CN113717959A - Phytase mutant - Google Patents

Phytase mutant Download PDF

Info

Publication number
CN113717959A
CN113717959A CN202110496409.7A CN202110496409A CN113717959A CN 113717959 A CN113717959 A CN 113717959A CN 202110496409 A CN202110496409 A CN 202110496409A CN 113717959 A CN113717959 A CN 113717959A
Authority
CN
China
Prior art keywords
leu
ala
thr
pro
gln
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202110496409.7A
Other languages
Chinese (zh)
Other versions
CN113717959B (en
Inventor
李馨培
吴秀秀
黄亦钧
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qingdao Vland Biotech Group Co Ltd
Original Assignee
Qingdao Vland Biotech Group Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qingdao Vland Biotech Group Co Ltd filed Critical Qingdao Vland Biotech Group Co Ltd
Priority to PCT/CN2021/093532 priority Critical patent/WO2021233193A1/en
Publication of CN113717959A publication Critical patent/CN113717959A/en
Application granted granted Critical
Publication of CN113717959B publication Critical patent/CN113717959B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/02—Thioester hydrolases (3.1.2)
    • C12Y301/02006—Hydroxyacylglutathione hydrolase (3.1.2.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
    • C12Y301/03008—3-Phytase (3.1.3.8)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention relates to the technical field of biology, and particularly relates to a phytase mutant, a preparation method and application thereof, and a DNA molecule, a vector and a host cell for encoding the phytase mutant. The present invention provides a mutant comprising an amino acid substitution at least one position selected from the group consisting of: 36, 111, 202. The heat resistance of the mutant is obviously improved, thereby being beneficial to the wide application of the phytase in the feed.

