc atcaagctga tacttcttcc 360
ccagatccat tgtttaaccc attgaagact ggtgtttgtc aattggatgt tgctaacgtt 420
actagagcta ttttggaaag agctggtggt tctattgctg attttactgg tcattaccaa 480
accgcctttc gtgaattgga aagagttttg aactttccac aatccaactt gtgtttgaag 540
agagaaaagc aagatgagtc ctgttccttg acccaagctc ttccatctga attgaaggtt 600
tctgctgata acgtttcttt gactggtgct gtttctttgg cttctatgtt gactgaaatt 660
ttcttgttgc agcaggctca aggtatgcca gaaccaggtt ggggtagaat tactgattct 720
catcaatgga acactttgtt gtctttgcat aacgctcaat ttgacttgtt gcaaagaact 780
ccagaagttg ctagatctag agctactcca ttgttggatt tgattaagac tgctttgact 840
ccacatccac cacaaaagca ggcttacggt gttactttgc caacttctgt tttgtttatt 900
gccggtcatg ataccaactt ggctaacttg ggtggtgctt tggaattgaa ctggactttg 960
ccaggtcaac cagataacac tccaccaggt ggtgaattgg tttttgaaag atggagaaga 1020
ttgtccgata actctcaatg gattcaagtt tctttggtct ttcagacctt gcagcaaatg 1080
agagataaga ctccattgtc tttgaacact ccaccaggtg aagttaagtt gactttggct 1140
ggttgtgaag aaagaaacgc tcaaggtatg tgttctttgg ctggttttac tcaaattgtc 1200
aacgaggcta gaatcccagc ttgttctttg 1230
<210> 7
<211> 410
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 7
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp Arg Gln
50 55 60
Arg Leu Val Ala Asp Glu Leu Leu Pro Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Pro Val
100 105 110
His His Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Val Ala Asn Val Thr Arg Ala Ile
130 135 140
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Asp Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 8
<211> 1230
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
caatctgaac cagaattgaa gttggaatct gttgttattg tttcccgtca cggtgttaga 60
gccccaacta aggctactca attgatgcaa gatgttactc cagatgcttg gccaacttgg 120
ccagttaagt tgggtgaatt gactccaaga ggtggtgaat tgattgctta cttgggtcat 180
tactggagac aaagattggt tgctgatgaa ttgttgccaa agaagggttg tccacaatct 240
ggtcaagttg ctattattgc tgatgttgat gaacgcacta gaaagaccgg tgaggctttt 300
gctgctggtt tggctccaga ttgtgctatt ccagttcatc atcaagctga tacttcttcc 360
ccagatccat tgtttaaccc attgaagact ggtgtttgtc aattggatgt tgctaacgtt 420
actagagcta ttttggaaag agctggtggt tctattgctg attttactgg tcattaccaa 480
accgcctttc gtgaattgga aagagttttg aactttccac aatccaactt gtgtttgaag 540
agagaaaagc aagatgagtc ctgttccttg acccaagctc ttccatctga attgaaggtt 600
tctgctgata acgtttcttt gactggtgct gtttctttgg cttctatgtt gactgaaatt 660
ttcttgttgc agcaggctca aggtatgcca gaaccaggtt ggggtagaat tactgattct 720
catcaatgga acactttgtt gtctttgcat aacgctcaat ttgacttgtt gcaaagaact 780
ccagaagttg ctagatctag agctactcca ttgttggatt tgattaagac tgctttgact 840
ccacatccac cacaaaagca ggcttacggt gttactttgc caacttctgt tttgtttatt 900
gccggtcatg ataccaactt ggctaacttg ggtggtgctt tggaattgaa ctggactttg 960
ccaggtcaac cagataacac tccaccaggt ggtgaattgg tttttgaaag atggagaaga 1020
ttgtccgata actctcaatg gattcaagtt tctttggtct ttcagacctt gcagcaaatg 1080
agagataaga ctccattgtc tttgaacact ccaccaggtg aagttaagtt gactttggct 1140
ggttgtgaag aaagaaacgc tcaaggtatg tgttctttgg ctggttttac tcaaattgtc 1200
aacgaggcta gaatcccagc ttgttctttg 1230
<210> 9
<211> 410
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 9
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp Arg Gln
50 55 60
Arg Leu Val Ala Asp Glu Leu Leu Pro Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val
100 105 110
His His Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Val Ala Asn Val Thr Arg Ala Ile
130 135 140
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Pro Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Asp Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 10
<211> 1230
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
caatctgaac cagaattgaa gttggaatct gttgttattg tttcccgtca cggtgttaga 60
gccccaacta aggctactca attgatgcaa gatgttactc cagatgcttg gccaacttgg 120
ccagttaagt tgggtgaatt gactccaaga ggtggtgaat tgattgctta cttgggtcat 180
tactggagac aaagattggt tgctgatgaa ttgttgccaa agaagggttg tccacaatct 240
ggtcaagttg ctattattgc tgatgttgat gaacgcacta gaaagaccgg tgaggctttt 300
gctgctggtt tggctccaga ttgtgctatt actgttcatc atcaagctga tacttcttcc 360
ccagatccat tgtttaaccc attgaagact ggtgtttgtc aattggatgt tgctaacgtt 420
actagagcta ttttggaaag agctggtggt tctattgctg attttactgg tcattaccaa 480
accgcctttc gtgaattgga aagagttttg aactttccac aatccaactt gtgtttgaag 540
agagaaaagc aagatgagtc ctgttccttg acccaagctc ttccatctga attgaaggtt 600
tctccagata acgtttcttt gactggtgct gtttctttgg cttctatgtt gactgaaatt 660
ttcttgttgc agcaggctca aggtatgcca gaaccaggtt ggggtagaat tactgattct 720
catcaatgga acactttgtt gtctttgcat aacgctcaat ttgacttgtt gcaaagaact 780
ccagaagttg ctagatctag agctactcca ttgttggatt tgattaagac tgctttgact 840
ccacatccac cacaaaagca ggcttacggt gttactttgc caacttctgt tttgtttatt 900
gccggtcatg ataccaactt ggctaacttg ggtggtgctt tggaattgaa ctggactttg 960
ccaggtcaac cagataacac tccaccaggt ggtgaattgg tttttgaaag atggagaaga 1020
ttgtccgata actctcaatg gattcaagtt tctttggtct ttcagacctt gcagcaaatg 1080
agagataaga ctccattgtc tttgaacact ccaccaggtg aagttaagtt gactttggct 1140
ggttgtgaag aaagaaacgc tcaaggtatg tgttctttgg ctggttttac tcaaattgtc 1200
aacgaggcta gaatcccagc ttgttctttg 1230
<210> 11
<211> 410
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 11
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Pro Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp Arg Gln
50 55 60
Arg Leu Val Ala Asp Glu Leu Leu Pro Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Pro Val
100 105 110
His His Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Val Ala Asn Val Thr Arg Ala Ile
130 135 140
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Asp Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 12
<211> 1230
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
caatctgaac cagaattgaa gttggaatct gttgttattg tttcccgtca cggtgttaga 60
gccccaacta aggctactca attgatgcaa gatgttactc cagatccatg gccaacttgg 120
ccagttaagt tgggtgaatt gactccaaga ggtggtgaat tgattgctta cttgggtcat 180
tactggagac aaagattggt tgctgatgaa ttgttgccaa agaagggttg tccacaatct 240
ggtcaagttg ctattattgc tgatgttgat gaacgcacta gaaagaccgg tgaggctttt 300
gctgctggtt tggctccaga ttgtgctatt ccagttcatc atcaagctga tacttcttcc 360
ccagatccat tgtttaaccc attgaagact ggtgtttgtc aattggatgt tgctaacgtt 420
actagagcta ttttggaaag agctggtggt tctattgctg attttactgg tcattaccaa 480
accgcctttc gtgaattgga aagagttttg aactttccac aatccaactt gtgtttgaag 540
agagaaaagc aagatgagtc ctgttccttg acccaagctc ttccatctga attgaaggtt 600
tctgctgata acgtttcttt gactggtgct gtttctttgg cttctatgtt gactgaaatt 660
ttcttgttgc agcaggctca aggtatgcca gaaccaggtt ggggtagaat tactgattct 720
catcaatgga acactttgtt gtctttgcat aacgctcaat ttgacttgtt gcaaagaact 780
ccagaagttg ctagatctag agctactcca ttgttggatt tgattaagac tgctttgact 840
ccacatccac cacaaaagca ggcttacggt gttactttgc caacttctgt tttgtttatt 900
gccggtcatg ataccaactt ggctaacttg ggtggtgctt tggaattgaa ctggactttg 960
ccaggtcaac cagataacac tccaccaggt ggtgaattgg tttttgaaag atggagaaga 1020
ttgtccgata actctcaatg gattcaagtt tctttggtct ttcagacctt gcagcaaatg 1080
agagataaga ctccattgtc tttgaacact ccaccaggtg aagttaagtt gactttggct 1140
ggttgtgaag aaagaaacgc tcaaggtatg tgttctttgg ctggttttac tcaaattgtc 1200
aacgaggcta gaatcccagc ttgttctttg 1230
<210> 13
<211> 410
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 13
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Pro Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp Arg Gln
50 55 60
Arg Leu Val Ala Asp Glu Leu Leu Pro Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val
100 105 110
His His Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Val Ala Asn Val Thr Arg Ala Ile
130 135 140
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Pro Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Asp Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 14
<211> 1230
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
caatctgaac cagaattgaa gttggaatct gttgttattg tttcccgtca cggtgttaga 60
gccccaacta aggctactca attgatgcaa gatgttactc cagatccatg gccaacttgg 120
ccagttaagt tgggtgaatt gactccaaga ggtggtgaat tgattgctta cttgggtcat 180
tactggagac aaagattggt tgctgatgaa ttgttgccaa agaagggttg tccacaatct 240
ggtcaagttg ctattattgc tgatgttgat gaacgcacta gaaagaccgg tgaggctttt 300
gctgctggtt tggctccaga ttgtgctatt actgttcatc atcaagctga tacttcttcc 360
ccagatccat tgtttaaccc attgaagact ggtgtttgtc aattggatgt tgctaacgtt 420
actagagcta ttttggaaag agctggtggt tctattgctg attttactgg tcattaccaa 480
accgcctttc gtgaattgga aagagttttg aactttccac aatccaactt gtgtttgaag 540
agagaaaagc aagatgagtc ctgttccttg acccaagctc ttccatctga attgaaggtt 600
tctccagata acgtttcttt gactggtgct gtttctttgg cttctatgtt gactgaaatt 660
ttcttgttgc agcaggctca aggtatgcca gaaccaggtt ggggtagaat tactgattct 720
catcaatgga acactttgtt gtctttgcat aacgctcaat ttgacttgtt gcaaagaact 780
ccagaagttg ctagatctag agctactcca ttgttggatt tgattaagac tgctttgact 840
ccacatccac cacaaaagca ggcttacggt gttactttgc caacttctgt tttgtttatt 900
gccggtcatg ataccaactt ggctaacttg ggtggtgctt tggaattgaa ctggactttg 960
ccaggtcaac cagataacac tccaccaggt ggtgaattgg tttttgaaag atggagaaga 1020
ttgtccgata actctcaatg gattcaagtt tctttggtct ttcagacctt gcagcaaatg 1080
agagataaga ctccattgtc tttgaacact ccaccaggtg aagttaagtt gactttggct 1140
ggttgtgaag aaagaaacgc tcaaggtatg tgttctttgg ctggttttac tcaaattgtc 1200
aacgaggcta gaatcccagc ttgttctttg 1230
<210> 15
<211> 410
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 15
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp Arg Gln
50 55 60
Arg Leu Val Ala Asp Glu Leu Leu Pro Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Pro Val
100 105 110
His His Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Val Ala Asn Val Thr Arg Ala Ile
130 135 140
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Pro Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Asp Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 16
<211> 1230
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
caatctgaac cagaattgaa gttggaatct gttgttattg tttcccgtca cggtgttaga 60
gccccaacta aggctactca attgatgcaa gatgttactc cagatgcttg gccaacttgg 120
ccagttaagt tgggtgaatt gactccaaga ggtggtgaat tgattgctta cttgggtcat 180
tactggagac aaagattggt tgctgatgaa ttgttgccaa agaagggttg tccacaatct 240
ggtcaagttg ctattattgc tgatgttgat gaacgcacta gaaagaccgg tgaggctttt 300
gctgctggtt tggctccaga ttgtgctatt ccagttcatc atcaagctga tacttcttcc 360
ccagatccat tgtttaaccc attgaagact ggtgtttgtc aattggatgt tgctaacgtt 420
actagagcta ttttggaaag agctggtggt tctattgctg attttactgg tcattaccaa 480
accgcctttc gtgaattgga aagagttttg aactttccac aatccaactt gtgtttgaag 540
agagaaaagc aagatgagtc ctgttccttg acccaagctc ttccatctga attgaaggtt 600
tctccagata acgtttcttt gactggtgct gtttctttgg cttctatgtt gactgaaatt 660
ttcttgttgc agcaggctca aggtatgcca gaaccaggtt ggggtagaat tactgattct 720
catcaatgga acactttgtt gtctttgcat aacgctcaat ttgacttgtt gcaaagaact 780
ccagaagttg ctagatctag agctactcca ttgttggatt tgattaagac tgctttgact 840
ccacatccac cacaaaagca ggcttacggt gttactttgc caacttctgt tttgtttatt 900
gccggtcatg ataccaactt ggctaacttg ggtggtgctt tggaattgaa ctggactttg 960
ccaggtcaac cagataacac tccaccaggt ggtgaattgg tttttgaaag atggagaaga 1020
ttgtccgata actctcaatg gattcaagtt tctttggtct ttcagacctt gcagcaaatg 1080
agagataaga ctccattgtc tttgaacact ccaccaggtg aagttaagtt gactttggct 1140
ggttgtgaag aaagaaacgc tcaaggtatg tgttctttgg ctggttttac tcaaattgtc 1200
aacgaggcta gaatcccagc ttgttctttg 1230
<210> 17
<211> 410
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 17
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Pro Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp Arg Gln
50 55 60
Arg Leu Val Ala Asp Glu Leu Leu Pro Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Pro Val
100 105 110
His His Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Val Ala Asn Val Thr Arg Ala Ile
130 135 140
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Pro Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Asp Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 18
<211> 1230
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 18
caatctgaac cagaattgaa gttggaatct gttgttattg tttcccgtca cggtgttaga 60
gccccaacta aggctactca attgatgcaa gatgttactc cagatccatg gccaacttgg 120
ccagttaagt tgggtgaatt gactccaaga ggtggtgaat tgattgctta cttgggtcat 180
tactggagac aaagattggt tgctgatgaa ttgttgccaa agaagggttg tccacaatct 240
ggtcaagttg ctattattgc tgatgttgat gaacgcacta gaaagaccgg tgaggctttt 300
gctgctggtt tggctccaga ttgtgctatt ccagttcatc atcaagctga tacttcttcc 360
ccagatccat tgtttaaccc attgaagact ggtgtttgtc aattggatgt tgctaacgtt 420
actagagcta ttttggaaag agctggtggt tctattgctg attttactgg tcattaccaa 480
accgcctttc gtgaattgga aagagttttg aactttccac aatccaactt gtgtttgaag 540
agagaaaagc aagatgagtc ctgttccttg acccaagctc ttccatctga attgaaggtt 600
tctccagata acgtttcttt gactggtgct gtttctttgg cttctatgtt gactgaaatt 660
ttcttgttgc agcaggctca aggtatgcca gaaccaggtt ggggtagaat tactgattct 720
catcaatgga acactttgtt gtctttgcat aacgctcaat ttgacttgtt gcaaagaact 780
ccagaagttg ctagatctag agctactcca ttgttggatt tgattaagac tgctttgact 840
ccacatccac cacaaaagca ggcttacggt gttactttgc caacttctgt tttgtttatt 900
gccggtcatg ataccaactt ggctaacttg ggtggtgctt tggaattgaa ctggactttg 960
ccaggtcaac cagataacac tccaccaggt ggtgaattgg tttttgaaag atggagaaga 1020
ttgtccgata actctcaatg gattcaagtt tctttggtct ttcagacctt gcagcaaatg 1080
agagataaga ctccattgtc tttgaacact ccaccaggtg aagttaagtt gactttggct 1140
ggttgtgaag aaagaaacgc tcaaggtatg tgttctttgg ctggttttac tcaaattgtc 1200
aacgaggcta gaatcccagc ttgttctttg 1230

Claims (4)

1. A phytase mutant is characterized in that the amino acid sequence of the mutant is shown as SEQ ID NO. 11 or SEQ ID NO. 13 or SEQ ID NO. 17.
2. A DNA molecule encoding the phytase mutant of claim 1.
3. A vector having a DNA molecule according to claim 2.
4. A host cell comprising the vector of claim 3.
CN202110496409.7A 2020-05-22 2021-05-07 Phytase mutants Active CN113717959B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/CN2021/093532 WO2021233193A1 (en) 2020-05-22 2021-05-13 Phytase mutant

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2020104438824 2020-05-22
CN202010443882 2020-05-22

Publications (2)

Publication Number Publication Date
CN113717959A CN113717959A (en) 2021-11-30
CN113717959B true CN113717959B (en) 2024-04-02

Family

ID=78672730

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110496409.7A Active CN113717959B (en) 2020-05-22 2021-05-07 Phytase mutants

Country Status (2)

Country Link
CN (1) CN113717959B (en)
WO (1) WO2021233193A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2003270969A1 (en) * 1998-03-23 2004-01-22 Novozymes A/S Phytase Variants
CN106047836A (en) * 2016-06-15 2016-10-26 昆明爱科特生物科技有限公司 Phytase mutant and preparation method and application thereof
CN107236717A (en) * 2016-03-28 2017-10-10 青岛蔚蓝生物集团有限公司 Phytic acid enzyme mutant
CN107164344B (en) * 2017-06-28 2020-03-17 青岛红樱桃生物技术有限公司 Heat-resistant phytase mutant and encoding gene and application thereof

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7078035B2 (en) * 1997-08-13 2006-07-18 Diversa Corporation Phytases, nucleic acids encoding them and methods for making and using them
AU8126201A (en) * 2000-08-11 2002-02-25 Us Health Use of a transgene encoding a vertebrate phytase to increase capacity to utilizephytic acid in livestock feed
CN101883500A (en) * 2007-12-03 2010-11-10 先正达参股股份有限公司 Engineering enzymatically susceptible proteins
KR101692103B1 (en) * 2011-04-21 2017-01-02 바스프 에스이 Synthetic phytase variants
CN105441406A (en) * 2014-08-05 2016-03-30 北京大学 Phytase variant
WO2018004627A1 (en) * 2016-06-30 2018-01-04 Fornia Biosolutions, Inc. Novel phytases and uses thereof
CN107858364B (en) * 2017-12-04 2023-01-06 上海市农业科学院 High-temperature-resistant high-specific-activity bacterial phytase gene suitable for methanol yeast expression

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2003270969A1 (en) * 1998-03-23 2004-01-22 Novozymes A/S Phytase Variants
CN107236717A (en) * 2016-03-28 2017-10-10 青岛蔚蓝生物集团有限公司 Phytic acid enzyme mutant
CN106047836A (en) * 2016-06-15 2016-10-26 昆明爱科特生物科技有限公司 Phytase mutant and preparation method and application thereof
CN107164344B (en) * 2017-06-28 2020-03-17 青岛红樱桃生物技术有限公司 Heat-resistant phytase mutant and encoding gene and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Evolution of E. coli Phytase for Increased Thermostability Guided by Rational Parameters;Li Jiadi 等;J. Microbiol. Biotechnol;第29卷(第3期);419-428,参见全文 *

Also Published As

Publication number Publication date
CN113717959A (en) 2021-11-30
WO2021233193A1 (en) 2021-11-25

Similar Documents

Publication Publication Date Title
CN113699134B (en) Phytase mutants
US11739336B2 (en) Phytase mutants
CN107236717B (en) Phytase mutant
US20220154154A1 (en) Phytase mutant
CN110029120B (en) Phytase high-yield strain and application thereof
CN110527674A (en) Polypeptide, its polynucleotides of separation, and the additive comprising polypeptide, its purposes and method
CN111593063B (en) Application of recombinant vector or recombinant strain containing phytase mutant
CN102002487A (en) Optimized and improved high temperature resistance phytase PHYTH as well as gene and application thereof
CN113717958B (en) Phytase mutant with improved specific activity
CN113717959B (en) Phytase mutants
CN113403290A (en) Glucose oxidase mutant with improved thermal stability as well as coding gene and application thereof
CN111635895B (en) Phytase mutant
WO2023041040A1 (en) High temperature resistant mannanase mutant
WO2020063267A1 (en) Phytase mutant
CN107446832B (en) Pichia pastoris engineering bacterium for high-yield heat-resistant phytase
CN111218436B (en) Phytase mutant
WO2020063268A1 (en) Phytase mutant
CN109694858B (en) Phytase mutant
CN116121222A (en) Neutral phytase mutant and application thereof
CN118086257A (en) Alpha-galactosidase mutants
CN115094050A (en) Neutral phytase mutant and application thereof
CN115094049A (en) High-temperature-resistant neutral phytase mutant

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant