CN113717266B - Osnop2 protein and application of encoding gene thereof in relation to stress tolerance and yield - Google Patents

Abstract

The invention discloses an Osnop2 protein and application of a coding gene thereof in relation to stress tolerance and yield. The invention protects an application of Osnop2 protein in regulating stress tolerance of plants. The invention also protects the application of the substances for inhibiting the Osnop2 genes and/or the substances for inhibiting the Osnop2 proteins in plant breeding, wherein the breeding targets are as follows: plants with enhanced stress tolerance are cultivated. The invention also protects the application of the substances for inhibiting the Osnop2 genes and/or the substances for inhibiting the Osnop2 proteins in plant breeding, wherein the breeding targets are as follows: cultivating plants with enhanced yield traits. The invention can be used for improving plant properties and has great application and popularization values for plant breeding, especially rice breeding.

Description

Osnop2 protein and application of encoding gene thereof in relation to stress tolerance and yield

Technical Field

The invention belongs to the technical field of biology, and relates to an Osnop2 protein and application of a coding gene thereof in relation to stress tolerance and yield.

Background

Rice is native to China and India. Is one of the main grain crops in the world. The Chinese rice sowing surface accounts for 1/4 of the national grain crops, and the yield accounts for more than half of the yield. The cultivation history has been 14000-18000 years. Is an important grain crop; besides the edible caryopsis, the rice bran can be used for preparing starch, brewing wine and vinegar, and the rice bran can be used for preparing sugar, extracting oil and extracting furfural for industrial and medical use; the rice stalks are good feed, papermaking raw materials and weaving materials, and the rice sprouts and the rice roots can be used for medical purposes.

In recent years, the rapid development of biotechnology has greatly promoted the innovation of plant breeding research means and the continuous improvement of research level, and plant disease and insect resistance and herbicide resistance biotechnology breeding have begun to enter into the practical stage. Exogenous insecticidal herbicide-resistant genes are introduced into plant genome by biotechnology means, natural barriers which are difficult to hybridize among plant species are broken, and transfer of the insecticidal herbicide-resistant genes is realized, so that the plants can rapidly and directionally obtain insect resistance and mechanical weeding, and meanwhile, the original good agronomic characters can be maintained. Because each plant of the transgenic corn has a considerable degree of resistance, the pest and herbicide resistance effect is better and more stable than the artificial control effect, the investment of manpower and material resources can be saved, and the social resources can be effectively saved. Other transgenic plants with improved agronomic traits are less ideal than insect-resistant and herbicide-resistant traits in development and application, mainly because of the lack of excellent trait improvement genes, and most agronomic traits are mainly caused by slightly effective multi-gene control, and no ideal genes are operated all the time.

Disclosure of Invention

The invention aims to provide an Osnop2 protein and application of a coding gene thereof in relation to stress tolerance and yield.

The invention protects an application of Osnop2 protein in regulating stress tolerance of plants.

The regulation is negative regulation, namely, the Osnop2 protein content is increased, and the stress tolerance of plants is reduced.

The regulation is negative regulation, namely, the Osnop2 protein content is reduced, and the stress tolerance of the plant is enhanced.

The invention also protects the application of the substances for inhibiting the Osnop2 genes and/or the substances for inhibiting the Osnop2 proteins in plant breeding, wherein the breeding targets are as follows: plants with enhanced stress tolerance are cultivated.

The invention also provides a plant breeding method for cultivating stress tolerance enhanced plants, comprising the following steps: performing gene editing on the Osnop2 gene in the receptor plant to obtain a gene editing plant; the stress tolerance of the gene editing plant is enhanced compared to the recipient plant.

The invention also protects the application of the Osnop2 protein in regulating and controlling the plant yield traits.

The regulation is negative regulation, namely, the Osnop2 protein content is increased, and the yield traits of plants are reduced.

The regulation is negative regulation, namely, the Osnop2 protein content is reduced, and the yield traits of plants are enhanced.

The invention also protects the application of the substances for inhibiting the Osnop2 genes and/or the substances for inhibiting the Osnop2 proteins in plant breeding, wherein the breeding targets are as follows: cultivating plants with enhanced yield traits.

The invention also provides a plant breeding method for cultivating plants with enhanced yield traits, comprising the following steps: performing gene editing on the Osnop2 gene in the receptor plant to obtain a gene editing plant; the gene editing plant has enhanced yield traits compared with the recipient plant.

Any of the above-described inhibiting the Osnop2 gene is inhibiting the activity of the Osnop2 gene and/or reducing the abundance of the Osnop2 gene. Decreasing the abundance of the Osnop2 gene can be achieved by disabling transcription of the RNA. The reduction of the abundance of the Osnop2 gene can be achieved by gene editing. The gene editing may specifically be a Cas9 system-based gene editing. In the Cas9 system, the target sequence binding region in the sgRNA is shown as a sequence 7 in a sequence table. In the Cas9 system, sgRNA is shown as a sequence 6 in a sequence table. The gene editing is specifically realized by introducing a recombinant plasmid SG2027 into plants.

Any of the above-described inhibition of an Osnop2 protein is inhibition of the activity of an Osnop2 protein and/or reduction of the abundance of an Osnop2 protein. The reduction in the abundance of the Osnop2 protein may be achieved by disabling the expression of the Osnop2 protein.

Any of the above gene edits may specifically be Cas9 system-based gene edits. Substances that gene-edit the Osnop2 gene can specifically be sgrnas and Cas9 proteins. The substances that perform gene editing on the Osnop2 gene may specifically be a DNA molecule encoding sgRNA and a DNA molecule encoding Cas9 protein. The substances that carry out gene editing on the Osnop2 gene may specifically be an expression vector having a DNA molecule encoding sgRNA and an expression vector having a DNA molecule encoding Cas9 protein. The substance for gene editing of the Osnop2 gene may specifically be an expression vector having a DNA molecule encoding sgRNA and a DNA molecule encoding Cas9 protein. The target sequence binding region in the sgRNA is shown as a sequence 7 in a sequence table. The sgRNA is shown as a sequence 6 in a sequence table. The DNA molecule for coding the sgRNA is shown as a sequence 5 in a sequence table. The material for gene editing of the Osnop2 gene is specifically recombinant plasmid SG2027.

The invention also provides a method for preparing the plant with enhanced stress tolerance, which comprises the following steps of replacing 'TCGGACGACGCCTCCTTTG' in the Osnop2 gene in plant genome DNA with 'TCGGACGACGCCTCCTTG' or 'TCGGACGACGCCTCCTTTTGG', so as to obtain the plant with enhanced stress tolerance.

The substitutions are homozygous substitutions, i.e., identical substitutions occur in homologous chromosomes.

The present invention also provides a method for preparing a plant with enhanced yield traits comprising the step of replacing "TCGGACGACGCCTCCTTTG" in the Osnop2 gene in plant genomic DNA with "TCGGACGACGCCTCCTTG" or "TCGGACGACGCCTCCTTTTGG" to obtain a plant with enhanced yield traits.

The substitutions are homozygous substitutions, i.e., identical substitutions occur in homologous chromosomes.

The stress tolerance is stress tolerance to heat stress and/or stress tolerance to salt stress.

The yield trait enhancement is embodied as at least one or any combination of the following: increased ear length, increased secondary stem number, increased ear grain number, increased grain weight, increased grain length and increased grain width.

Any one of the above Osnop2 proteins is (a 1) or (a 2) or (a 3) or (a 4) as follows:

(a1) Protein shown in a sequence 1 in a sequence table;

(a2) A fusion protein obtained by connecting a tag to the N-terminal or/and the C-terminal of the protein of (a 1);

(a3) A protein related to plant stress tolerance obtained by substitution and/or deletion and/or addition of one or more amino acid residues in the step (a 1);

(a4) A protein derived from rice and having 98% or more identity with (a 1) and being related to plant stress tolerance.

Any of the above described Osnop2 genes is a gene encoding an Osnop2 protein.

Any of the above Osnop2 genes is (b 1) or (b 2) or (b 3) or (b 4) as follows:

(b1) A DNA molecule with a coding region shown as a sequence 2 in a sequence table;

(b2) DNA molecules shown in a sequence 3 in a sequence table;

(b3) A DNA molecule derived from rice and having 95% or more identity to (b 1) or (b 2) and encoding said protein;

(b4) A DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in (b 1) or (b 2) and which encodes said protein.

Any one of the Cas9 proteins is a protein coded by 2696 th-6967 th nucleotide in a sequence 4 of a sequence table.

Any recombinant plasmid SG2027 is shown as a sequence 4 in a sequence table.

Any of the above plants is a monocotyledonous plant or a dicotyledonous plant. Any of the above plants is a gramineous plant. Any of the above plants is a oryza plant. Any of the above plants is rice, for example, rice Nipponbare.

The invention can be used for improving plant properties and has great application and popularization values for plant breeding, especially rice breeding.

Drawings

FIG. 1 is a schematic diagram of the structure of recombinant plasmid SG2027.

FIG. 2 shows the sequencing results of the mutant sites and their surrounding nucleotides of Osnop2#1 plants and Osnop2#2 plants.

FIG. 3 shows ear phenotypes of different strains of osnop2 and complementary materials.

FIG. 4 shows spike length statistics for different strains of osnop2 and complementary materials.

FIG. 5 is a graph showing statistics of the number of primary and secondary shoots of different strains of osnop2 and complementary materials.

FIG. 6 is a plot of statistics of the number of grains per ear for different strains of osnop2 and complementary materials.

FIG. 7 is a graph showing the statistics of thousand kernel weights of different strains of osnop2 and complementary materials.

FIG. 8 shows the shelled grain length and grain width phenotypes of different strains of osnop2 and complementary materials.

FIG. 9 shows the phenotype of the different strains of osnop2 and the grain length and grain width of the uncoating of the complementary material.

FIG. 10 is a plot of the statistics of the shelled grain length and grain width of different strains of osnop2 and complementary materials.

FIG. 11 is a plot of statistics of the grain length and grain width of the dehulled grains of the different strains of osnop2 and the complementary materials.

FIG. 12 is a graph showing heat stress phenotypes and statistics of different strains of osnop 2.

FIG. 13 is a salt stress phenotype and statistical plot of osnop2#1 and its complement.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Unless otherwise indicated, the quantitative tests in the examples below were all performed in triplicate, and the results averaged.

Examples

The Osnop2 protein is shown as a sequence 1 in a sequence table. In the cDNA of rice Japanese sunny, the CDS of the encoding Osnop2 protein is shown as a sequence 2 of a sequence table. In the genomic DNA of rice Japanese sunny, the gene for encoding the Osnop2 protein is shown as a sequence 3 in a sequence table.

1. Construction of recombinant plasmids

Recombinant plasmid SG2027 was constructed. The structural schematic of recombinant plasmid SG2027 is shown in FIG. 1. And through whole plasmid sequencing, the recombinant plasmid SG2027 is shown as a sequence 4 of a sequence table. In the sequence 4 of the sequence table, 2696-6967 th nucleotide codes Cas9 protein. In the recombinant plasmid SG2027, the coding region of the sgRNA is shown as a sequence 5 of a sequence table. Correspondingly, the sgRNA is shown as a sequence 6 in a sequence table, and a target sequence binding region in the sgRNA is shown as a sequence 7 in the sequence table.

2. Genetic transformation is carried out and regenerated plants are obtained

Recombinant plasmid SG2027 was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium. The method comprises the steps of adopting an agrobacterium dip method to carry out genetic transformation on embryogenic callus of rice Japanese sunny by recombinant agrobacterium, then screening resistant callus (100 mg/L hygromycin is adopted for resistance screening), carrying out differentiation regeneration culture, and then carrying out rooting culture to obtain regenerated plants.

3. Obtaining a gene editing plant and a progeny plant thereof

And (3) identifying the regenerated plant obtained in the step two as follows: taking leaves, extracting genome DNA, carrying out PCR amplification by adopting a primer pair consisting of a primer F1 and a primer R1, and sequencing PCR amplification products.

F1：5’-GCGGGGAAGAAGGGGAAG-3’；

R1：5’-TAGCTCGCGTGAATGCTACA-3’。

Through the above identification, two homozygous mutant plants (homozygous mutant, i.e., two chromosomes are identical) were selected from the regenerated plants obtained in the second step, and designated as Osnop2#1 plants and Osnop2#2 plants, respectively. Sequencing identified that the Osnop2#1 plant differed from the genomic DNA of rice Nippon (expressed by Nip) only in that a deletion of one nucleotide occurred in the gene encoding the Osnop2 protein (a frame shift mutation was caused and terminated in advance), the sequencing results of the mutation site and its surrounding nucleotides were shown in FIG. 2. Sequencing identified, compared with genomic DNA of rice Nippon (expressed by Nip), osnop2#2 plants were different only in that two nucleotide insertions (causing frame shift mutation and premature termination) occurred in the gene encoding the Osnop2 protein, and the sequencing results of the mutation site and its surrounding nucleotides are shown in FIG. 2.

The Osnop2#1 plant is selfed and seeds are harvested, and the seeds are cultivated into plants, namely T1 generation plants. And selfing the T1 generation plant and harvesting seeds to obtain the T2 generation seed. The Osnop2#1 plant and its inbred progeny are called Osnop2#1 strain.

The Osnop2#2 plant is selfed and seeds are harvested, and the seeds are cultivated into plants, namely T1 generation plants. And selfing the T1 generation plant and harvesting seeds to obtain the T2 generation seed. The Osnop2#2 plant and its inbred progeny are called Osnop2#2 strain.

4. Obtaining a compensation plant and a progeny plant thereof

1. Construction of recombinant plasmids

The recombinant plasmid is a circular double-stranded DNA molecule, as shown in a sequence 8 of a sequence table. In the sequence 8 of the sequence table, 807 th-2296 th nucleotide is a promoter, and 2297 th-4378 th nucleotide codes Osnop2 protein.

2. And (3) introducing the recombinant plasmid constructed in the step (1) into agrobacterium EHA105 to obtain recombinant agrobacterium. The method comprises the steps of adopting an agrobacterium infection method, carrying out genetic transformation on embryogenic callus of a receptor plant (the receptor plant is a plant grown from T2 generation seeds of Osnop2#1 plants), screening resistant callus (50 mg/L hygromycin is adopted for resistance screening), carrying out differentiation regeneration culture, and carrying out rooting culture to obtain regenerated plants.

3. And (3) identifying the regenerated plant obtained in the step (2) as follows: taking leaves, extracting genome DNA, carrying out PCR amplification by adopting a primer pair consisting of a primer F2 and a primer R2, and sequencing PCR amplification products. And screening to obtain the anaplerotic plants according to the identification result. Sequencing results show that the DNA molecule shown in the sequence 2 of the sequence table and the mutant DNA molecule are simultaneously arranged in the anaplerotic plant (the mutant DNA molecule is used for replacing TCGGACGACGCCTCC in the DNA molecule shown in the sequence 2 by TCGGACGACGCCTCCTTG)TTTG "DNA molecule obtained).

F2：5’-GAGTTAGCTCACTCATTAG-3’；

R2：5’-CAACGTGCACAACAGAAT-3’。

4. And 3, selfing the anaplerotic plant obtained in the step, harvesting seeds, and culturing the seeds into plants, namely T1 generation plants. And selfing the T1 generation plant and harvesting seeds to obtain the T2 generation seed. The selfing offspring of the anaplerotic plants are called Osnop2-CP strain.

5. Trait comparison

The seeds tested were: rice seeds of Nippon sunny, T2 generation seeds of Osnop2#1, T2 generation seeds of Osnop2#2, and T2 generation seeds of Osnop2-CP.

The test plants were cultivated under parallel conditions, in particular: taking seeds, germinating and raising seedlings in a greenhouse (counting from dew white, and co-culturing for 3 weeks) to obtain 3-week seedlings; transplanting the 3-week seedlings to the field of the Hebei gallery and carrying out normal cultivation and management.

And (5) observing the phenotype of the spike in the mature period, photographing, and counting the spike length. The photograph is shown in FIG. 3. The ear length is shown in FIG. 4 (average of 10 plants per line). Compared with rice Japanese sunny plants, the spike length of the Osnop2#1 plant line and the Osnop2#2 plant line is obviously increased, and the increase range is about 5.48-7.34 percent. Compared with rice Japanese sunny plants, the spike length of the Osnop2-CP plants is not significantly different. Compared with the Osnop2#1 strain plant, the spike length of the Osnop2-CP plant is obviously reduced.

And observing and counting the number of primary and secondary branches in the mature period. The results are shown in FIG. 5 (average of 10 plants per line). Compared with rice Japanese sunny plants, the number of secondary branches of the Osnop2#1 plant line and the Osnop2#2 plant line is obviously increased, and the increase range is about 11.08-13.67%. Compared with the Osnop2#1 strain plant, the secondary branch number of the Osnop2-CP plant is obviously reduced.

The number of seeds per ear was observed and counted during the maturation period. The results are shown in FIG. 6. Compared with rice Japanese sunny plants, the seed numbers of the Osnop2#1 plant line and the Osnop2#2 plant line are obviously increased, and the increase range is about 15.32-17.04%. Compared with rice Japanese sunny plants, the seed numbers of the Osnop2-CP plants have no obvious difference. Compared with the Osnop2#1 plant, the number of seeds of the Osnop2-CP plant is obviously reduced.

Seeds were harvested at maturity and thousand kernel weight was counted. The results are shown in FIG. 7. Compared with rice Japanese sunny plants, the thousand seed weight of the Osnop2#1 plant line and the Osnop2#2 plant line is obviously increased, and the increase range is about 8.7-15.88 percent. Compared with rice Japanese sunny plants, the thousand seed weight of the Osnop2-CP plants is not significantly different. Compared with the Osnop2#1 strain, the thousand seed weight of the Osnop2-CP strain is remarkably reduced.

The seeds are harvested in the mature period, and the length and width of the shelled seeds and the shelled seeds are observed and counted. The results are shown in fig. 8, 9, 10 and 11. Compared with the rice Japanese sunny plant, the grain length with hulls, grain width with hulls, grain length with hulls and grain width with hulls of the Osnop2#1 plant and the Osnop2#2 plant are obviously increased, and the increase ranges are about 12.4 to 16.2 percent, 22.6 to 23.2 percent, 11.4 to 15.7 percent and 16.1 to 17.9 percent respectively. Compared with the rice Japanese sunny plant, the Osnop2-CP plant has no obvious difference in grain length with hulls, grain width with hulls, grain length with hulls and grain width with hulls. Compared with the Osnop2#1 strain, the Osnop2-CP strain has significantly reduced grain length with shell, grain width with shell, grain length with shell and grain width with shell.

6. Heat stress test

The seeds tested were: rice seeds of japan, T2 generation seeds of osnop2#1 line, T2 generation seeds of osnop2#2 line. The test plants were cultivated under parallel conditions, in particular: seeds were taken, germinated in the greenhouse and cultivated to the trefoil phase (time point a, photographs), then transferred to a 45 ℃ incubator for 48 hours (time point B, photographs), then transferred back to the greenhouse and cultivated for 7 days (time point C, photographs), and then the survival rate was counted (at least 24 per test plant). The greenhouse conditions were: 28 ℃,10 hours light/14 hours darkness.

The photographs of the plants are shown in fig. 12, the left graph corresponds to time point a, the middle graph corresponds to time point B, and the right graph corresponds to time point C.

The survival results are shown in figure 12. The survival rate of the Japanese sunny plant is about 40%, the survival rate of the Osnop2#1 plant is about 90%, and the survival rate of the Osnop2#2 plant is about 85%. Compared with Japanese sunny, the heat resistance of the Osnop2#1 strain and the Osnop2#2 strain plants is remarkably improved.

7. Salt stress test

The seeds tested were: rice seeds of Nippon sunny, seeds of the T2 generation of the Osnop2#1 strain and seeds of the T2 generation of the Osnop2-CP strain. The test plants were cultivated under parallel conditions, in particular: seeds were taken, grown in the greenhouse to the trefoil stage (time point a, photographed), then changed to grown in the Hoagland nutrient solution containing 150mM NaCl for 6 days (time point B, photographed), then the seedlings were washed, then changed to grown in the Hoagland nutrient solution for 7 days (time point C, photographed), and finally the survival rate was counted (at least 24 plants per test plant). The greenhouse conditions were: 28 ℃,10 hours light/14 hours darkness.

The photographs of plants are shown in fig. 13, the left graph corresponds to time point a, the middle graph corresponds to time point B, and the right graph corresponds to time point C.

The survival results are shown in figure 13. The survival rate of the Nippon plants was 0, the survival rate of the Osnop2#1 plants was about 20%, and the survival rate of the Osnop2-CP plants was 0. Compared with Japanese sunny, the salt tolerance of the Osnop2#1 line is significantly increased. The salt tolerance of the Osnop2-CP strain plant is basically consistent with that of Japanese sunny.

The present invention is described in detail above. It will be apparent to those skilled in the art that the present invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with respect to specific embodiments, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Sequence listing

<110> institute of biotechnology of national academy of agricultural sciences

<120> Osnop2 protein and use of gene encoding the same in relation to stress tolerance and yield

<130> GNCYX212426

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 693

<212> PRT

<213> Oryza sativa

<400> 1

Met Ala Lys Lys Gly Ala Pro Arg Arg Gln Pro Pro Pro Pro Pro Pro

1 5 10 15

Arg Gln Leu Ala Ala Gly Lys Lys Gly Lys Ala Ser Pro Lys Ala Ala

20 25 30

Lys Arg Ala Ala Pro Lys Lys Gln Arg Leu Leu Glu Ser Ser Ser Asp

35 40 45

Asp Ser Glu Leu Glu Gln Gln Gln Gly Gln Leu Gln Glu Val Glu Ser

50 55 60

Gly Ser Asp Leu Asp Val Pro Ser Asp Ser Gly Ala Glu Glu Leu Ser

65 70 75 80

Asp Ser Asp Asp Ala Ser Phe Glu Gly Gly Asp Ser Gly Asp Glu Glu

85 90 95

Glu Glu Glu Asp Asp Glu Asp Gly Asp Asp Asp Pro Leu Ala Asp Asp

100 105 110

Phe Leu Ala Gly Ser Asp Asp Glu Ser Asp Gly Gly Asp Asp Ser Gly

115 120 125

Val Asp Ser Asp Glu Ser Asp Asp Leu Glu Ala Lys Ser Arg Ala Ile

130 135 140

Asp Glu Glu Lys Glu Lys Ala Glu Glu Glu Ala Glu Glu Glu Leu Lys

145 150 155 160

Leu Asn Ile Arg Ser Glu Ser Asp Glu Phe Arg Leu Pro Thr Lys Glu

165 170 175

Glu Leu Glu Glu Glu Ala Leu Arg Pro Pro Asn Leu Pro Asn Leu Lys

180 185 190

Arg Arg Ile Ser Glu Ile Val Arg Val Leu Ser Asn Phe Ser Lys Leu

195 200 205

Arg Gln Lys Asp Val Pro Arg Lys Asp Tyr Val Asn Gln Leu Lys Thr

210 215 220

Asp Ile Met Ser Tyr Tyr Gly Tyr Asn Asp Phe Leu Val Glu Ala Phe

225 230 235 240

Ile Glu Met Phe Pro Ala Val Glu Leu Val Glu Leu Leu Glu Ser Phe

245 250 255

Glu Lys Arg Pro Pro Glu Cys Leu Arg Thr Asn Thr Leu Lys Thr Arg

260 265 270

Arg Arg Asp Leu Ala Ala Ala Leu Ile Pro Arg Gly Phe Asn Leu Asp

275 280 285

Pro Ile Gly Lys Trp Ser Lys Val Gly Leu Val Val Tyr Asp Ser Thr

290 295 300

Ile Ser Ala Gly Ala Thr Val Glu Tyr Met Ala Gly His Tyr Met Lys

305 310 315 320

Gln Gly Ala Ser Ser Phe Leu Pro Val Met Ala Leu Ala Pro Gln Glu

325 330 335

Lys Glu Arg Ile Val Asp Met Ala Ala Ala Pro Gly Gly Lys Thr Thr

340 345 350

Tyr Ile Gly Ala Leu Met Lys Asn Thr Gly Ile Ile Tyr Ala Asn Glu

355 360 365

Phe Asn Glu Lys Arg Leu His Gly Leu Leu Gly Asn Ile His Arg Met

370 375 380

Gly Val Thr Asn Thr Ile Val Cys Asn Tyr Asp Gly Lys Glu Leu Pro

385 390 395 400

Lys Val Leu Gly Met Asn Ser Val Asp Arg Val Leu Leu Asp Ala Pro

405 410 415

Cys Thr Gly Thr Gly Thr Ile Trp Lys Asp Pro Gln Ile Lys Thr Ser

420 425 430

Lys Gly Ile Glu Asp Ile Arg Asp Cys Ala Phe Val Gln Lys Gln Leu

435 440 445

Leu Leu Ala Ala Ile Asp Leu Val Asp Ala Asn Ser Lys Thr Gly Gly

450 455 460

Tyr Ile Val Tyr Ser Thr Cys Ser Leu Met Ile Pro Glu Asn Glu Ala

465 470 475 480

Val Val Asp Tyr Ala Leu Lys Lys Arg Asn Val Lys Leu Val Pro Cys

485 490 495

Gly Leu Asp Phe Gly Arg Pro Gly Phe Ile Arg Phe Arg Glu His Arg

500 505 510

Phe His Thr Ser Leu Asp Lys Thr Arg Arg Phe Tyr Pro His Val Asn

515 520 525

Asn Met Asp Gly Phe Phe Val Ala Lys Leu Lys Lys Leu Ser Asn Thr

530 535 540

Ile Pro Val Ala Ser Glu Ser Ser Asn Val Pro Glu Glu Ala Ile Glu

545 550 555 560

Lys Ala Asp Pro Ser Ser Asp Asp Pro Gln Lys Gln Pro Ile Gln Ser

565 570 575

Lys Lys His Lys Asp Val Lys Thr Thr Asn Glu Glu Thr Ser Ile Leu

580 585 590

Asp Gly Val Thr Lys Asp Lys Arg Gln Thr His Glu Thr Leu Lys Asn

595 600 605

His Lys Lys Gly Lys Lys Arg Asn Gly Pro Glu Ser Thr Lys Ile Lys

610 615 620

Gly Asp Gln Lys Glu Thr His Asn Glu Glu Glu Pro Thr Ser Glu Lys

625 630 635 640

Lys Gln Pro Val Ser Ala Lys Ile Lys Lys Ser Val Pro Lys Arg Ile

645 650 655

Ser Gly Asn Lys Gly Lys Lys Leu Asp Thr Gly Lys Gly Glu Lys Arg

660 665 670

Lys Arg Asn Trp Met Val Arg Arg Asp Trp Glu Ala Tyr Lys Lys Ser

675 680 685

Arg Ser Lys Gln Val

690

<210> 2

<211> 2082

<212> DNA

<213> Oryza sativa

<400> 2

atggcgaaga agggcgcgcc gcgcaggcag ccgccgccgc cgccgcctcg gcaactggcc 60

gcggggaaga aggggaaggc ctccccgaag gcggcgaaga gggcggcgcc caagaagcag 120

aggctgctcg agtcgtcctc cgacgactcc gagctggagc agcagcaggg gcagcttcag 180

gaggtggagt ccgggtcaga cctcgacgtc ccctctgatt ccggcgccga ggagctctcc 240

gactcggacg acgcctcctt tgagggagga gacagcggcg acgaggagga ggaggaagac 300

gatgaggatg gcgacgacga ccccctcgct gacgacttcc tcgccggcag tgacgacgaa 360

agtgacggag gagacgactc tggtgtggac tcagatgagt ctgatgactt agaggcgaag 420

tcgcgagcga ttgatgaaga gaaagagaag gcagaagaag aggctgagga ggagctcaag 480

ctcaatatta gatcagaatc tgatgagttc cgattgccca caaaggagga gttggaggaa 540

gaggcacttc gaccaccaaa cctgccgaat cttaaaagga ggatatcaga aattgtccgg 600

gtactctcaa actttagtaa gctgaggcaa aaagatgtgc cgcgaaagga ttatgtcaat 660

cagctgaaga cagatataat gtcatactat ggatacaatg attttctcgt tgaagcattt 720

attgagatgt tcccagctgt ggagcttgtt gaactactgg aatcttttga gaaaagaccg 780

cctgaatgct tacgaacaaa tacattgaag acccggagaa gggatcttgc tgctgctctt 840

ataccaagag gatttaatct ggatccgata gggaagtggt caaaggtagg ccttgttgta 900

tacgactcca ccatttcagc tggtgccact gttgaatata tggctgggca ttacatgaaa 960

caaggtgcaa gttctttctt acctgtgatg gctcttgctc ctcaggagaa agagcgaatt 1020

gttgatatgg cggctgcccc aggtggcaag actacatata ttggagctct tatgaagaat 1080

actggaataa tttatgcaaa tgagttcaat gagaaaaggc tgcatggact tttgggcaac 1140

atacatcgca tgggtgttac caataccata gtttgtaatt atgatggtaa agagctacct 1200

aaagttcttg ggatgaattc ggttgacaga gttcttttgg atgcaccctg cacaggcaca 1260

gggaccattt ggaaggatcc acaaattaaa acgtcgaagg gcattgagga catcagagac 1320

tgtgcttttg tacaaaagca attgctatta gctgctattg atttggttga tgccaactcc 1380

aaaactggag gttacattgt ttactcaaca tgttcattga tgattccaga gaatgaagcg 1440

gttgttgact atgcccttaa aaagagaaac gtaaagcttg taccttgtgg attagatttt 1500

gggcgtccag gattcatccg gttccgagag catcgattcc atacttcttt agataaaaca 1560

aggagatttt atccccatgt aaacaacatg gatggttttt ttgttgcgaa gcttaaaaaa 1620

ttgagcaata cgatcccagt ggcatctgag tcatctaatg tgcctgaaga agcaattgag 1680

aaggctgatc ctagcagtga cgatcctcaa aaacagccca ttcagtcaaa aaaacataaa 1740

gatgtgaaga cgacgaatga agagacaagc atccttgatg gggtgactaa ggacaaaagg 1800

cagacacatg agacactcaa gaaccacaag aagggtaaga aacgcaatgg ccctgagagt 1860

actaaaataa agggagacca gaaagaaaca cacaacgaag aagagcctac aagtgaaaaa 1920

aagcagcctg tgtctgctaa aataaaaaaa tctgttccca agagaatatc aggtaacaaa 1980

ggaaagaagc tggatacggg caaaggagag aagaggaaaa gaaactggat ggtgaggcga 2040

gactgggaag cttataagaa gtcgaggagt aaacaagtat ga 2082

<210> 3

<211> 5395

<212> DNA

<213> Oryza sativa

<400> 3

attaaaacga gcggctcttt cccctctccg ccctctctct ctctctctct ctctctctcc 60

catggcgaag aagggcgcgc cgcgcaggca gccgccgccg ccgccgcctc ggcaactggc 120

cgcggggaag aaggggaagg cctccccgaa ggcggcgaag agggcggcgc ccaagaagca 180

gaggctgctc gagtcgtcct ccgacgactc cgagctggag cagcagcagg ggcagcttca 240

ggaggtggag tccgggtcag acctcgacgt cccctctgat tccggcgccg aggagctctc 300

cgactcggac gacgcctcct ttgagggagg agacagcggc gacgaggagg aggaggaaga 360

cgatgaggat ggcgacgacg accccctcgc tgacgacttc ctcgccggca gtgacgacga 420

aagtggtaat gcacggatta ctattgaatc gaattagctt taacaacgtg cttttcagcc 480

ttttccccat caagtcattc gattgtagca ttcacgcgag ctagtattgt aataatcgat 540

aatgggaatg caatgctgta ttgtacatct aggggaatat ctattgatga ttgtattgtg 600

ttttgtagac ggaggagacg actctggtgt ggactcagat gagtctgatg acttagaggc 660

gaagtcgcga gcgattgatg aagagaaaga gaaggcagaa gaagaggctg aggaggagct 720

caagctcaat attagatcag aatctgatga gttccgattg cccacaaagg aggttgattt 780

ttccaccttc ttttatgtct tcagttttac gtgccgctga aggtccgcaa gtgatgtgca 840

catatatcat agtttgtatg ctctgcagga gttggaggaa gaggcacttc gaccaccaaa 900

cctgccgaat cttaaaagga ggatatcaga aagtgtgttc atatatatat tttgcattac 960

caagtttatg aattttttag atgaatcaga gaaaactcaa ttgagatttg gcataatatt 1020

agtgagctaa caagatgtag ctgttctctt gtgtaaactc caaggcactt cgaccaccaa 1080

acctgccgaa tcttaaaagg aggatatcag aaagtgtgtt catatatata ttttgcatta 1140

tcaagtttat gaatttttta gatgaatcag agaaaactca attgagattt ggcataatat 1200

tagtgagcta acaagatgta gctgttctct tgtgtaaact ccaagggcaa atttaagctt 1260

tataactatg gtcattttgc attgtgatag aagcattgaa tatttccctt tctgactttt 1320

ctttctgccc attggtcttc ccctctagtt gtccgggtac tctcaaactt tagtaagctg 1380

aggcaaaaag atgtgccgcg aaaggattat gtcaatcagc tgaagacaga tataatgtca 1440

tactatggat acaatgattt tctcgttgaa gcatttattg aggtgagctt ggtgccgttt 1500

gtttctttcc attgagctgt gcgtttcccc aactgcatca ggttataatt agaaattatt 1560

gtctgacatg cttattaaaa tatgatcatg gtttacctgc tatgagttaa cagtatacat 1620

atttttactg cgcagatgtt cccagctgtg gagcttgttg aactactgga atcttttgag 1680

aaaagaccgc ctgaatgctt acgaacaaat acattgaagg taactatttc agatctcctg 1740

atatgtatgt atgtggtgcc atggaataca tgattcttta tatgtgcttc agtcttttct 1800

ttgcgttctt catcgtcctt acctgctttg ttcatgatgt tggcagaccc ggagaaggga 1860

tcttgctgct gctcttatac caagaggatt taatctggat ccgataggga agtggtcaaa 1920

ggtatgcttt gttcgatctt ctcctttact caagtaatat atccaacatc ccaaagcaac 1980

tctcctggta taaatggcag gtaggccttg ttgtatacga ctccaccatt tcagctggtg 2040

ccactgttga atatatggct gggcattaca tggtaccttc ttctccgata tcattgtgtg 2100

tagattattt catttgctct ccttccacta atgttggtat taaaaaatgt gactacagaa 2160

acaaggtgca agttctttct tacctgtgat ggctcttgct cctcaggaga aagagcgaat 2220

tgttgatatg gcgtaagatg ttttcctttg tctcatacac ttttggcaat tgttcactat 2280

catgacttct aagttattat gtgatccttt tttttcaatg aacatgtaat tgtaatatgc 2340

catgtatgta atctagtcat gctgtcttga tataccactt tgcttctgaa tttgatgata 2400

cattcaactg aattaattac cttgaattca tggaattcat gtcctcgttt ctgatcagga 2460

actcattctt ttcttgtttc cagggctgcc ccaggtggca agactacata tattggagct 2520

cttatgaaga atactggtca gtatgctgcc tgtttttaaa tacattttgt tcctccattg 2580

gagtaatttt gttttgtgtg gtttcttgcc aattgaaatg caaatatact gttttattca 2640

tttgtcatgc acaggaataa tttatgcaaa tgagttcaat gagaaaaggc tgcatggact 2700

tttgggcaac atacatcgca tgggtgttac caataccata gtttgtaatt atgatggtaa 2760

agaggtgagc aaacagtaca aatattgtta acgtgctatc tgatagccga aacacaatca 2820

actaatttta tgcattaaga aagaatcttg atttgtggta tttgtcaagt acttagtata 2880

atgtaactac agtatattgt tttgtacaaa acgataacag aatgaaaaca cattataagt 2940

attgttacat aatctctgac caataatttt tggtccattt taatcatgga gaagataaat 3000

gtcaagtcct aataattttt ggttgcttga attgggtgca gcattttctc attgaaaacc 3060

tattttgtga taacattctg tttatttcag ctacctaaag ttcttgggat gaattcggtt 3120

gacagagttc ttttggatgc accctgcaca ggcacagggg taagcatcat atagttcgta 3180

taagctccta ctcctgtcat attttctcat ttatttaaac agatgcttac tttttctgca 3240

gaccatttgg aaggatccac aaattaaaac gtcgaagggc attgaggaca tcagagactg 3300

tgcttttgta caaaaggtgc atttcttgta tttctaggtc ttgtttaaat tgaacctact 3360

taccatttgg catattccca cctaacaatt ctaaatgcaa ttcttcttat gttatcgagg 3420

aaaagaactg cattccactc acattattcc aattttgatt cttaaccaag tcacttgctt 3480

aaaacattat tggttcgtcc tcgtgttgag tttgtttttt gggggtcatt tctaagcaat 3540

ttatattgtg cagttgtgct gattcttaca tggaaataac atataacccc agaattgcta 3600

tgttctgttt gctcattttt atggattatg tttacttaat ctgtatttgc taagctatgt 3660

gattgtgttc aatcataatt tggtctttta agctacacaa tttttgtttg gtcagttttt 3720

tctaaatcga gctgttattc tatactggtt gagtacctca atcaccttga aattggtatg 3780

tataccacta tttactgtct aactgatgag ttgttttaca gcaattgcta ttagctgcta 3840

ttgatttggt tgatgccaac tccaaaactg gaggttacat tgtttactca acatgttcat 3900

tgatgattcc agaggtaagt tcattggcct tgccagttca atgatagtca acttagtttc 3960

ttgaacctct ctccattctt gcagaatgaa gcggttgttg actatgccct taaaaagaga 4020

aacgtaaagc ttgtaccttg tggattagat tttgggcgtc cagggtactg taaatctctc 4080

tcccatgacc tgttatgaag aatttctaca tttttatctt attactatcc gtttatccta 4140

cagattcatc cggttccgag agcatcgatt ccatacttct ttagataaaa caaggagatt 4200

ttatccccat gtaaacaaca tggatggttt ttttgttgcg aaggtaacac caatgctaaa 4260

cttcatggtg aaatatctaa tctattaaat aggttgtttg atcaggtgct tatttcatta 4320

ttaggatgtg ctgaatgtat tgaactctat tatgaaaagt ttaattttct ttgcttagtt 4380

tggacatacc atctgattag ggtacttcct ttgacgcagc ttaaaaaatt gagcaatacg 4440

atcccagtgg catctgagtc atctaatgtg cctgaagaag caattgagaa ggctgatcct 4500

agcagtgacg atcctcaaaa acagcccatt cagtcaaaaa aacataaaga tgtgaagacg 4560

acgaatgaag agacaagcat ccttgatggg gtgactaagg acaaaaggca gacacatgag 4620

acactcaaga accacaagaa gggtaagaaa cgcaatggcc ctgagagtac taaaataaag 4680

ggagaccaga aagaaacaca caacgaagaa gagcctacaa gtgaaaaaaa gcagcctgtg 4740

tctgctaaaa taaaaaaatc tgttcccaag agaatatcag gtaacaaagg aaagaagctg 4800

gatacgggca aaggagagaa gaggaaaaga aactggatgg tgaggcgaga ctggtgagat 4860

agtacaatga tgttgtgcct tttcatgcct tggaattgtt gttttcgttg ctttattctg 4920

atttggtgta atgatcttct aacagggaag cttataagaa gtcgaggagt aaacaagtat 4980

gaaaggcacg gatgaaggag ctctagccgt agacaaattg cagttaaatt tgaaaaccca 5040

catacgggga agatgttaga aggagcgaga atacacaatt ttggcgttgg ttcaagttcg 5100

aggcgaagga aaatttttgt tgtacttaag tctagtgaag tgatcgtctg tagttttacc 5160

ctttcttttc cgtcttggtt taatgtacca atactaaggc acttctcgga catgagttat 5220

gggagtatgt gattgacttc gtcatgttgc ctggtaagta ctatgctggc cgatggaaca 5280

gtatgatgtt ctgcttgcta agggcgacgt gtggttgtgc tcagggttag gggcggaaat 5340

cgtgctggct ccgcttttta ttgagctttc tttgaaatta atttaccttc atatt 5395

<210> 4

<211> 15897

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

taaacgctct tttctcttag gtttacccgc caatatatcc tgtcaaacac tgatagttta 60

aactgaaggc gggaaacgac aatctgatcc aagctcaagc tgctctagca ttcgccattc 120

aggctgcgca actgttggga agggcgatcg gtgcgggcct cttcgctatt acgccagctg 180

gcgaaagggg gatgtgctgc aaggcgatta agttgggtaa cgccagggtt ttcccagtca 240

cgacgttgta aaacgacggc cagtgccaag cttggatcat gaaccaacgg cctggctgta 300

tttggtggtt gtgtagggag atggggagaa gaaaagcccg attctcttcg ctgtgatggg 360

ctggatgcat gcgggggagc gggaggccca agtacgtgca cggtgagcgg cccacagggc 420

gagtgtgagc gcgagaggcg ggaggaacag tttagtacca cattgcccag ctaactcgaa 480

cgcgaccaac ttataaaccc gcgcgctgtc gcttgtgttc ggacgacgcc tcctttggtt 540

ttagagctag aaatagcaag ttaaaataag gctagtccgt tatcaacttg aaaaagtggc 600

accgagtcgg tgcttttttg ttttagagct agaaatagca agttaaaata aggctagtcc 660

gtagcgcgtg cgccaattct gcagacaaat ggccccgggc ctgcaggtgc agcgtgaccc 720

ggtcgtgccc ctctctagag ataatgagca ttgcatgtct aagttataaa aaattaccac 780

atattttttt tgtcacactt gtttgaagtg cagtttatct atctttatac atatatttaa 840

actttactct acgaataata taatctatag tactacaata atatcagtgt tttagagaat 900

catataaatg aacagttaga catggtctaa aggacaattg agtattttga caacaggact 960

ctacagtttt atctttttag tgtgcatgtg ttctcctttt tttttgcaaa tagcttcacc 1020

tatataatac ttcatccatt ttattagtac atccatttag ggtttagggt taatggtttt 1080

tatagactaa tttttttagt acatctattt tattctattt tagcctctaa attaagaaaa 1140

ctaaaactct attttagttt ttttatttaa taatttagat ataaaataga ataaaataaa 1200

gtgactaaaa attaaacaaa taccctttaa gaaattaaaa aaactaagga aacatttttc 1260

ttgtttcgag tagataatgc cagcctgtta aacgccgtcg acgagtctaa cggacaccaa 1320

ccagcgaacc agcagcgtcg cgtcgggcca agcgaagcag acggcacggc atctctgtcg 1380

ctgcctctgg acccctctcg agagttccgc tccaccgttg gacttgctcc gctgtcggca 1440

tccagaaatt gcgtggcgga gcggcagacg tgagccggca cggcaggcgg cctcctcctc 1500

ctctcacggc acggcagcta cgggggattc ctttcccacc gctccttcgc tttcccttcc 1560

tcgcccgccg taataaatag acaccccctc cacaccctct ttccccaacc tcgtgttgtt 1620

cggagcgcac acacacacaa ccagatctcc cccaaatcca cccgtcggca cctccgcttc 1680

aaggtacgcc gctcgtcctc cccccccccc cctctctacc ttctctagat cggcgttccg 1740

gtccatggtt agggcccggt agttctactt ctgttcatgt ttgtgttaga tccgtgtttg 1800

tgttagatcc gtgctgctag cgttcgtaca cggatgcgac ctgtacgtca gacacgttct 1860

gattgctaac ttgccagtgt ttctctttgg ggaatcctgg gatggctcta gccgttccgc 1920

agacgggatc gatttcatga ttttttttgt ttcgttgcat agggtttggt ttgccctttt 1980

cctttatttc aatatatgcc gtgcacttgt ttgtcgggtc atcttttcat gctttttttt 2040

gtcttggttg tgatgatgtg gtctggttgg gcggtcgttc tagatcggag tagaattctg 2100

tttcaaacta cctggtggat ttattaattt tggatctgta tgtgtgtgcc atacatattc 2160

atagttacga attgaagatg atggatggaa atatcgatct aggataggta tacatgttga 2220

tgcgggtttt actgatgcat atacagagat gctttttgtt cgcttggttg tgatgatgtg 2280

gtgtggttgg gcggtcgttc attcgttcta gatcggagta gaatactgtt tcaaactacc 2340

tggtgtattt attaattttg gaactgtatg tgtgtgtcat acatcttcat agttacgagt 2400

ttaagatgga tggaaatatc gatctaggat aggtatacat gttgatgtgg gttttactga 2460

tgcatataca tgatggcata tgcagcatct attcatatgc tctaaccttg agtacctatc 2520

tattataata aacaagtatg ttttataatt attttgatct tgatatactt ggatgatggc 2580

atatgcagca gctatatgtg gattttttta gccctgcctt catacgctat ttatttgctt 2640

ggtactgttt cttttgtcga tgctcaccct gttgtttggt gttacttctg cagccatgga 2700

ctataaggac cacgacggag actacaagga tcatgatatt gattacaaag acgatgacga 2760

taagatggcc ccaaagaaga agcggaaggt cggtatccac ggagtcccag cagccgacaa 2820

gaagtacagc atcggcctgg acatcggcac caactctgtg ggctgggccg tgatcaccga 2880

cgagtacaag gtgcccagca agaaattcaa ggtgctgggc aacaccgacc ggcacagcat 2940

caagaagaac ctgatcggag ccctgctgtt cgacagcggc gaaacagccg aggccacccg 3000

gctgaagaga accgccagaa gaagatacac cagacggaag aaccggatct gctatctgca 3060

agagatcttc agcaacgaga tggccaaggt ggacgacagc ttcttccaca gactggaaga 3120

gtccttcctg gtggaagagg ataagaagca cgagcggcac cccatcttcg gcaacatcgt 3180

ggacgaggtg gcctaccacg agaagtaccc caccatctac cacctgagaa agaaactggt 3240

ggacagcacc gacaaggccg acctgcggct gatctatctg gccctggccc acatgatcaa 3300

gttccggggc cacttcctga tcgagggcga cctgaacccc gacaacagcg acgtggacaa 3360

gctgttcatc cagctggtgc agacctacaa ccagctgttc gaggaaaacc ccatcaacgc 3420

cagcggcgtg gacgccaagg ccatcctgtc tgccagactg agcaagagca gacggctgga 3480

aaatctgatc gcccagctgc ccggcgagaa gaagaatggc ctgttcggaa acctgattgc 3540

cctgagcctg ggcctgaccc ccaacttcaa gagcaacttc gacctggccg aggatgccaa 3600

actgcagctg agcaaggaca cctacgacga cgacctggac aacctgctgg cccagatcgg 3660

cgaccagtac gccgacctgt ttctggccgc caagaacctg tccgacgcca tcctgctgag 3720

cgacatcctg agagtgaaca ccgagatcac caaggccccc ctgagcgcct ctatgatcaa 3780

gagatacgac gagcaccacc aggacctgac cctgctgaaa gctctcgtgc ggcagcagct 3840

gcctgagaag tacaaagaga ttttcttcga ccagagcaag aacggctacg ccggctacat 3900

tgacggcgga gccagccagg aagagttcta caagttcatc aagcccatcc tggaaaagat 3960

ggacggcacc gaggaactgc tcgtgaagct gaacagagag gacctgctgc ggaagcagcg 4020

gaccttcgac aacggcagca tcccccacca gatccacctg ggagagctgc acgccattct 4080

gcggcggcag gaagattttt acccattcct gaaggacaac cgggaaaaga tcgagaagat 4140

cctgaccttc cgcatcccct actacgtggg ccctctggcc aggggaaaca gcagattcgc 4200

ctggatgacc agaaagagcg aggaaaccat caccccctgg aacttcgagg aagtggtgga 4260

caagggcgct tccgcccaga gcttcatcga gcggatgacc aacttcgata agaacctgcc 4320

caacgagaag gtgctgccca agcacagcct gctgtacgag tacttcaccg tgtataacga 4380

gctgaccaaa gtgaaatacg tgaccgaggg aatgagaaag cccgccttcc tgagcggcga 4440

gcagaaaaag gccatcgtgg acctgctgtt caagaccaac cggaaagtga ccgtgaagca 4500

gctgaaagag gactacttca agaaaatcga gtgcttcgac tccgtggaaa tctccggcgt 4560

ggaagatcgg ttcaacgcct ccctgggcac ataccacgat ctgctgaaaa ttatcaagga 4620

caaggacttc ctggacaatg aggaaaacga ggacattctg gaagatatcg tgctgaccct 4680

gacactgttt gaggacagag agatgatcga ggaacggctg aaaacctatg cccacctgtt 4740

cgacgacaaa gtgatgaagc agctgaagcg gcggagatac accggctggg gcaggctgag 4800

ccggaagctg atcaacggca tccgggacaa gcagtccggc aagacaatcc tggatttcct 4860

gaagtccgac ggcttcgcca acagaaactt catgcagctg atccacgacg acagcctgac 4920

ctttaaagag gacatccaga aagcccaggt gtccggccag ggcgatagcc tgcacgagca 4980

cattgccaat ctggccggca gccccgccat taagaagggc atcctgcaga cagtgaaggt 5040

ggtggacgag ctcgtgaaag tgatgggccg gcacaagccc gagaacatcg tgatcgaaat 5100

ggccagagag aaccagacca cccagaaggg acagaagaac agccgcgaga gaatgaagcg 5160

gatcgaagag ggcatcaaag agctgggcag ccagatcctg aaagaacacc ccgtggaaaa 5220

cacccagctg cagaacgaga agctgtacct gtactacctg cagaatgggc gggatatgta 5280

cgtggaccag gaactggaca tcaaccggct gtccgactac gatgtggacc atatcgtgcc 5340

tcagagcttt ctgaaggacg actccatcga caacaaggtg ctgaccagaa gcgacaagaa 5400

ccggggcaag agcgacaacg tgccctccga agaggtcgtg aagaagatga agaactactg 5460

gcggcagctg ctgaacgcca agctgattac ccagagaaag ttcgacaatc tgaccaaggc 5520

cgagagaggc ggcctgagcg aactggataa ggccggcttc atcaagagac agctggtgga 5580

aacccggcag atcacaaagc acgtggcaca gatcctggac tcccggatga acactaagta 5640

cgacgagaat gacaagctga tccgggaagt gaaagtgatc accctgaagt ccaagctggt 5700

gtccgatttc cggaaggatt tccagtttta caaagtgcgc gagatcaaca actaccacca 5760

cgcccacgac gcctacctga acgccgtcgt gggaaccgcc ctgatcaaaa agtaccctaa 5820

gctggaaagc gagttcgtgt acggcgacta caaggtgtac gacgtgcgga agatgatcgc 5880

caagagcgag caggaaatcg gcaaggctac cgccaagtac ttcttctaca gcaacatcat 5940

gaactttttc aagaccgaga ttaccctggc caacggcgag atccggaagc ggcctctgat 6000

cgagacaaac ggcgaaaccg gggagatcgt gtgggataag ggccgggatt ttgccaccgt 6060

gcggaaagtg ctgagcatgc cccaagtgaa tatcgtgaaa aagaccgagg tgcagacagg 6120

cggcttcagc aaagagtcta tcctgcccaa gaggaacagc gataagctga tcgccagaaa 6180

gaaggactgg gaccctaaga agtacggcgg cttcgacagc cccaccgtgg cctattctgt 6240

gctggtggtg gccaaagtgg aaaagggcaa gtccaagaaa ctgaagagtg tgaaagagct 6300

gctggggatc accatcatgg aaagaagcag cttcgagaag aatcccatcg actttctgga 6360

agccaagggc tacaaagaag tgaaaaagga cctgatcatc aagctgccta agtactccct 6420

gttcgagctg gaaaacggcc ggaagagaat gctggcctct gccggcgaac tgcagaaggg 6480

aaacgaactg gccctgccct ccaaatatgt gaacttcctg tacctggcca gccactatga 6540

gaagctgaag ggctcccccg aggataatga gcagaaacag ctgtttgtgg aacagcacaa 6600

gcactacctg gacgagatca tcgagcagat cagcgagttc tccaagagag tgatcctggc 6660

cgacgctaat ctggacaaag tgctgtccgc ctacaacaag caccgggata agcccatcag 6720

agagcaggcc gagaatatca tccacctgtt taccctgacc aatctgggag cccctgccgc 6780

cttcaagtac tttgacacca ccatcgaccg gaagaggtac accagcacca aagaggtgct 6840

ggacgccacc ctgatccacc agagcatcac cggcctgtac gagacacgga tcgacctgtc 6900

tcagctggga ggcgacaaaa ggccggcggc cacgaaaaag gccggccagg caaaaaagaa 6960

aaagtaagga tcctgattga tcgatagagc tcgaatttcc ccgatcgttc aaacatttgg 7020

caataaagtt tcttaagatt gaatcctgtt gccggtcttg cgatgattat catataattt 7080

ctgttgaatt acgttaagca tgtaataatt aacatgtaat gcatgacgtt atttatgaga 7140

tgggttttta tgattagagt cccgcaatta tacatttaat acgcgataga aaacaaaata 7200

tagcgcgcaa actaggataa attatcgcgc gcggtgtcat ctatgttact agatcgggaa 7260

ttcgtaatca tggtcatagc tgtttcctgt gtgaaattgt tatccgctca caattccaca 7320

caacatacga gccggaagca taaagtgtaa agcctggggt gcctaatgag tgagctaact 7380

cacattaatt gcgttgcgct cactgcccgc tttccagtcg ggaaacctgt cgtgccagct 7440

gcattaatga atcggccaac gcgcggggag aggcggtttg cgtattggct agagcagctt 7500

gccaacatgg tggagcacga cactctcgtc tactccaaga atatcaaaga tacagtctca 7560

gaagaccaaa gggctattga gacttttcaa caaagggtaa tatcgggaaa cctcctcgga 7620

ttccattgcc cagctatctg tcacttcatc aaaaggacag tagaaaagga aggtggcacc 7680

tacaaatgcc atcattgcga taaaggaaag gctatcgttc aagatgcctc tgccgacagt 7740

ggtcccaaag atggaccccc acccacgagg agcatcgtgg aaaaagaaga cgttccaacc 7800

acgtcttcaa agcaagtgga ttgatgtgat aacatggtgg agcacgacac tctcgtctac 7860

tccaagaata tcaaagatac agtctcagaa gaccaaaggg ctattgagac ttttcaacaa 7920

agggtaatat cgggaaacct cctcggattc cattgcccag ctatctgtca cttcatcaaa 7980

aggacagtag aaaaggaagg tggcacctac aaatgccatc attgcgataa aggaaaggct 8040

atcgttcaag atgcctctgc cgacagtggt cccaaagatg gacccccacc cacgaggagc 8100

atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgatatc 8160

tccactgacg taagggatga cgcacaatcc cactatcctt cgcaagacct tcctctatat 8220

aaggaagttc atttcatttg gagaggacac gctgaaatca ccagtctctc tctacaaatc 8280

tatctctctc gagctttcgc agatcccggg gggcaatgag atatgaaaaa gcctgaactc 8340

accgcgacgt ctgtcgagaa gtttctgatc gaaaagttcg acagcgtctc cgacctgatg 8400

cagctctcgg agggcgaaga atctcgtgct ttcagcttcg atgtaggagg gcgtggatat 8460

gtcctgcggg taaatagctg cgccgatggt ttctacaaag atcgttatgt ttatcggcac 8520

tttgcatcgg ccgcgctccc gattccggaa gtgcttgaca ttggggagtt tagcgagagc 8580

ctgacctatt gcatctcccg ccgtgcacag ggtgtcacgt tgcaagacct gcctgaaacc 8640

gaactgcccg ctgttctaca accggtcgcg gaggctatgg atgcgatcgc tgcggccgat 8700

cttagccaga cgagcgggtt cggcccattc ggaccgcaag gaatcggtca atacactaca 8760

tggcgtgatt tcatatgcgc gattgctgat ccccatgtgt atcactggca aactgtgatg 8820

gacgacaccg tcagtgcgtc cgtcgcgcag gctctcgatg agctgatgct ttgggccgag 8880

gactgccccg aagtccggca cctcgtgcac gcggatttcg gctccaacaa tgtcctgacg 8940

gacaatggcc gcataacagc ggtcattgac tggagcgagg cgatgttcgg ggattcccaa 9000

tacgaggtcg ccaacatctt cttctggagg ccgtggttgg cttgtatgga gcagcagacg 9060

cgctacttcg agcggaggca tccggagctt gcaggatcgc cacgactccg ggcgtatatg 9120

ctccgcattg gtcttgacca actctatcag agcttggttg acggcaattt cgatgatgca 9180

gcttgggcgc agggtcgatg cgacgcaatc gtccgatccg gagccgggac tgtcgggcgt 9240

acacaaatcg cccgcagaag cgcggccgtc tggaccgatg gctgtgtaga agtactcgcc 9300

gatagtggaa accgacgccc cagcactcgt ccgagggcaa agaaatagag tagatgccga 9360

ccggatctgt cgatcgacaa gctcgagttt ctccataata atgtgtgagt agttcccaga 9420

taagggaatt agggttccta tagggtttcg ctcatgtgtt gagcatataa gaaaccctta 9480

gtatgtattt gtatttgtaa aatacttcta tcaataaaat ttctaattcc taaaaccaaa 9540

atccagtact aaaatccaga tcccccgaat taattcggcg ttaattcagt acattaaaaa 9600

cgtccgcaat gtgttattaa gttgtctaag cgtcaatttg tttacaccac aatatatcct 9660

gccaccagcc agccaacagc tccccgaccg gcagctcggc acaaaatcac cactcgatac 9720

aggcagccca tcagtccggg acggcgtcag cgggagagcc gttgtaaggc ggcagacttt 9780

gctcatgtta ccgatgctat tcggaagaac ggcaactaag ctgccgggtt tgaaacacgg 9840

atgatctcgc ggagggtagc atgttgattg taacgatgac agagcgttgc tgcctgtgat 9900

caccgcggtt tcaaaatcgg ctccgtcgat actatgttat acgccaactt tgaaaacaac 9960

tttgaaaaag ctgttttctg gtatttaagg ttttagaatg caaggaacag tgaattggag 10020

ttcgtcttgt tataattagc ttcttggggt atctttaaat actgtagaaa agaggaagga 10080

aataataaat ggctaaaatg agaatatcac cggaattgaa aaaactgatc gaaaaatacc 10140

gctgcgtaaa agatacggaa ggaatgtctc ctgctaaggt atataagctg gtgggagaaa 10200

atgaaaacct atatttaaaa atgacggaca gccggtataa agggaccacc tatgatgtgg 10260

aacgggaaaa ggacatgatg ctatggctgg aaggaaagct gcctgttcca aaggtcctgc 10320

actttgaacg gcatgatggc tggagcaatc tgctcatgag tgaggccgat ggcgtccttt 10380

gctcggaaga gtatgaagat gaacaaagcc ctgaaaagat tatcgagctg tatgcggagt 10440

gcatcaggct ctttcactcc atcgacatat cggattgtcc ctatacgaat agcttagaca 10500

gccgcttagc cgaattggat tacttactga ataacgatct ggccgatgtg gattgcgaaa 10560

actgggaaga agacactcca tttaaagatc cgcgcgagct gtatgatttt ttaaagacgg 10620

aaaagcccga agaggaactt gtcttttccc acggcgacct gggagacagc aacatctttg 10680

tgaaagatgg caaagtaagt ggctttattg atcttgggag aagcggcagg gcggacaagt 10740

ggtatgacat tgccttctgc gtccggtcga tcagggagga tatcggggaa gaacagtatg 10800

tcgagctatt ttttgactta ctggggatca agcctgattg ggagaaaata aaatattata 10860

ttttactgga tgaattgttt tagtacctag aatgcatgac caaaatccct taacgtgagt 10920

tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt 10980

tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt 11040

gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc 11100

agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg 11160

tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg 11220

ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt 11280

cgggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac 11340

tgagatacct acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg 11400

acaggtatcc ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg 11460

gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat 11520

ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcggcctttt 11580

tacggttcct ggccttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg 11640

attctgtgga taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa 11700

cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga gcgcctgatg cggtattttc 11760

tccttacgca tctgtgcggt atttcacacc gcatatggtg cactctcagt acaatctgct 11820

ctgatgccgc atagttaagc cagtatacac tccgctatcg ctacgtgact gggtcatggc 11880

tgcgccccga cacccgccaa cacccgctga cgcgccctga cgggcttgtc tgctcccggc 11940

atccgcttac agacaagctg tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc 12000

gtcatcaccg aaacgcgcga ggcagggtgc cttgatgtgg gcgccggcgg tcgagtggcg 12060

acggcgcggc ttgtccgcgc cctggtagat tgcctggccg taggccagcc atttttgagc 12120

ggccagcggc cgcgataggc cgacgcgaag cggcggggcg tagggagcgc agcgaccgaa 12180

gggtaggcgc tttttgcagc tcttcggctg tgcgctggcc agacagttat gcacaggcca 12240

ggcgggtttt aagagtttta ataagtttta aagagtttta ggcggaaaaa tcgccttttt 12300

tctcttttat atcagtcact tacatgtgtg accggttccc aatgtacggc tttgggttcc 12360

caatgtacgg gttccggttc ccaatgtacg gctttgggtt cccaatgtac gtgctatcca 12420

caggaaagag tccttttcga cctttttccc ctgctagggc aatttgccct agcatctgct 12480

ccgtacatta ggaaccggcg gatgcttcgc cctcgatcag gttgcggtag cgcatgacta 12540

ggatcgggcc agcctgcccc gcctcctcct tcaaatcgta ctccggcagg tcatttgacc 12600

cgatcagctt gcgcacggtg aaacagaact tcttgaactc tccggcgctg ccactgcgtt 12660

cgtagatcgt cttgaacaac catctggctt ctgccttgcc tgcggcgcgg cgtgccaggc 12720

ggtagagaaa acggccgatg ccgggatcga tcaaaaagta atcggggtga accgtcagca 12780

cgtccgggtt cttgccttct gtgatctcgc ggtacatcca atcagctagc tcgatctcga 12840

tgtactccgg ccgcccggtt tcgctcttta cgatcttgta gcggctaatc aaggcttcac 12900

cctcggatac cgtcaccagg cggccgttct tggccttctt cgtacgctgc atggcaacgt 12960

gcgtggtgtt taaccgaatg caggtttcta ccaggtcgtc tttctgcttt ccgccatcgg 13020

ctcgccggca gaacttgagt acgtccgcaa cgtgtggacg gaacacgcgg ccgggcttgt 13080

ctcccttccc ttcccggtat cggttcatgg attcggttag atgggaaacc gccatcagta 13140

ccaggtcgta atcccacaca ctggccatgc cggccggccc tgcggaaacc tctacgtgcc 13200

cgtctggaag ctcgtagcgg atcacctcgc cagctcgtcg gtcacgcttc gacagacgga 13260

aaacggccac gtccatgatg ctgcgactat cgcgggtgcc cacgtcatag agcatcggaa 13320

cgaaaaaatc tggttgctcg tcgcccttgg gcggcttcct aatcgacggc gcaccggctg 13380

ccggcggttg ccgggattct ttgcggattc gatcagcggc cgcttgccac gattcaccgg 13440

ggcgtgcttc tgcctcgatg cgttgccgct gggcggcctg cgcggccttc aacttctcca 13500

ccaggtcatc acccagcgcc gcgccgattt gtaccgggcc ggatggtttg cgaccgtcac 13560

gccgattcct cgggcttggg ggttccagtg ccattgcagg gccggcagac aacccagccg 13620

cttacgcctg gccaaccgcc cgttcctcca cacatggggc attccacggc gtcggtgcct 13680

ggttgttctt gattttccat gccgcctcct ttagccgcta aaattcatct actcatttat 13740

tcatttgctc atttactctg gtagctgcgc gatgtattca gatagcagct cggtaatggt 13800

cttgccttgg cgtaccgcgt acatcttcag cttggtgtga tcctccgccg gcaactgaaa 13860

gttgacccgc ttcatggctg gcgtgtctgc caggctggcc aacgttgcag ccttgctgct 13920

gcgtgcgctc ggacggccgg cacttagcgt gtttgtgctt ttgctcattt tctctttacc 13980

tcattaactc aaatgagttt tgatttaatt tcagcggcca gcgcctggac ctcgcgggca 14040

gcgtcgccct cgggttctga ttcaagaacg gttgtgccgg cggcggcagt gcctgggtag 14100

ctcacgcgct gcgtgatacg ggactcaaga atgggcagct cgtacccggc cagcgcctcg 14160

gcaacctcac cgccgatgcg cgtgcctttg atcgcccgcg acacgacaaa ggccgcttgt 14220

agccttccat ccgtgacctc aatgcgctgc ttaaccagct ccaccaggtc ggcggtggcc 14280

catatgtcgt aagggcttgg ctgcaccgga atcagcacga agtcggctgc cttgatcgcg 14340

gacacagcca agtccgccgc ctggggcgct ccgtcgatca ctacgaagtc gcgccggccg 14400

atggccttca cgtcgcggtc aatcgtcggg cggtcgatgc cgacaacggt tagcggttga 14460

tcttcccgca cggccgccca atcgcgggca ctgccctggg gatcggaatc gactaacaga 14520

acatcggccc cggcgagttg cagggcgcgg gctagatggg ttgcgatggt cgtcttgcct 14580

gacccgcctt tctggttaag tacagcgata accttcatgc gttccccttg cgtatttgtt 14640

tatttactca tcgcatcata tacgcagcga ccgcatgacg caagctgttt tactcaaata 14700

cacatcacct ttttagacgg cggcgctcgg tttcttcagc ggccaagctg gccggccagg 14760

ccgccagctt ggcatcagac aaaccggcca ggatttcatg cagccgcacg gttgagacgt 14820

gcgcgggcgg ctcgaacacg tacccggccg cgatcatctc cgcctcgatc tcttcggtaa 14880

tgaaaaacgg ttcgtcctgg ccgtcctggt gcggtttcat gcttgttcct cttggcgttc 14940

attctcggcg gccgccaggg cgtcggcctc ggtcaatgcg tcctcacgga aggcaccgcg 15000

ccgcctggcc tcggtgggcg tcacttcctc gctgcgctca agtgcgcggt acagggtcga 15060

gcgatgcacg ccaagcagtg cagccgcctc tttcacggtg cggccttcct ggtcgatcag 15120

ctcgcgggcg tgcgcgatct gtgccggggt gagggtaggg cgggggccaa acttcacgcc 15180

tcgggccttg gcggcctcgc gcccgctccg ggtgcggtcg atgattaggg aacgctcgaa 15240

ctcggcaatg ccggcgaaca cggtcaacac catgcggccg gccggcgtgg tggtgtcggc 15300

ccacggctct gccaggctac gcaggcccgc gccggcctcc tggatgcgct cggcaatgtc 15360

cagtaggtcg cgggtgctgc gggccaggcg gtctagcctg gtcactgtca caacgtcgcc 15420

agggcgtagg tggtcaagca tcctggccag ctccgggcgg tcgcgcctgg tgccggtgat 15480

cttctcggaa aacagcttgg tgcagccggc cgcgtgcagt tcggcccgtt ggttggtcaa 15540

gtcctggtcg tcggtgctga cgcgggcata gcccagcagg ccagcggcgg cgctcttgtt 15600

catggcgtaa tgtctccggt tctagtcgca agtattctac tttatgcgac taaaacacgc 15660

gacaagaaaa cgccaggaaa agggcagggc ggcagcctgt cgcgtaactt aggacttgtg 15720

cgacatgtcg ttttcagaag acggctgcac tgaacgtcag aagccgactg cactatagca 15780

gcggaggggt tggatcaaag tactttgatc ccgaggggaa ccctgtggtt ggcatgcaca 15840

tacaaatgga cgaacggata aaccttttca cgccctttta aatatccgtt attctaa 15897

<210> 5

<211> 95

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

tcggacgacg cctcctttgg ttttagagct agaaatagca agttaaaata aggctagtcc 60

gttatcaact tgaaaaagtg gcaccgagtc ggtgc 95

<210> 6

<211> 95

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

ucggacgacg ccuccuuugg uuuuagagcu agaaauagca aguuaaaaua aggcuagucc 60

guuaucaacu ugaaaaagug gcaccgaguc ggugc 95

<210> 7

<211> 19

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

ucggacgacg ccuccuuug 19

<210> 8

<211> 5413

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

gcatcttgaa cgatagcctt tcctttatcg caatgatggc atttgtaggt gccaccttcc 60

ttttctactg tccttttgat gaagtgacag atagctgggc aatggaatcc gaggaggttt 120

cccgatatta ccctttgttg aaaagtctca atagcccttt ggtcttctga gactgtatct 180

ttgatattct tggagtagac gagagtgtcg tgctccacca tgttcacatc aatccacttg 240

ctttgaagac gtggttggaa cgtcttcttt ttccacgatg ctcctcgtgg gtgggggtcc 300

atctttggga ccactgtcgg cagaggcatc ttgaacgata gcctttcctt tatcgcaatg 360

atggcatttg taggtgccac cttccttttc tactgtcctt ttgatgaagt gacagatagc 420

tgggcaatgg aatccgagga ggtttcccga tattaccctt tgttgaaaag tctcaatagc 480

cctttggtct tctgagactg tatctttgat attcttggag tagacgagag tgtcgtgctc 540

caccatgttg gcaagctgct ctagccaata cgcaaaccgc ctctccccgc gcgttggccg 600

attcattaat gcagctggca cgacaggttt cccgactgga aagcgggcag tgagcgcaac 660

gcaattaatg tgagttagct cactcattag gcaccccagg ctttacactt tatgcttccg 720

gctcgtatgt tgtgtggaat tgtgagcgga taacaatttc acacaggaaa cagctatgac 780

atgattacga attcgagctc ggtaccagta gctgataatt ccacattcaa ggtctctcag 840

gttgttatga tgctcaaatg tactctctct ggtttttaat gtttgacgct attgactttt 900

aaacacatgt ttgatatttt ttcttgttca aaagaaatat agaattatca tttattttgt 960

tgttatttgt tacctcataa ctatggcttt tttgtatata tgtatagttt ttaaaataag 1020

acaagtggta aaggtatgtt taaatgccaa caatgtcagc cattaaaaac tgaagggaga 1080

aacgtcctgg ggttttccgg ctagcttcac aaggtggtgg gttagacgac ctgggttcga 1140

agcctcaccc ctcctaatta tttgatatta ggtccttccc taatacttgt gtttttcatt 1200

aaaaactgaa tgagtaacat tttcagcttg ttggagacag agattagcac accacatcat 1260

gtcaactatc aagaagtcct atttatcatg taccatacta ttggttcctg aaaacagttt 1320

ggccatgcat cacttttcag tcatggctgc aacaatcact ccatttctgc aataaaatgc 1380

agcttggaga tcacttctaa ctaacttgct cttgatcgtt gcagcgcaac atcagctctg 1440

tcacacgttg tgctggggca attcaagacc atagtcataa tgctctcagg ttacctgatc 1500

ttcagctcgg atcctggaat caccagcatc tgcggagcca tcgtcgctct cggtggcatg 1560

tccgtctaca cctatctggg tctgaaagag tcgacgacaa ccgggaagaa accgccttta 1620

gcacagaagc ccaaagctgc tggggatggt gagaagcctg gtttggagca tgaggattct 1680

gtatgagctg acgaggatta ttcatcctgg ttggtcgatt gtactataag catacttagg 1740

tgattctcca agagttgtac gccattgctg agtccattgt acatagaaac acttcatgat 1800

tttacccttt tacagttctt aaaaagttca aaaacattgc ctcacaattc tcttcgtttc 1860

ttttttcttg ctgataagtt ccacagttga tgtcacgtaa gatgaagaac atgtcagcat 1920

gtcacatagg ataggaacca cgtaggagga aaccacgctc taaaccattc gggaaggtaa 1980

attggtccgg ttttaataat tgacggagca tctatacccg gttttgtagt tcatgaacat 2040

gaattggact cggcctgcag attgagggag aatatatgaa ccttttgcca tattgttttt 2100

ctaagttgaa acgggggacg cgtgcgaaac tggcccatta tttctttgga tcaatatact 2160

caagttttgg gccggcctgg cccatctagc aagcgaggta gttatagctc tctcgccgag 2220

ggcccgaggc ccagcattaa aacgagcggc tctttcccct ctccgccctc tctctctctc 2280

tctctctctc tctcccatgg cgaagaaggg cgcgccgcgc aggcagccgc cgccgccgcc 2340

gcctcggcaa ctggccgcgg ggaagaaggg gaaggcctcc ccgaaggcgg cgaagagggc 2400

ggcgcccaag aagcagaggc tgctcgagtc gtcctccgac gactccgagc tggagcagca 2460

gcaggggcag cttcaggagg tggagtccgg gtcagacctc gacgtcccct ctgattccgg 2520

cgccgaggag ctctccgact cggacgacgc ctcctttgag ggaggagaca gcggcgacga 2580

ggaggaggag gaagacgatg aggatggcga cgacgacccc ctcgctgacg acttcctcgc 2640

cggcagtgac gacgaaagtg acggaggaga cgactctggt gtggactcag atgagtctga 2700

tgacttagag gcgaagtcgc gagcgattga tgaagagaaa gagaaggcag aagaagaggc 2760

tgaggaggag ctcaagctca atattagatc agaatctgat gagttccgat tgcccacaaa 2820

ggaggagttg gaggaagagg cacttcgacc accaaacctg ccgaatctta aaaggaggat 2880

atcagaaatt gtccgggtac tctcaaactt tagtaagctg aggcaaaaag atgtgccgcg 2940

aaaggattat gtcaatcagc tgaagacaga tataatgtca tactatggat acaatgattt 3000

tctcgttgaa gcatttattg agatgttccc agctgtggag cttgttgaac tactggaatc 3060

ttttgagaaa agaccgcctg aatgcttacg aacaaataca ttgaagaccc ggagaaggga 3120

tcttgctgct gctcttatac caagaggatt taatctggat ccgataggga agtggtcaaa 3180

ggtaggcctt gttgtatacg actccaccat ttcagctggt gccactgttg aatatatggc 3240

tgggcattac atgaaacaag gtgcaagttc tttcttacct gtgatggctc ttgctcctca 3300

ggagaaagag cgaattgttg atatggcggc tgccccaggt ggcaagacta catatattgg 3360

agctcttatg aagaatactg gaataattta tgcaaatgag ttcaatgaga aaaggctgca 3420

tggacttttg ggcaacatac atcgcatggg tgttaccaat accatagttt gtaattatga 3480

tggtaaagag ctacctaaag ttcttgggat gaattcggtt gacagagttc ttttggatgc 3540

accctgcaca ggcacaggga ccatttggaa ggatccacaa attaaaacgt cgaagggcat 3600

tgaggacatc agagactgtg cttttgtaca aaagcaattg ctattagctg ctattgattt 3660

ggttgatgcc aactccaaaa ctggaggtta cattgtttac tcaacatgtt cattgatgat 3720

tccagagaat gaagcggttg ttgactatgc ccttaaaaag agaaacgtaa agcttgtacc 3780

ttgtggatta gattttgggc gtccaggatt catccggttc cgagagcatc gattccatac 3840

ttctttagat aaaacaagga gattttatcc ccatgtaaac aacatggatg gtttttttgt 3900

tgcgaagctt aaaaaattga gcaatacgat cccagtggca tctgagtcat ctaatgtgcc 3960

tgaagaagca attgagaagg ctgatcctag cagtgacgat cctcaaaaac agcccattca 4020

gtcaaaaaaa cataaagatg tgaagacgac gaatgaagag acaagcatcc ttgatggggt 4080

gactaaggac aaaaggcaga cacatgagac actcaagaac cacaagaagg gtaagaaacg 4140

caatggccct gagagtacta aaataaaggg agaccagaaa gaaacacaca acgaagaaga 4200

gcctacaagt gaaaaaaagc agcctgtgtc tgctaaaata aaaaaatctg ttcccaagag 4260

aatatcaggt aacaaaggaa agaagctgga tacgggcaaa ggagagaaga ggaaaagaaa 4320

ctggatggtg aggcgagact gggaagctta taagaagtcg aggagtaaac aagtatgagg 4380

tacccgggga tcctctagag tcgacctgca ggcatgccct gctttaatga gatatgcgag 4440

acgcctatga tcgcatgata tttgctttca attctgttgt gcacgttgta aaaaacctga 4500

gcatgtgtag ctcagatcct taccgccggt ttcggttcat tctaatgaat atatcacccg 4560

ttactatcgt atttttatga ataatattct ccgttcaatt tactgattgt ccaagcttgg 4620

cactggccgt cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc caacttaatc 4680

gccttgcagc acatccccct ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc 4740

gcccttccca acagttgcgc agcctgaatg gcgaatgcta gagcagcttg agcttggatc 4800

agattgtcgt ttcccgcctt cagtttaaac tatcagtgtt tgacaggata tattggcggg 4860

taaacctaag agaaaagagc gtttattaga ataatcggat atttaaaagg gcgtgaaaag 4920

gtttatccgt tcgtccattt gtatgtgcat gccaaccaca gggttcccct cgggatcaaa 4980

gtactttgat ccaacccctc cgctgctata gtgcagtcgg cttctgacgt tcagtgcagc 5040

cgtcttctga aaacgacatg tcgcacaagt cctaagttac gcgacaggct gccgccctgc 5100

cctttttctg ggcgttttct tgtcgcgtgt tttagtcgca taaaagtaga atacttgcga 5160

ctaggaaccg ggagacatta cgccatgaac aagaagcgcg acgctggcct gctggctatg 5220

cccgcgtcag caccgacgaa ccaggacttg aaccacaacg gacgaactgc acgcggcggc 5280

ctgcactaag ctgttttccg aaaaagaatc accgtacaca ggccgaccgc ccgaacctgc 5340

cagaatgctt gaacacctac ccttgcgcac gtggtgaaca atacaagcct agaaccgccc 5400

ctgaccgcgc gag 5413

Claims (10)

1. Application of Osnop2 protein in regulating plant stress tolerance;

   the Osnop2 protein is (a 1) or (a 2) as follows:

   (a1) Protein shown in a sequence 1 in a sequence table;

   (a2) A fusion protein obtained by connecting a tag to the N-terminal or/and the C-terminal of the protein of (a 1);

   the regulation is negative regulation, namely, the Osnop2 protein content is reduced, and the stress tolerance of the plant is enhanced;

   the stress tolerance is stress tolerance to heat stress and/or stress tolerance to salt stress;

   the plant is rice.
2. 2. Use of a substance that inhibits the Osnop2 gene in plant breeding with the following objectives: cultivating a plant with enhanced stress tolerance; the Osnop2 gene is a gene encoding the Osnop2 protein of claim 1;

   the Osnop2 gene inhibition is realized by reducing the abundance of the gene through gene editing;

   the stress tolerance is stress tolerance to heat stress and/or stress tolerance to salt stress;

   the plant is rice.
3. 3. The use according to claim 2, wherein: the Osnop2 gene is a DNA molecule with a coding region shown as a sequence 2 in a sequence table.
4. 4. A use according to claim 3, wherein: the Osnop2 gene is a DNA molecule shown in a sequence 3 in a sequence table.
5. 5. A method of making a stress tolerant enhanced plant comprising the steps of: "TCGGACGACGCCTCCTTG" or "TCGGACGACGCCTCCTTTTGG" is used to replace "TCGGACGACGCCTCCTTTG" in the Osnop2 gene in plant genomic DNA to obtain a plant with enhanced stress tolerance; the Osnop2 gene is a gene encoding the Osnop2 protein of claim 1;

   the stress tolerance is stress tolerance to heat stress and/or stress tolerance to salt stress;

   the plant is rice.
6. Application of Osnop2 protein in regulating and controlling plant yield traits;

   the Osnop2 protein is (a 1) or (a 2) as follows:

   (a1) Protein shown in a sequence 1 in a sequence table;

   (a2) A fusion protein obtained by connecting a tag to the N-terminal or/and the C-terminal of the protein of (a 1);

   the regulation is negative regulation, namely, the Osnop2 protein content is reduced, and the yield property of the plant is enhanced;

   the yield trait enhancement is embodied as at least one or any combination of the following: increasing the spike length, increasing the number of secondary branches, increasing the spike grain number, increasing the grain weight, increasing the grain length and increasing the grain width;

   the plant is rice.
7. 7. Use of a substance that inhibits the Osnop2 gene in plant breeding with the following objectives: cultivating plants with enhanced yield traits; the Osnop2 gene is a gene encoding the Osnop2 protein of claim 1;

   the Osnop2 gene inhibition is realized by reducing the abundance of the gene through gene editing;

   the yield trait enhancement is embodied as at least one or any combination of the following: increasing the spike length, increasing the number of secondary branches, increasing the spike grain number, increasing the grain weight, increasing the grain length and increasing the grain width;

   the plant is rice.
8. 8. The use according to claim 7, wherein: the Osnop2 gene is a DNA molecule with a coding region shown as a sequence 2 in a sequence table.
9. 9. The use according to claim 8, wherein: the Osnop2 gene is a DNA molecule shown in a sequence 3 in a sequence table.
10. 10. A method of making a plant with enhanced yield traits comprising the steps of: "TCGGACGACGCCTCCTTG" or "TCGGACGACGCCTCCTTTTGG" is used to replace "TCGGACGACGCCTCCTTTG" in the Osnop2 gene in plant genomic DNA to obtain plants with enhanced yield traits; the Osnop2 gene is a gene encoding the Osnop2 protein of claim 1;

    the yield trait enhancement is embodied as at least one or any combination of the following: increasing the spike length, increasing the number of secondary branches, increasing the spike grain number, increasing the grain weight, increasing the grain length and increasing the grain width;

    the plant is rice.

Images