Description

Phytase mutant
Technical Field
The invention relates to the technical field of biology, and particularly relates to a phytase mutant, a preparation method and application thereof, and a DNA molecule, a vector and a host cell for encoding the phytase mutant.
Background
Phytase is a phosphatase enzyme that hydrolyzes phytic acid. It can degrade phytate phosphorus (inositol hexaphosphate) into inositol and inorganic phosphoric acid. The enzymes are divided into two classes, 3-phytase (EC. 3.1.3.8) and 6-phytase (EC. 3.1.2.6). The phytase is widely present in plants, animals and microorganisms, such as high-grade plants of corn, wheat and the like, prokaryotic microorganisms of bacillus subtilis, pseudomonas, lactobacillus, escherichia coli and the like, and eukaryotic microorganisms of yeast, rhizopus, aspergillus and the like.
In the seeds of crops such as grains, beans and oil plants, the basic storage form of phosphorus is phytate phosphorus, the content of which is up to 1-3 percent and accounts for 60-80 percent of the total phosphorus in the plants. However, phosphorus in the form of phytate phosphorus is difficult to utilize due to the lack of enzymes capable of decomposing phytic acid in monogastric animals, and the utilization rate is only 0% -40%, thereby causing many problems: firstly, phosphorus source waste is caused, on one hand, the phosphorus source in the feed cannot be effectively utilized, on the other hand, in order to meet the requirement of animals on phosphorus, inorganic phosphorus must be added into the feed, and the feed cost is improved; secondly, high-phosphorus feces are formed to pollute the environment. About 85% of phytate phosphorus in the feed can be directly discharged out of the body by animals, and a large amount of phytate phosphorus in the excrement can seriously pollute water and soil. In addition, phytate phosphorus is an anti-nutritional factor which is associated with various metal ions such as Zn during the digestive absorption in the gastrointestinal tract of animals2 +、Ca2+、Cu2+、Fe2+And the protein sequesters to the corresponding insoluble complex, reducing the effective utilization of these nutrients by the animal.
The phytase can be used as a feed additive for monogastric animals, and the feeding effect of the phytase is verified worldwide. It can raise the utilization rate of phosphorus in plant feed by 60%, reduce phosphorus excretion in excrement by 40% and reduce the anti-nutritive action of phytic acid. Therefore, the phytase added into the feed has important significance for improving the production benefit of livestock and poultry industry and reducing the pollution of phytate phosphorus to the environment.
The phytase produced industrially mainly includes two kinds of fungal phytase derived from Aspergillus niger and bacterial phytase derived from Escherichia coli. Wherein, the phytase APPA derived from the escherichia coli has the characteristics of high specific activity, good stability of the digestive tract and the like. At present, the method is mainly applied to the feed industry by directly adding powder feed or spraying after granulating feed.
Because there is currently a short high temperature period of 80-90 c during the pellet feed production process. The bacterial phytase APPA has poor heat stability, the residual enzyme activity of the water solution is lower than 30 percent after the water solution is kept for 5 minutes at 70 ℃, the residual enzyme activity is generally lower than 20 percent after the water solution is directly added into animal feed for granulation, and the application of the APPA phytase in pellet feed is limited. The method of spraying the phytase liquid on the feed after the feed granulation not only increases the equipment investment, but also can not well ensure the stability of the enzyme preparation and the distribution uniformity in the feed. Therefore, the improvement of the heat stability has important practical significance for the prior phytase for the feed.
Disclosure of Invention
In view of the above, the invention provides a phytase mutant, which can obtain mutant protein and improve the heat resistance thereof, thereby facilitating the wide application of phytase in the field of feed.
In order to achieve the above object, the present invention provides the following technical solutions:
the present invention relates to a phytase mutant comprising an amino acid sequence having at least 90% identity to SEQ ID No. 3 and comprising a substitution of an amino acid in at least one position selected from the group consisting of SEQ ID No. 3: 36, 111, 202.
In some embodiments of the invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity to SEQ ID No. 3.
In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity compared to SEQ ID No. 3.
In some embodiments of the invention, the mutant comprises a substitution of at least one amino acid of the group: a36P, T111P, a 202P.
In some embodiments of the invention, the mutant comprises a substitution or combination of substitutions selected from the following substitutions and combinations of substitutions: A36P, T111P, A202P, A36P/T111P, A36P/A202P, T111P/A202P, A36P/T111P/A202P.
The invention also relates to DNA molecules encoding the phytase mutants.
The invention also relates to a recombinant expression vector containing the DNA molecule.
The invention also relates to a host cell comprising the recombinant expression vector.
The plasmid is transferred into host cells, and the heat resistance of the recombinant expressed phytase mutant is obviously improved.
In some embodiments of the invention, the host cell is pichia pastoris (a: (b))Pichia pastoris）。
In some embodiments of the invention, the host cell is trichoderma reesei (trichoderma reesei) (ii)Trichoderma reesei）。
The invention also provides a preparation method of the phytase mutant, which comprises the following steps:
step 1: obtaining a DNA molecule encoding a phytase mutant comprising an amino acid sequence having at least 90% identity to SEQ ID NO. 3 and comprising a substitution of at least one amino acid in at least one position selected from the group consisting of SEQ ID NO. 1: 36, 111, 202;
step 2: fusing the DNA molecule obtained in the step 1 with an expression vector to construct a recombinant expression vector and transform a host cell;
and step 3: inducing host cell containing recombinant expression vector to express fusion protein, and separating and purifying the expressed fusion protein.
In some embodiments of the invention, the phytase mutant of step 1 comprises a substitution of at least one amino acid of the group consisting of: a36P, T111P, a 202P.
In some embodiments of the invention, the host cell of step 2 is pichia pastoris (pichia pastoris) ((pichia pastoris))Pichia pastoris）。
In some embodiments of the invention, the host cell of step 2 is Trichoderma reesei (T. reesei) (T. reesei)) (TTrichoderma reesei）。
The invention also provides application of the phytase mutant in feed.
The invention provides a mutant containing at least one mutation site of A36P, T111P and A202P on the basis of phytase APPA-N0. Compared with APPA-N0, the mutant has obviously improved heat resistance. After treatment for 5min at 80 ℃, the enzyme activity residual rates of mutants PHY-N1, PHY-N2 and PHY-N3 containing single-point mutations of A36P, T111P and A202P are respectively improved by 21.2%, 7.4% and 14.3%; the enzyme activity residual rates of the mutants PHY-N4, PHY-N5 and PHY-N6 respectively comprising two mutation site combinations of A36P/T111P, A36P/A202P and T111P/A202P and the mutant PHY-N7 respectively comprising three mutation site combinations of A36P/T111P/A202P are respectively improved by 28.9%, 36.9%, 8.0% and 45.1%; after treatment at 85 ℃ for 5min, the enzyme activity residual rates of the mutant PHY-N3 containing the A202P single-point mutation, the mutant PHY-N4 and the mutant PHY-N5 containing the A36P/T111P and the A36P/A202P two mutation site combinations and the mutant PHY-N7 containing the A36P/T111P/A202P three mutation site combinations are respectively improved by 18.4%, 13.1%, 25.0% and 30.8%, and unexpected technical effects are achieved. The phytase mutant provided by the invention can be widely applied to the field of feed.
Detailed Description
The invention discloses a phytase mutant, a preparation method and application thereof, and a DNA molecule, a vector and a host cell for coding the phytase mutant. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.
In the present invention, the nomenclature used for defining the amino acid positions is based on the amino acid sequence of the phytase of E.coli deposited in Genbank under the accession number ABF60232, which is given in the sequence listing as SEQ ID NO:1 (amino acids 1-410 of SEQ ID NO: 1). Thus, in this context, the basic SEQ ID NO:1, starting from Q1 (Gln 1) and ending at L410 (Leu 410). SEQ ID NO:1 serves as a standard for position numbering and thus as a basis for naming.
The present invention uses conventional techniques and methods used in the fields of genetic engineering and MOLECULAR biology, such as MOLECULAR CLONING: a Laboratory Manual, 3nd Ed. (Sambrook, 2001) and Current Protocols IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can adopt other conventional methods, experimental schemes and reagents in the field on the basis of the technical scheme described in the invention, and the invention is not limited to the specific embodiment of the invention. For example, the following experimental materials and reagents may be selected for use in the present invention:
strain and carrier: coli DH5 α, Pichia pastoris GS115, vector pPIC9k, Amp, G418 were purchased from Invitrogen.
Enzyme and kit: PCR enzyme and ligase were purchased from Takara, restriction enzyme was purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomais Biotech.
The formula of the culture medium is as follows:
coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCL, ph 7.0);
yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;
yeast screening medium (MD medium): 2% peptone, 2% agarose;
BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH6.0), 1.34% YNB, 4X 10-5 biotin, 1% glycerol;
BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH6.0), 1.34% YNB, 4X 10-5 biotin, 0.5% methanol;
LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100. mu.g/mL ampicillin, pH 7.0;
LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100. mu.g/mL ampicillin, pH 7.0;
upper medium: 0.1% MgSO4，1%KH2PO4，0.6%(NH4)2SO41% glucose, 18.3% sorbitol, 0.35% agarose;
lower medium plate: 2% glucose, 0.5% (NH)4)2SO4，1.5%KH2PO4，0.06%MgSO4，0.06%CaCl21.5% agar.
The invention is further illustrated by the following examples:
example 1 screening of thermostable mutants
The applicant carries out mutation (W46E, Q62W, G70E, A73P, T114H, N137V, D142R, S146E, R159Y and Y255D) on 10 sites of a wild type phytase APPA (the amino acid sequence of which is SEQ ID NO:1 and the coding nucleotide sequence of which is SEQ ID NO:2) to obtain the phytase mutant APPA-N0, the amino acid sequence of which is SEQ ID NO:3, and a coding nucleotide sequence of which is SEQ ID NO:4 is synthesized by referring to the sequence. Compared with the phytase APPA, the heat resistance of the mutant APPA-N0 is obviously improved, after the phytase APPA is treated at 75 ℃ for 5min, the residual enzyme activity of the phytase APPA is less than 10%, and the residual enzyme activity of the mutant APPA-N0 is higher than 85%.
In order to further improve the thermotolerance of the phytase mutant APPA-N0, the applicant carried out a protein structural analysis of its gene, which has two domains: 134 amino acid residues at the N end and 152 amino acid residues at the C end jointly form a structural domain 1, the remaining 124 amino acid residues form a structural domain 2, the conserved sequence and the active center are positioned in the structural domain 1, and the gene is further mutated on the premise of not damaging the secondary structure and the active center of the protein.
1.1 design of PCR primers N0-F1, N0-R1:
N0-F1：GGCGAATTCCAGTCAGAACCAGAGTTGAAGTT (restriction enzyme EcoRI recognition site underlined);
N0-R1：ATAGCGGCCGCTTACAAGGAACAAGCAGGGAT (restriction endonuclease NotI recognition site underlined).
The method comprises the steps of using an APPA-N0 gene (SEQ ID NO: 4) as a template, utilizing the primers to perform PCR amplification by using a GeneMorph II random mutation PCR kit (Stratagene), carrying out gel recovery on PCR products, carrying out enzyme digestion treatment on EcoRI and NotI, connecting the products with pET21a vectors subjected to the same enzyme digestion, transforming the products into escherichia coli BL21 (DE 3), coating the escherichia coli BL21 and the escherichia coli BL21 on an LB + Amp flat plate, carrying out inversion culture at 37 ℃, selecting the products to 96 pore plates one by using toothpicks after the products appear, adding 150ul LB + Amp culture medium containing 0.1mM IPTG into each pore, carrying out culture at 220rpm at 37 ℃ for about 6 hours, centrifuging and abandoning supernatant, carrying out resuspension on thalli by using buffer solution, repeatedly freezing and thawing and breaking the walls, and obtaining the escherichia coli cell lysate containing phytase.
Respectively taking out 40ul of lysate to two new 96-well plates, and treating one 96-well plate at 75 ℃ for 5 min; then, 80ul of substrate was added to each of the two 96-well plates, reacted at 37 ℃ for 30min, and 80ul of stop solution (ammonium vanadate: ammonium molybdate: nitric acid = 1: 1: 2) was added to measure the content of the generated inorganic phosphorus. The activities of different mutants after high temperature treatment were different.
The experimental result shows that some mutations have no influence on the heat resistance of phytase APPA-N0, some mutations even make the heat resistance or enzyme activity of the phytase APPA-N0 worse, and in addition, some mutations can improve the temperature resistance of APPA-N0, but the enzymatic properties of the phytase APPA-N0 are obviously changed after the mutations, and the mutations do not meet the requirements. Finally, the applicant obtains a mutation site which can obviously improve the heat resistance of the APPA-N0 and does not influence the enzyme activity and the original enzymology property: a36P, T111P, a 202P.
On the basis of phytase APPA-N0, the invention provides single-point mutants respectively comprising single mutation sites of A36P, T111P and A202P, which are respectively named as PHY-N1, PHY-N2 and PHY-N3, the amino acid sequences of the single-point mutants are respectively SEQ ID NO 5, SEQ ID NO 7 and SEQ ID NO 9, and the coding nucleotide sequences of the single-point mutants are respectively SEQ ID NO 6, SEQ ID NO 8 and SEQ ID NO 10.
The invention further provides mutants containing a combination of two mutation sites of A36P/T111P, A36P/A202P and T111P/A202P, which are respectively named as PHY-N4, PHY-N5 and PHY-N6, the amino acid sequences of the mutants are respectively SEQ ID NO 11, SEQ ID NO 13 and SEQ ID NO 15, and the encoding nucleotide sequences of the mutants are respectively SEQ ID NO 12, SEQ ID NO 14 and SEQ ID NO 16.
The invention also provides a mutant containing the combination of three mutation sites of A36P/T111P/A202P, which is named as PHY-N7, the amino acid sequences of the mutant are respectively SEQ ID NO. 17, and the coding nucleotide sequence of the mutant is SEQ ID NO. 18.
Example 2 expression of phytase mutants in Pichia pastoris
According to the codon preference of pichia pastoris, the gene sequences of APPA-N0 are respectively shown in SEQ ID NO:4, optimally synthesizing the gene sequence of the mutant, and respectively adding EcoRI and NotI enzyme cutting sites at the 5 'end and the 3' end of the synthesized sequence.
2.1 construction of expression vectors
EcoRI and NotI double enzyme digestion is carried out on the synthesized gene sequences of the APPA-N0 and the mutant respectively, then the obtained product is connected with a pPIC-9K carrier which is subjected to the same enzyme digestion overnight at 16 ℃, escherichia coli DH5a is transformed, the obtained product is coated on an LB + Amp plate, inverted culture is carried out at 37 ℃, after a transformant appears, colony PCR (reaction system: monoclonal picked by a template, rTaqDNA polymerase 0.5ul, 10 xBuffer 2.0 muL, dNTPs (2.5mM) 2.0 muL, 5 'AOX primer (10M) 0.5 muL, 3' AOX primer 0.5 muL and ddH2O14.5 μ L, reaction procedure: pre-denaturation at 95 ℃ for 5min, 30 cycles: 94 ℃ 30sec, 55 ℃ 30sec, 72 ℃ 2min, 72 ℃ 10 min). And (5) verifying positive clones, and obtaining correct recombinant expression plasmids after sequencing verification.
2.2 construction of Pichia engineering Strain
2.2.1 Yeast competent preparation
YPD plate activation is carried out on a Pichia pastoris GS115 strain, the strain is cultured at 30 ℃ for 48 h, then the activated GS115 is inoculated to be monoclonal in 6 mL of YPD liquid culture medium, the strain is transferred to a bacteria liquid after being cultured at 30 ℃ for about 12 h, the strain liquid is cultured at 30 ℃ for about 5h at 220rpm, the density of the strain is detected by an ultraviolet spectrophotometer, after the OD600 value is in the range of 1.1-1.3, 4mL of the strain is respectively collected into a sterilized EP tube after being centrifuged at 4 ℃ and 9000rpm for 2min, the supernatant is lightly discarded, the residual supernatant is sucked by sterilized filter paper and then is re-suspended by 1mL of sterilized water, the strain is centrifuged at 4 ℃ and 9000rpm for 2min, the supernatant is re-suspended and re-suspended by 1mL of sterilized water, the supernatant is centrifuged at 4 ℃ and 9000rpm for 2min, and the pre-cooled 1mL of sorbitol (1 mol/L) strain is lightly discarded; centrifugation was carried out at 9000rpm for 2min at 4 ℃ and the supernatant was discarded, and the cells were gently resuspended in 100. mu.l of precooled sorbitol (1 mol/L).
2.2.2 transformation and screening
The expression plasmids obtained by the construction of 2.1 are linearized by Sac I, the linearized fragments are purified and recovered, and then are transformed into pichia pastoris GS115 by an electroporation method, pichia pastoris recombinant strains are obtained by screening on an MD plate, and then multi-copy transformants are screened on YPD plates (0.5 mg/mL-8 mg/mL) containing different concentrations of geneticin.
Transferring the obtained transformants to BMGY culture medium respectively, and performing shaking culture at 30 ℃ and 250rpm for 1 d; then transferring the strain into a BMMY culture medium, and carrying out shaking culture at 30 ℃ and 250 rpm; adding 0.5% methanol every day to induce expression for 4 d; centrifuging at 9000rpm for 10min to remove thallus, and obtaining fermentation supernatant respectively containing phytase APPA-N0 and phytase mutant.
(1) Definition of the enzyme Activity Unit of Phytase
At 37 deg.C and pH5.0, 1 μmol of inorganic phosphorus is released from sodium phytate with concentration of 5.0mmol/L per minute, and the unit of phytase activity is expressed by U.
(2) Method for measuring enzyme activity of phytase
Two 25mL colorimetric tubes A and B were taken, 1.8mL of an acetic acid buffer (pH 5.0) and 0.2mL of a sample reaction solution were added, mixed, and preheated at 37 ℃ for 5 min. Adding 4mL of substrate solution into the tube A, adding 4mL of stop solution into the tube B, mixing uniformly, reacting for 30min at 37 ℃, adding 4mL of stop solution into the tube A after the reaction is finished, adding 4mL of substrate solution into the tube B, and mixing uniformly. Standing for 10min, and measuring absorbance at 415nm wavelength respectively. For each sample, 3 replicates were taken and the absorbance was averaged and phytase activity was calculated by the regression line equation using a standard curve.
Enzyme activity X is F × C/(m × 30)
Wherein: x is the unit of enzyme activity, U/g (mL);
f is the total dilution multiple of the sample solution before reaction;
c is enzyme activity, U, calculated by a linear regression equation according to the light absorption value of the actual sample liquid;
m is sample mass or volume, g/mL;
30-reaction time.
The phytase enzyme activity determination is respectively carried out on the constructed pichia pastoris recombinant strain fermentation supernatant by adopting the method.
Example 3 expression of Phytase mutants in Trichoderma reesei
According to the codon preference of trichoderma, the gene sequences of APPA-N0 are respectively expressed by SEQ ID NO:4, optimally synthesizing the gene sequence of the mutant, and respectively adding two enzyme cutting sites KpnI and MluI at the two ends of the 5 'and 3' of the synthesized sequence.
3.1 construction of expression vectors
The synthesized phytase gene fragment and the pSC1G vector were digested with restriction enzymes KpnI and MluI (Fermentas), respectively, the digested products were purified using a gel purification kit, and the phytase gene and the digested products of the pSC1G vector were ligated with T4 DNA ligase (Fermentas), respectively, and E.coli Trans5 α (Transgen) was transformed, selected with ampicillin, and clones were verified by sequencing (Invitrogen). And (4) obtaining the recombinant plasmid containing the phytase gene after the sequencing is correct.
3.2 construction of recombinant strains of Trichoderma reesei
(1) Protoplast preparation
Taking a host bacterium (Trichoderma reesei) (III)Trichoderma reesei) Inoculating the UE spore suspension on a PDA flat plate, and culturing for 6 days at 30 ℃; after the spore production is rich, cutting a colony of about 1cm multiplied by 1cm into a liquid culture medium containing 120 mL YEG + U (0.5% yeast powder, 1% glucose, 0.1% uridine), and carrying out shake culture at 30 ℃ and 220rpm for 14-16 h;
filtering with sterile gauze to collect mycelium, and washing with sterile water; placing the mycelium in a triangular flask containing 20 mL of 10mg/mL lyase solution (Sigma L1412) and reacting at 30 ℃ and 90 rpm for 1-2 h; observing and detecting the transformation progress of the protoplast by using a microscope;
pre-cooled 20 mL of 1.2M sorbitol (1.2M sorbitol, 50 mM Tris-Cl, 50 mM CaCl)2) Adding into the triangular flask, shaking gently, filtering with sterile Miracloth, collecting filtrate, centrifuging at 3000 rpm and 4 deg.C for 10 min; discarding the supernatant, adding pre-cooled 5mL of 1.2M sorbitol solution to suspend the thalli, and centrifuging at 3000 rpm and 4 ℃ for 10 min; discarding the supernatant, adding appropriate amount of precooled 1.2M sorbitol, suspending and packaging (200. mu.L/tube, protoplast concentration of 10)8one/mL).
(2) Expression vector transformation
The following procedures were performed on ice, and 10. mu.g of the recombinant plasmid constructed above was added to a7 mL sterile centrifuge tube containing 200. mu.L of the protoplast solution, followed by 50. mu.L of 25% PEG (25% PEG, 50 mM Tris-Cl, 50 mM CaCl)2) Mixing the tube bottom, and standing on ice for 20 min; adding 2mL of 25% PEG, uniformly mixing, and standing at room temperature for 5 min; adding 4mL of 1.2M sorbitol, gently mixing, and pouring into the upper culture medium which is melted and kept at 55 ℃; and (3) after gently mixing, paving the mixture on a prepared lower-layer culture medium plate, culturing at 30 ℃ for 5-7 days until transformants grow out, and selecting the grown transformants to the lower-layer culture medium plate for re-screening, wherein the strains with smooth colony edge morphology are positive transformants.
According to the method, the applicant respectively constructs the Trichoderma reesei engineering strain for recombinant expression of the APPA-N0 and the phytase mutant.
(3) Fermentation validation and enzyme activity determination
Respectively inoculating the Trichoderma reesei engineering strains obtained by the construction to a PDA solid plate, carrying out inverted culture in a constant temperature incubator at 30 ℃ for 6-7 days, and respectively inoculating two hypha blocks with the diameter of 1cm to a fermentation medium (containing 50mL of 1.5% of glucose, 1.7% of lactose, 2.5% of corn steep liquor and 0.44% (NH)4)2SO4，0.09%MgSO4，2%KH2PO4，0.04%CaCl20.018% tween-80, 0.018% trace elements) was cultured at 30 ℃ for 48 hours and then at 25 ℃ for 48 hours in a 250mL Erlenmeyer flask. And centrifuging the fermentation liquor to obtain fermentation supernatants respectively containing the phytase APPA-N0 and the phytase mutants.
The method described in example 2 was used to measure phytase activity of the constructed Trichoderma reesei recombinant strain fermentation supernatants.
Example 4 thermal stability analysis
Diluting the fermentation supernatant of the recombinant strain expressing the phytase mutant by 10 times respectively by using 0.25M sodium acetate buffer solution with the pH value of 5.0 and preheated for 10 min; the diluted samples were then treated as follows: treating at 80 deg.C for 5min, treating at 85 deg.C for 5min, sampling at the end, and cooling to room temperature; and respectively measuring the enzyme activity of the phytase of the samples after heat treatment, and calculating the enzyme activity residual rate by taking the enzyme activity of the untreated samples as 100%.
Enzyme activity residual rate (%) = enzyme activity of untreated sample/enzyme activity of sample after heat treatment × 100%.
The results show that after the phytase mutants containing single point mutations of A36P, T111P and A202P provided by the invention are treated for 5min at 80 ℃, the enzyme activity residual rates of the phytase mutants PHY-N1, PHY-N2 and PHY-N3 are respectively improved by 21.2%, 7.4% and 14.3% compared with the phytase APPA-N0; the heat resistance of the phytase mutants PHY-N4, PHY-N5 and PHY-N6 which respectively comprise the combination of two mutation sites A36P/T111P, A36P/A202P and T111P/A202P and the heat resistance of the phytase mutant PHY-N7 which comprises the combination of three mutation sites A36P/T111P/A202P are further improved, and the enzyme activity residual rates of the phytase mutants PHY-N7 are respectively improved by 28.9%, 36.9%, 8.0% and 45.1% compared with the phytase APPA-N0, so that unexpected technical effects are achieved.
After treatment at 85 ℃ for 5min, the enzyme activity residual rates of the phytase mutants PHY-N3 containing A202P single-point mutation, the phytase mutants PHY-N4 and PHY-N5 containing A36P/T111P and A36P/A202P two mutation site combinations respectively and the phytase mutants PHY-N7 containing A36P/T111P/A202P three mutation site combinations are respectively improved by 18.4%, 13.1%, 25.0% and 30.8% compared with the phytase APPA-N0, and unexpected technical effects are achieved.
In conclusion, the mutation sites A36P, T111P and A202P provided by the invention can obviously improve the heat resistance of the phytase, thereby being beneficial to the wide application of the phytase in feed.
Sequence listing
<110> Islands blue biological group Co Ltd
<120> Phytase mutants
<160> 18
<170> SIPOSequenceListing 1.0
<210> 1
<211> 410
<212> PRT
<213> Escherichia coli (Escherichia coli)
<400> 1
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln
50 55 60
Arg Leu Val Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val
100 105 110
His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val Thr Asp Ala Ile
130 135 140
Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 2
<211> 1233
<212> DNA
<213> Escherichia coli (Escherichia coli)
<400> 2
cagagtgagc cggagctgaa gctggaaagt gtggtgattg tcagtcgtca tggtgtgcgt 60
gctccaacca aggccacgca actgatgcag gatgtcaccc cagacgcatg gccaacctgg 120
ccggtaaaac tgggttggct gacaccgcgc ggtggtgagc taatcgccta tctcggacat 180
taccaacgcc agcgtctggt agccgacgga ttgctggcga aaaagggctg cccgcagtct 240
ggtcaggtcg cgattattgc tgatgtcgac gagcgtaccc gtaaaacagg cgaagccttc 300
gccgccgggc tggcacctga ctgtgcaata accgtacata cccaggcaga tacgtccagt 360
cccgatccgt tatttaatcc tctaaaaact ggcgtttgcc aactggataa cgcgaacgtg 420
actgacgcga tcctcagcag ggcaggaggg tcaattgctg actttaccgg gcatcggcaa 480
acggcgtttc gcgaactgga acgggtgctt aattttccgc aatcaaactt gtgccttaaa 540
cgtgagaaac aggacgaaag ctgttcatta acgcaggcat taccatcgga actcaaggtg 600
agcgccgaca atgtctcatt aaccggtgcg gtaagcctcg catcaatgct gacggagata 660
tttctcctgc aacaagcaca gggaatgccg gagccggggt ggggaaggat caccgattca 720
caccagtgga acaccttgct aagtttgcat aacgcgcaat tttatttgct acaacgcacg 780
ccagaggttg cccgcagccg cgccaccccg ttattagatt tgatcaagac agcgttgacg 840
ccccatccac cgcaaaaaca ggcgtatggt gtgacattac ccacttcagt gctgtttatc 900
gccggacacg atactaatct ggcaaatctc ggcggcgcac tggagctcaa ctggacgctt 960
cccggtcagc cggataacac gccgccaggt ggtgaactgg tgtttgaacg ctggcgtcgg 1020
ctaagcgata acagccagtg gattcaggtt tcgctggtct tccagacttt acagcagatg 1080
cgtgataaaa cgccgctgtc attaaatacg ccgcccggag aggtgaaact gaccctggca 1140
ggatgtgaag agcgaaatgc gcagggcatg tgttcgttgg caggttttac gcaaatcgtg 1200
aatgaagcac gcataccggc gtgcagtttg taa 1233
<210> 3
<211> 410
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp Arg Gln
50 55 60
Arg Leu Val Ala Asp Glu Leu Leu Pro Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val
100 105 110
His His Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Val Ala Asn Val Thr Arg Ala Ile
130 135 140
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Asp Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 4
<211> 1230
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
caatctgaac cagaattgaa gttggaatct gttgttattg tttcccgtca cggtgttaga 60
gccccaacta aggctactca attgatgcaa gatgttactc cagatgcttg gccaacttgg 120
ccagttaagt tgggtgaatt gactccaaga ggtggtgaat tgattgctta cttgggtcat 180
tactggagac aaagattggt tgctgatgaa ttgttgccaa agaagggttg tccacaatct 240
ggtcaagttg ctattattgc tgatgttgat gaacgcacta gaaagaccgg tgaggctttt 300
gctgctggtt tggctccaga ttgtgctatt actgttcatc atcaagctga tacttcttcc 360
ccagatccat tgtttaaccc attgaagact ggtgtttgtc aattggatgt tgctaacgtt 420
actagagcta ttttggaaag agctggtggt tctattgctg attttactgg tcattaccaa 480
accgcctttc gtgaattgga aagagttttg aactttccac aatccaactt gtgtttgaag 540
agagaaaagc aagatgagtc ctgttccttg acccaagctc ttccatctga attgaaggtt 600
tctgctgata acgtttcttt gactggtgct gtttctttgg cttctatgtt gactgaaatt 660
ttcttgttgc agcaggctca aggtatgcca gaaccaggtt ggggtagaat tactgattct 720
catcaatgga acactttgtt gtctttgcat aacgctcaat ttgacttgtt gcaaagaact 780
ccagaagttg ctagatctag agctactcca ttgttggatt tgattaagac tgctttgact 840
ccacatccac cacaaaagca ggcttacggt gttactttgc caacttctgt tttgtttatt 900
gccggtcatg ataccaactt ggctaacttg ggtggtgctt tggaattgaa ctggactttg 960
ccaggtcaac cagataacac tccaccaggt ggtgaattgg tttttgaaag atggagaaga 1020
ttgtccgata actctcaatg gattcaagtt tctttggtct ttcagacctt gcagcaaatg 1080
agagataaga ctccattgtc tttgaacact ccaccaggtg aagttaagtt gactttggct 1140
ggttgtgaag aaagaaacgc tcaaggtatg tgttctttgg ctggttttac tcaaattgtc 1200
aacgaggcta gaatcccagc ttgttctttg 1230
<210> 5
<211> 410
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 5
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Pro Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp Arg Gln
50 55 60
Arg Leu Val Ala Asp Glu Leu Leu Pro Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val
100 105 110
His His Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Val Ala Asn Val Thr Arg Ala Ile
130 135 140
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Asp Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 6
<211> 1230
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
caatctgaac cagaattgaa gttggaatct gttgttattg tttcccgtca cggtgttaga 60
gccccaacta aggctactca attgatgcaa gatgttactc cagatccatg gccaacttgg 120
ccagttaagt tgggtgaatt gactccaaga ggtggtgaat tgattgctta cttgggtcat 180
tactggagac aaagattggt tgctgatgaa ttgttgccaa agaagggttg tccacaatct 240
ggtcaagttg ctattattgc tgatgttgat gaacgcacta gaaagaccgg tgaggctttt 300
gctgctggtt tggctccaga ttgtgctatt actgttcatc atcaagctga tacttcttcc 360
ccagatccat tgtttaaccc attgaagact ggtgtttgtc aattggatgt tgctaacgtt 420
actagagcta ttttggaaag agctggtggt tctattgctg attttactgg tcattaccaa 480
accgcctttc gtgaattgga aagagttttg aactttccac aatccaactt gtgtttgaag 540
agagaaaagc aagatgagtc ctgttccttg acccaagctc ttccatctga attgaaggtt 600
tctgctgata acgtttcttt gactggtgct gtttctttgg cttctatgtt gactgaaatt 660
ttcttgttgc agcaggctca aggtatgcca gaaccaggtt ggggtagaat tactgattct 720
catcaatgga acactttgtt gtctttgcat aacgctcaat ttgacttgtt gcaaagaact 780
ccagaagttg ctagatctag agctactcca ttgttggatt tgattaagac tgctttgact 840
ccacatccac cacaaaagca ggcttacggt gttactttgc caacttctgt tttgtttatt 900
gccggtcatg ataccaactt ggctaacttg ggtggtgctt tggaattgaa ctggactttg 960
ccaggtcaac cagataacac tccaccaggt ggtgaattgg tttttgaaag atggagaaga 1020
ttgtccgata actctcaatg gattcaagtt tctttggtct ttcagacctt gcagcaaatg 1080
agagataaga ctccattgtc tttgaacact ccaccaggtg aagttaagtt gactttggct 1140
ggttgtgaag aaagaaacgc tcaaggtatg tgttctttgg ctggttttac tcaaattgtc 1200
aacgaggcta gaatcccagc ttgttctttg 1230
<210> 7
<211> 410
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 7
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp Arg Gln
50 55 60
Arg Leu Val Ala Asp Glu Leu Leu Pro Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Pro Val
100 105 110
His His Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Val Ala Asn Val Thr Arg Ala Ile
130 135 140
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Asp Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 8
<211> 1230
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
caatctgaac cagaattgaa gttggaatct gttgttattg tttcccgtca cggtgttaga 60
gccccaacta aggctactca attgatgcaa gatgttactc cagatgcttg gccaacttgg 120
ccagttaagt tgggtgaatt gactccaaga ggtggtgaat tgattgctta cttgggtcat 180
tactggagac aaagattggt tgctgatgaa ttgttgccaa agaagggttg tccacaatct 240
ggtcaagttg ctattattgc tgatgttgat gaacgcacta gaaagaccgg tgaggctttt 300
gctgctggtt tggctccaga ttgtgctatt ccagttcatc atcaagctga tacttcttcc 360
ccagatccat tgtttaaccc attgaagact ggtgtttgtc aattggatgt tgctaacgtt 420
actagagcta ttttggaaag agctggtggt tctattgctg attttactgg tcattaccaa 480
accgcctttc gtgaattgga aagagttttg aactttccac aatccaactt gtgtttgaag 540
agagaaaagc aagatgagtc ctgttccttg acccaagctc ttccatctga attgaaggtt 600
tctgctgata acgtttcttt gactggtgct gtttctttgg cttctatgtt gactgaaatt 660
ttcttgttgc agcaggctca aggtatgcca gaaccaggtt ggggtagaat tactgattct 720
catcaatgga acactttgtt gtctttgcat aacgctcaat ttgacttgtt gcaaagaact 780
ccagaagttg ctagatctag agctactcca ttgttggatt tgattaagac tgctttgact 840
ccacatccac cacaaaagca ggcttacggt gttactttgc caacttctgt tttgtttatt 900
gccggtcatg ataccaactt ggctaacttg ggtggtgctt tggaattgaa ctggactttg 960
ccaggtcaac cagataacac tccaccaggt ggtgaattgg tttttgaaag atggagaaga 1020
ttgtccgata actctcaatg gattcaagtt tctttggtct ttcagacctt gcagcaaatg 1080
agagataaga ctccattgtc tttgaacact ccaccaggtg aagttaagtt gactttggct 1140
ggttgtgaag aaagaaacgc tcaaggtatg tgttctttgg ctggttttac tcaaattgtc 1200
aacgaggcta gaatcccagc ttgttctttg 1230
<210> 9
<211> 410
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 9
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp Arg Gln
50 55 60
Arg Leu Val Ala Asp Glu Leu Leu Pro Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val
100 105 110
His His Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Val Ala Asn Val Thr Arg Ala Ile
130 135 140
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Pro Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Asp Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 10
<211> 1230
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
caatctgaac cagaattgaa gttggaatct gttgttattg tttcccgtca cggtgttaga 60
gccccaacta aggctactca attgatgcaa gatgttactc cagatgcttg gccaacttgg 120
ccagttaagt tgggtgaatt gactccaaga ggtggtgaat tgattgctta cttgggtcat 180
tactggagac aaagattggt tgctgatgaa ttgttgccaa agaagggttg tccacaatct 240
ggtcaagttg ctattattgc tgatgttgat gaacgcacta gaaagaccgg tgaggctttt 300
gctgctggtt tggctccaga ttgtgctatt actgttcatc atcaagctga tacttcttcc 360
ccagatccat tgtttaaccc attgaagact ggtgtttgtc aattggatgt tgctaacgtt 420
actagagcta ttttggaaag agctggtggt tctattgctg attttactgg tcattaccaa 480
accgcctttc gtgaattgga aagagttttg aactttccac aatccaactt gtgtttgaag 540
agagaaaagc aagatgagtc ctgttccttg acccaagctc ttccatctga attgaaggtt 600
tctccagata acgtttcttt gactggtgct gtttctttgg cttctatgtt gactgaaatt 660
ttcttgttgc agcaggctca aggtatgcca gaaccaggtt ggggtagaat tactgattct 720
catcaatgga acactttgtt gtctttgcat aacgctcaat ttgacttgtt gcaaagaact 780
ccagaagttg ctagatctag agctactcca ttgttggatt tgattaagac tgctttgact 840
ccacatccac cacaaaagca ggcttacggt gttactttgc caacttctgt tttgtttatt 900
gccggtcatg ataccaactt ggctaacttg ggtggtgctt tggaattgaa ctggactttg 960
ccaggtcaac cagataacac tccaccaggt ggtgaattgg tttttgaaag atggagaaga 1020
ttgtccgata actctcaatg gattcaagtt tctttggtct ttcagacctt gcagcaaatg 1080
agagataaga ctccattgtc tttgaacact ccaccaggtg aagttaagtt gactttggct 1140
ggttgtgaag aaagaaacgc tcaaggtatg tgttctttgg ctggttttac tcaaattgtc 1200
aacgaggcta gaatcccagc ttgttctttg 1230
<210> 11
<211> 410
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 11
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Pro Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp Arg Gln
50 55 60
Arg Leu Val Ala Asp Glu Leu Leu Pro Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Pro Val
100 105 110
His His Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Val Ala Asn Val Thr Arg Ala Ile
130 135 140
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Asp Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 12
<211> 1230
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
caatctgaac cagaattgaa gttggaatct gttgttattg tttcccgtca cggtgttaga 60
gccccaacta aggctactca attgatgcaa gatgttactc cagatccatg gccaacttgg 120
ccagttaagt tgggtgaatt gactccaaga ggtggtgaat tgattgctta cttgggtcat 180
tactggagac aaagattggt tgctgatgaa ttgttgccaa agaagggttg tccacaatct 240
ggtcaagttg ctattattgc tgatgttgat gaacgcacta gaaagaccgg tgaggctttt 300
gctgctggtt tggctccaga ttgtgctatt ccagttcatc atcaagctga tacttcttcc 360
ccagatccat tgtttaaccc attgaagact ggtgtttgtc aattggatgt tgctaacgtt 420
actagagcta ttttggaaag agctggtggt tctattgctg attttactgg tcattaccaa 480
accgcctttc gtgaattgga aagagttttg aactttccac aatccaactt gtgtttgaag 540
agagaaaagc aagatgagtc ctgttccttg acccaagctc ttccatctga attgaaggtt 600
tctgctgata acgtttcttt gactggtgct gtttctttgg cttctatgtt gactgaaatt 660
ttcttgttgc agcaggctca aggtatgcca gaaccaggtt ggggtagaat tactgattct 720
catcaatgga acactttgtt gtctttgcat aacgctcaat ttgacttgtt gcaaagaact 780
ccagaagttg ctagatctag agctactcca ttgttggatt tgattaagac tgctttgact 840
ccacatccac cacaaaagca ggcttacggt gttactttgc caacttctgt tttgtttatt 900
gccggtcatg ataccaactt ggctaacttg ggtggtgctt tggaattgaa ctggactttg 960
ccaggtcaac cagataacac tccaccaggt ggtgaattgg tttttgaaag atggagaaga 1020
ttgtccgata actctcaatg gattcaagtt tctttggtct ttcagacctt gcagcaaatg 1080
agagataaga ctccattgtc tttgaacact ccaccaggtg aagttaagtt gactttggct 1140
ggttgtgaag aaagaaacgc tcaaggtatg tgttctttgg ctggttttac tcaaattgtc 1200
aacgaggcta gaatcccagc ttgttctttg 1230
<210> 13
<211> 410
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 13
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Pro Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp Arg Gln
50 55 60
Arg Leu Val Ala Asp Glu Leu Leu Pro Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val
100 105 110
His His Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Val Ala Asn Val Thr Arg Ala Ile
130 135 140
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Pro Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Asp Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 14
<211> 1230
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
caatctgaac cagaattgaa gttggaatct gttgttattg tttcccgtca cggtgttaga 60
gccccaacta aggctactca attgatgcaa gatgttactc cagatccatg gccaacttgg 120
ccagttaagt tgggtgaatt gactccaaga ggtggtgaat tgattgctta cttgggtcat 180
tactggagac aaagattggt tgctgatgaa ttgttgccaa agaagggttg tccacaatct 240
ggtcaagttg ctattattgc tgatgttgat gaacgcacta gaaagaccgg tgaggctttt 300
gctgctggtt tggctccaga ttgtgctatt actgttcatc atcaagctga tacttcttcc 360
ccagatccat tgtttaaccc attgaagact ggtgtttgtc aattggatgt tgctaacgtt 420
actagagcta ttttggaaag agctggtggt tctattgctg attttactgg tcattaccaa 480
accgcctttc gtgaattgga aagagttttg aactttccac aatccaactt gtgtttgaag 540
agagaaaagc aagatgagtc ctgttccttg acccaagctc ttccatctga attgaaggtt 600
tctccagata acgtttcttt gactggtgct gtttctttgg cttctatgtt gactgaaatt 660
ttcttgttgc agcaggctca aggtatgcca gaaccaggtt ggggtagaat tactgattct 720
catcaatgga acactttgtt gtctttgcat aacgctcaat ttgacttgtt gcaaagaact 780
ccagaagttg ctagatctag agctactcca ttgttggatt tgattaagac tgctttgact 840
ccacatccac cacaaaagca ggcttacggt gttactttgc caacttctgt tttgtttatt 900
gccggtcatg ataccaactt ggctaacttg ggtggtgctt tggaattgaa ctggactttg 960
ccaggtcaac cagataacac tccaccaggt ggtgaattgg tttttgaaag atggagaaga 1020
ttgtccgata actctcaatg gattcaagtt tctttggtct ttcagacctt gcagcaaatg 1080
agagataaga ctccattgtc tttgaacact ccaccaggtg aagttaagtt gactttggct 1140
ggttgtgaag aaagaaacgc tcaaggtatg tgttctttgg ctggttttac tcaaattgtc 1200
aacgaggcta gaatcccagc ttgttctttg 1230
<210> 15
<211> 410
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 15
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp Arg Gln
50 55 60
Arg Leu Val Ala Asp Glu Leu Leu Pro Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Pro Val
100 105 110
His His Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Val Ala Asn Val Thr Arg Ala Ile
130 135 140
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Pro Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Asp Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 16
<211> 1230
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
caatctgaac cagaattgaa gttggaatct gttgttattg tttcccgtca cggtgttaga 60
gccccaacta aggctactca attgatgcaa gatgttactc cagatgcttg gccaacttgg 120
ccagttaagt tgggtgaatt gactccaaga ggtggtgaat tgattgctta cttgggtcat 180
tactggagac aaagattggt tgctgatgaa ttgttgccaa agaagggttg tccacaatct 240
ggtcaagttg ctattattgc tgatgttgat gaacgcacta gaaagaccgg tgaggctttt 300
gctgctggtt tggctccaga ttgtgctatt ccagttcatc atcaagctga tacttcttcc 360
ccagatccat tgtttaaccc attgaagact ggtgtttgtc aattggatgt tgctaacgtt 420
actagagcta ttttggaaag agctggtggt tctattgctg attttactgg tcattaccaa 480
accgcctttc gtgaattgga aagagttttg aactttccac aatccaactt gtgtttgaag 540
agagaaaagc aagatgagtc ctgttccttg acccaagctc ttccatctga attgaaggtt 600
tctccagata acgtttcttt gactggtgct gtttctttgg cttctatgtt gactgaaatt 660
ttcttgttgc agcaggctca aggtatgcca gaaccaggtt ggggtagaat tactgattct 720
catcaatgga acactttgtt gtctttgcat aacgctcaat ttgacttgtt gcaaagaact 780
ccagaagttg ctagatctag agctactcca ttgttggatt tgattaagac tgctttgact 840
ccacatccac cacaaaagca ggcttacggt gttactttgc caacttctgt tttgtttatt 900
gccggtcatg ataccaactt ggctaacttg ggtggtgctt tggaattgaa ctggactttg 960
ccaggtcaac cagataacac tccaccaggt ggtgaattgg tttttgaaag atggagaaga 1020
ttgtccgata actctcaatg gattcaagtt tctttggtct ttcagacctt gcagcaaatg 1080
agagataaga ctccattgtc tttgaacact ccaccaggtg aagttaagtt gactttggct 1140
ggttgtgaag aaagaaacgc tcaaggtatg tgttctttgg ctggttttac tcaaattgtc 1200
aacgaggcta gaatcccagc ttgttctttg 1230
<210> 17
<211> 410
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 17
Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg
1 5 10 15
His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val
20 25 30
Thr Pro Asp Pro Trp Pro Thr Trp Pro Val Lys Leu Gly Glu Leu Thr
35 40 45
Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Trp Arg Gln
50 55 60
Arg Leu Val Ala Asp Glu Leu Leu Pro Lys Lys Gly Cys Pro Gln Ser
65 70 75 80
Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr
85 90 95
Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Pro Val
100 105 110
His His Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu
115 120 125
Lys Thr Gly Val Cys Gln Leu Asp Val Ala Asn Val Thr Arg Ala Ile
130 135 140
Leu Glu Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Tyr Gln
145 150 155 160
Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn
165 170 175
Leu Cys Leu Lys Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln
180 185 190
Ala Leu Pro Ser Glu Leu Lys Val Ser Pro Asp Asn Val Ser Leu Thr
195 200 205
Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln
210 215 220
Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser
225 230 235 240
His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Asp Leu
245 250 255
Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu
260 265 270
Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala
275 280 285
Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp
290 295 300
Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu
305 310 315 320
Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu
325 330 335
Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu
340 345 350
Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu
355 360 365
Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu
370 375 380
Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val
385 390 395 400
Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu
405 410
<210> 18
<211> 1230
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
caatctgaac cagaattgaa gttggaatct gttgttattg tttcccgtca cggtgttaga 60
gccccaacta aggctactca attgatgcaa gatgttactc cagatccatg gccaacttgg 120
ccagttaagt tgggtgaatt gactccaaga ggtggtgaat tgattgctta cttgggtcat 180
tactggagac aaagattggt tgctgatgaa ttgttgccaa agaagggttg tccacaatct 240
ggtcaagttg ctattattgc tgatgttgat gaacgcacta gaaagaccgg tgaggctttt 300
gctgctggtt tggctccaga ttgtgctatt ccagttcatc atcaagctga tacttcttcc 360
ccagatccat tgtttaaccc attgaagact ggtgtttgtc aattggatgt tgctaacgtt 420
actagagcta ttttggaaag agctggtggt tctattgctg attttactgg tcattaccaa 480
accgcctttc gtgaattgga aagagttttg aactttccac aatccaactt gtgtttgaag 540
agagaaaagc aagatgagtc ctgttccttg acccaagctc ttccatctga attgaaggtt 600
tctccagata acgtttcttt gactggtgct gtttctttgg cttctatgtt gactgaaatt 660
ttcttgttgc agcaggctca aggtatgcca gaaccaggtt ggggtagaat tactgattct 720
catcaatgga acactttgtt gtctttgcat aacgctcaat ttgacttgtt gcaaagaact 780
ccagaagttg ctagatctag agctactcca ttgttggatt tgattaagac tgctttgact 840
ccacatccac cacaaaagca ggcttacggt gttactttgc caacttctgt tttgtttatt 900
gccggtcatg ataccaactt ggctaacttg ggtggtgctt tggaattgaa ctggactttg 960
ccaggtcaac cagataacac tccaccaggt ggtgaattgg tttttgaaag atggagaaga 1020
ttgtccgata actctcaatg gattcaagtt tctttggtct ttcagacctt gcagcaaatg 1080
agagataaga ctccattgtc tttgaacact ccaccaggtg aagttaagtt gactttggct 1140
ggttgtgaag aaagaaacgc tcaaggtatg tgttctttgg ctggttttac tcaaattgtc 1200
aacgaggcta gaatcccagc ttgttctttg 1230

Claims (8)

1. A phytase mutant comprising an amino acid sequence having at least 90% identity to SEQ ID No. 3 and comprising an amino acid substitution at least one position selected from the group consisting of SEQ ID No. 3: 36, 111, 202.
2. The mutant of claim 1, wherein the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity to SEQ ID No. 3.
3. The mutant of claim 1, wherein the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity to SEQ ID No. 3.
4. The mutant according to claim 1, wherein the mutant comprises a substitution of at least one amino acid of the group consisting of: a36P, T111P, a 202P.
5. The mutant according to claim 4, which comprises a substitution or a combination of substitutions selected from the following substitutions and combinations of substitutions: A36P, T111P, A202P, A36P/T111P, A36P/A202P, T111P/A202P, A36P/T111P/A202P.
6. A DNA molecule encoding a phytase mutant according to any one of claims 1-5.
7. A vector having the DNA molecule of claim 6.
8. A host cell comprising the vector of claim 7.
CN202110496409.7A 2020-05-22 2021-05-07 Phytase mutants Active CN113717959B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/CN2021/093532 WO2021233193A1 (en) 2020-05-22 2021-05-13 Phytase mutant

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2020104438824 2020-05-22
CN202010443882 2020-05-22

Publications (2)

Publication Number Publication Date
CN113717959A true CN113717959A (en) 2021-11-30
CN113717959B CN113717959B (en) 2024-04-02

Family

ID=78672730

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110496409.7A Active CN113717959B (en) 2020-05-22 2021-05-07 Phytase mutants

Country Status (2)

Country Link
CN (1) CN113717959B (en)
WO (1) WO2021233193A1 (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2003270969A1 (en) * 1998-03-23 2004-01-22 Novozymes A/S Phytase Variants
US20110041221A1 (en) * 2007-12-03 2011-02-17 Syngenta Participations Ag Engineering enzymatically susceptible phytases
CN106047836A (en) * 2016-06-15 2016-10-26 昆明爱科特生物科技有限公司 Phytase mutant and preparation method and application thereof
CN107164344A (en) * 2017-06-28 2017-09-15 青岛红樱桃生物技术有限公司 One class heat-resistance phytase mutant and its encoding gene and application
CN107236717A (en) * 2016-03-28 2017-10-10 青岛蔚蓝生物集团有限公司 Phytic acid enzyme mutant

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7078035B2 (en) * 1997-08-13 2006-07-18 Diversa Corporation Phytases, nucleic acids encoding them and methods for making and using them
AU8126201A (en) * 2000-08-11 2002-02-25 Us Health Use of a transgene encoding a vertebrate phytase to increase capacity to utilizephytic acid in livestock feed
KR101692103B1 (en) * 2011-04-21 2017-01-02 바스프 에스이 Synthetic phytase variants
CN105441406A (en) * 2014-08-05 2016-03-30 北京大学 Phytase variant
WO2018004627A1 (en) * 2016-06-30 2018-01-04 Fornia Biosolutions, Inc. Novel phytases and uses thereof
CN107858364B (en) * 2017-12-04 2023-01-06 上海市农业科学院 High-temperature-resistant high-specific-activity bacterial phytase gene suitable for methanol yeast expression

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2003270969A1 (en) * 1998-03-23 2004-01-22 Novozymes A/S Phytase Variants
US20110041221A1 (en) * 2007-12-03 2011-02-17 Syngenta Participations Ag Engineering enzymatically susceptible phytases
CN107236717A (en) * 2016-03-28 2017-10-10 青岛蔚蓝生物集团有限公司 Phytic acid enzyme mutant
CN106047836A (en) * 2016-06-15 2016-10-26 昆明爱科特生物科技有限公司 Phytase mutant and preparation method and application thereof
CN107164344A (en) * 2017-06-28 2017-09-15 青岛红樱桃生物技术有限公司 One class heat-resistance phytase mutant and its encoding gene and application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LI JIADI 等: "Evolution of E. coli Phytase for Increased Thermostability Guided by Rational Parameters", J. MICROBIOL. BIOTECHNOL, vol. 29, no. 3, pages 419 - 428, XP055975773, DOI: 10.4014/jmb.1811.11017 *

Also Published As

Publication number Publication date
CN113717959B (en) 2024-04-02
WO2021233193A1 (en) 2021-11-25

Similar Documents

Publication Publication Date Title
CN107236717B (en) Phytase mutant
US11739336B2 (en) Phytase mutants
CN113699134B (en) Phytase mutants
US20220154154A1 (en) Phytase mutant
CN110029120B (en) Phytase high-yield strain and application thereof
CN110527674A (en) Polypeptide, its polynucleotides of separation, and the additive comprising polypeptide, its purposes and method
CN107488642B (en) Phytase mutant and application thereof
CN113717958B (en) Phytase mutant with improved specific activity
CN111635895B (en) Phytase mutant
CN113717959B (en) Phytase mutants
CN115838706A (en) High temperature resistant mannanase mutant
WO2020063267A1 (en) Phytase mutant
CN115029335A (en) High-temperature-resistant xylanase mutant and application thereof
CN111218436B (en) Phytase mutant
CN107446832B (en) Pichia pastoris engineering bacterium for high-yield heat-resistant phytase
WO2020063268A1 (en) Phytase mutant
CN115094050A (en) Neutral phytase mutant and application thereof
CN115094049A (en) High-temperature-resistant neutral phytase mutant
CN116121222A (en) Neutral phytase mutant and application thereof
CN118086257A (en) Alpha-galactosidase mutants
CN114736886A (en) Phytase mutant and preparation method thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant