CN113699155B

CN113699155B - CuO mutant and application thereof

Info

Publication number: CN113699155B
Application number: CN202111266803.8A
Authority: CN
Inventors: 杨兴林; 杨佳丽; 潘讴东; 杨蕊菊; 高花
Original assignee: Obio Technology (shanghai) Corp ltd
Current assignee: Obio Technology (shanghai) Corp ltd
Priority date: 2021-10-29
Filing date: 2021-10-29
Publication date: 2022-02-11
Anticipated expiration: 2041-10-29
Also published as: CN113699155A; WO2023071695A1

Abstract

The invention belongs to the field of genetic engineering, and particularly relates to a CuO mutant and an inducible system thereof. The nucleotide sequence of the CuO mutant is shown as SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: and 6. According to the invention, a mutation library with a large number of mutants is established by randomly mutating the CuO P2 element sequence, and a plurality of CuO mutants with low background leakage and stronger induced expression are obtained by screening the mutation library. The CuO mutants can be applied to an inducible system of CuO-CymR and have wide application value.

Description

CuO mutant and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a CuO mutant and application thereof.

Background

The Cumate inducible expression system is a eukaryotic cell inducible system constructed from an operator system found in pseudomonas putida. The bacterial repressor CymR can be specifically bound to a binding sequence CuO (promoter) element downstream of the promoter, so that the transcription of the promoter is inhibited. And the inducer, 4-isopropylbenzoic acid (Cumate), can be combined with the CymR protein and cause the conformational change of the CymR protein, so that the CymR is not combined with the CuO sequence any more, and the inhibition of the transcription of the promoter is eliminated, as shown in FIG. 1.

Because the CuO element can be flexibly placed at the downstream of CMV, EF1a, CAG, UBC and other promoters, an inducible system is formed. Compared with the traditional TetON system, the CuO-CymR inducible system has higher flexibility, can be matched with various Pol II type promoters, and has important application in the field of biological basic research. However, the CuO-CymR inducible system still has strong background leakage, which affects the further application of the system.

Disclosure of Invention

At least one object of the present invention is to invent novel CuO mutants with low background leakage and more strongly induced expression.

The wild-type CuO P2 element is 28bp in length and is one of the most commonly used sequences. According to the invention, random mutation is carried out on two sides of a palindromic sequence of a CuO P2 element sequence and 6 bases in the middle of the palindromic sequence, a diversity mutation library containing 65536 mutants is established, and a plurality of mutants with low background leakage and stronger induced expression are obtained by screening the mutation library.

Specifically, the invention comprises the following technical scheme:

the first aspect of the invention discloses a plurality of CuO mutants, and the nucleotide sequence of the CuO mutant is shown as SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: and 6.

It is understood that sequences having at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the above sequences (and other sequences in the present invention) while remaining functionally unchanged are also within the scope of the present invention. The difference in the sequences is caused by base substitution, deletion or addition, and it is within the ability of those skilled in the art to obtain functionally similar sequences, for example, by non-conservative base substitution, and such sequences are within the scope of the present invention.

The second aspect of the invention discloses a method for screening CuO mutants, which comprises the following steps:

s1: constructing an mCuOx library;

s2: packaging mCuOx library virus;

s3: screening an mCuOx library;

s4: sequencing the mCuOx library;

s5: and comparing the mutant CuO with a wild CuO inducible system to obtain the target CuO mutant.

It should be understood that other additional steps may be included in the present invention before S1, between S2 and S3, between S3 and S4, between S4 and S5, and after S5, and are within the scope of the present invention.

Preferably, in S1, the mCuOx library is obtained by randomly mutating both ends and the middle 6 bases of the sequence of wild-type CuO.

Preferably, in S2, pSLenti-CMV-mCuOx-EGFP-3FLAG-PGK-puro mutant lentivirus plasmid library is amplified, extracted and packaged by a lentivirus three-plasmid packaging system to obtain mCuOx mutant library lentivirus.

It should be understood that the lentiviral vector of the present invention is not limited to pSLenti-CMV-mCuOx-EGFP-3FLAG-PGK-puro, and any suitable lentiviral vector can be selected by those skilled in the art as required to complete the technical solution of the present invention and is within the protection scope of the present invention.

In some embodiments of the invention, the mCuOx library is constructed:

NACAAACAGACNNNNNNGTCTGTTTGTN (SEQ ID NO：11)；

the construction process comprises the following steps:

sequence between BsmBI and EcoRI of H13781 vector:

Ggagacgccatccacgctgttttgacctccatagaagacaccgactctactagaggatcgctagcgctaccggactcagatctcgagctcaagcttc(SEQ ID NO：12)

replacing the steps as follows:

GgagacgttgaaNACAAACAGACNNNNNNGTCTGTTTGTNttataagtaaggactagt(SEQ ID NO：13)

pSLenti-CMV-mCuOx-EGFP-3FLAG-PGK-puro is obtained.

Preferably, the S3 includes:

s31: infecting cells with low MOI (MOI =0.5) by using the packaged mCuOx mutant library lentivirus, then carrying out fluorescence sorting detection, and separating and enriching cells with strong green fluorescence brightness (5% -10% before the fluorescence brightness);

s32: infecting the cells obtained in S31 with CymR overexpression virus, then carrying out fluorescence sorting detection, and separating and enriching the cells with weak green fluorescence brightness (5% -10% of the fluorescence brightness).

Preferably, in S4, after genome extraction of the cell obtained in S3, the mCuOx element is PCR-amplified, constructed on a T-vector, and sequenced to obtain the mCuOx mutant sequence.

Preferably, the mutant CuO is compared with the wild-type CuO in the transcription repression effect of the promoter in the inducible system to obtain the CuO mutant of interest. In some embodiments of the invention, the transcription repression effect of the promoter is judged by the intensity of fluorescence.

In a second aspect, the invention discloses a CuO mutant obtained by the above method.

In some embodiments of the present invention, 9 non-repetitive mutant sequences, e.g., mCuO01-mCuO09, were obtained, the nucleotide sequences of which are set forth in SEQ ID NO: 1-9. In the invention, the nucleotide sequence of wild CuO is shown in SEQ ID NO: shown at 10.

In a third aspect, the invention discloses a plasmid, which is characterized by comprising the CuO mutant. In the present invention, the term "plasmid" refers to a DNA molecule capable of autonomous replication in addition to the chromosomal or nuclear region DNA of a cell.

The fourth aspect of the invention discloses a kit, which comprises the plasmid.

The fifth aspect of the invention discloses a CuO-CymR inducible system, which comprises the CuO mutant.

The sixth aspect of the invention discloses a CASP8 overexpression stable strain, which is characterized in that the CASP8 overexpression stable strain is prepared by utilizing the CuO-CymR inducible system.

The seventh aspect of the invention discloses the use of the CuO mutant according to the above, the plasmid according to the above, the kit according to the above or the CuO-CymR inducible system according to the above in the field of genes.

On the basis of the common general knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily without departing from the concept and the protection scope of the invention.

Compared with the prior art, the invention has the following remarkable advantages and effects:

according to the invention, a mutation library with a large number of mutants is established by randomly mutating the CuO P2 element sequence, and a plurality of CuO mutants with low background leakage and stronger induced expression are obtained by screening the mutation library. The CuO mutant can be applied to an inducible system of CuO-CymR and has wide application value.

Drawings

FIG. 1 is a schematic diagram of an inducible system of CuO-CymR.

FIG. 2 is a schematic representation of the library base vector H13781 pSLenti-CMV-EGFP-3 FLAG-PGK-puro.

FIG. 3 is a schematic diagram of the CymR lentiviral vector pSLenti-EF1-CymR-IRES 2-BSR-WPRE.

FIG. 4 is a schematic diagram of mCuOx sequence alignment.

Fig. 5 is a graph showing the effect of mCuOx carrier inhibition.

FIG. 6 is a fluorescent intensity quantitative analysis chart of mCuOx carrier suppression effect.

FIG. 7 is a schematic diagram of lentiviral vectors of CuO-Luc-P2A-mCherry, mCuO03-Luc-P2A-mCherry, mCuO 04-Luc-P2A-mCherry and mCuO 06-Luc-P2A-mCherry.

FIG. 8 is a schematic diagram of fluorescence results before and after induction of 293T cells infected with CuO-Luc-P2A-mCherry, mCuO03-Luc-P2A-mCherry, mCuO 04-Luc-P2A-mCherry and mCuO06-Luc-P2A-mCherry viruses.

FIG. 9 is a schematic diagram showing the multiples of Luciferase before and after induction of 293T cells infected by CuO-Luc-P2A-mCherry, mCuO03-Luc-P2A-mCherry, mCuO 04-Luc-P2A-mCherry and mCuO06-Luc-P2A-mCherry viruses.

FIG. 10 is a schematic diagram of the basic vector pSLenti-CMV-CASP 8-P2A-EGFP-PGK-Puro-WPRE.

FIG. 11 is a fluorescent photograph of CuO-CASP8, mCuO03-CASP8, mCuO04-CASP8 and mCuO06-CASP8 before and after induction of stable cell lines.

FIG. 12 shows the results of WesternBlot detection of CASP8 expression levels after induction of CuO-CASP8, mCuO03-CASP8, mCuO04-CASP8 and mCuO06-CASP8 inducible stable cell lines.

Detailed Description

The technical solutions of the present invention are described in detail below with reference to the drawings and the embodiments, but the present invention is not limited to the scope of the embodiments.

The experimental methods without specifying specific conditions in the following examples were selected according to the conventional methods and conditions, or according to the commercial instructions. The reagents and starting materials used in the present invention are commercially available.

Example 1

1. Construction and screening of lentiviral vector CuO mutation library

1) CuOx library construction

NACAAACAGACNNNNNNGTCTGTTTGTN(SEQ ID NO: 11), N is any one of A, T, C and G.

The construction process comprises the following steps:

sequence between BsmBI and EcoRI of H13781 vector:

Ggagacgccatccacgctgttttgacctccatagaagacaccgactctactagaggatcgctagcgctaccggactcagatctcgagctcaagcttc((SEQ ID NO：12)

replacing the steps as follows:

GgagacgttgaaNACAAACAGACNNNNNNGTCTGTTTGTNttataagtaaggactagt((SEQ ID NO：13)

so as to obtain pSLenti-CMV-mCuOx-EGFP-3 FLAG-PGK-puro.

By annealing the primers, digesting with BsmBI and EcoRI, ligating to vector H13781, preparing plate clones by electrotransformation until the number of clones reaches at least 3 x 10⁶And obtaining a pSLenti-CMV-mCuOx-EGFP-3FLAG-PGK-puro mutant lentivirus plasmid library. A schematic representation of the basic vector H13781 pSLenti-CMV-EGFP-3FLAG-PGK-puro is shown in FIG. 2.

2) mCuOx library virus packaging

Amplifying the collected pSLenti-CMV-mCuOx-EGFP-3FLAG-PGK-puro mutant lentivirus plasmid library, extracting plasmids, packaging lentiviruses by adopting a lentivirus three-plasmid packaging system, and detecting the titer of the lentiviruses to be 3.7 x 10⁸TU/ml, to obtain-mCuOx mutant library lentiviruses.

3) mCuOx library screening

293T cells were infected with low MOI (multiplicity of infection) using lentiviruses of the above packaged mCuOx mutant library, and the cells were harvested 72 hours after infection. And separating and enriching cells with the brightness of green fluorescence of 5-10% by using a flow cytometer for fluorescence sorting detection.

After the enriched cells were cultured, they were infected with CymR overexpression virus (pSLenti-EF1-CymR-IRES 2-BSR-WPRE) for 72 hours, and then collected. And separating and enriching cells with weak green fluorescence brightness (5-10% of the fluorescence brightness) by using a flow cytometer for fluorescence sorting detection. A schematic diagram of pSLenti-EF1-CymR-IRES2-BSR-WPRE is shown in FIG. 3.

Culturing and amplifying cells collected by a flow sorter, extracting a genome, amplifying an mCuOx element by PCR, constructing the mCuOx element on a T carrier, selecting 50 clones, and sequencing to obtain 9 non-repetitive mutant sequences such as mCuO01-mCuO09 and the like.

4) mCuOx library sequencing

The 9 non-repetitive mutant sequences of mCuO01-mCuO09 and the like are shown in the following table 1, and the alignment chart is shown in FIG. 4.

TABLE 1

Name of element	Sequence of
		CuO	AACAAACAGACAATCTGGTCTGTTTGTA（SEQ ID NO：10）
mCuO01	CACAAACAGACAAAGTGGTCTGTTTGTG（SEQ ID NO：1）
		mCuO02	AACAAACAGACCAACCTGTCTGTTTGTT（SEQ ID NO：2）
mCuO03	AACAAACAGACAGGTTGGTCTGTTTGTA（SEQ ID NO：3）
		mCuO04	TACAAACAGACAACTTGCTCTGTTTGTA（SEQ ID NO：4）
mCuO05	GACAAACAGACAAGTTGATCTGTTTGTC（SEQ ID NO：5）
		mCuO06	TACAAACAGACGACATGCTCTGTTTGTA（SEQ ID NO：6）
mCuO07	AACAAACAGACTACGTGGTCTGTTTGTT（SEQ ID NO：7）
		mCuO08	CACAAACAGACAAGATAGTCTGTTTGTG（SEQ ID NO：8）
mCuO09	GACAAACAGACTAGGTCGTCTGTTTGTT（SEQ ID NO：9）

2. Comparison of mutant CuO with wild-type CuO inducible System

The mCuO01-mCuO09 sequence is constructed into a H13781 pSLenti-CMV-EGFP-3FLAG-PGK-puro vector to obtain a vector such as pSLenti-CMV-mCuO01-EGFP-3FLAG-PGK-puro, and after the vector and pcDNA3.1-CymR are co-transfected into 293T cells, fluorescence is observed, and the experimental result is shown in the graph of FIG. 5 and FIG. 6. From the results, it can be observed that mutant of mCuO03, mCuO04 and mCuO06 has stronger repression effect than the wild type.

Example 2

Furthermore, the mutant mCuO03-CymR, mCuO0-CymR 4 and mCuO06-CymR can induce the system to obtain an overexpression vector with lower background and higher induction fold. To verify the effect of the elements mCuO03, mCuO04 and mCuO06, the inventors performed the following operations:

pSLenti-CMV-CuO-Luc 2-P2A-mChery-EF 1-cymR-P2A-Puro-WPRE (CuO-Luc 2-P2A-mChery), pSLenti-CMV-mCuO03-Luc 2-P2A-mChery-1-CymR-P2 1-Puro-WPRE (mCuO 1-Luc 1-P2 1-mChery), pSLenti-CMV-mCuO 1-Luc 1-P2 1-mChery-EF 1-CymR-P2 1-Puro-WPRE (see the schematic diagram of mCuO 1-Luc 1-P2 1-hermC) and Lenti-pS-mCuO 1-Luc-CMV-WPRE (see the structure of mCEF 1-mCherP 2 1-mChery-mCErP 72-mChery vector) are constructed (see the schematic diagram of pSLenti-mCi-CMV-mRuo-1-mChery-mCER-P72-mCErP 72-mCErE-mCErP 72-mCErC 1-mCErC-mCErE-mCErP 72-mRurC-mRurE vector). As shown in FIG. 8 and FIG. 9, mCuO03-CymR, mCuO04-CymR and mCuO06-CymR inducible systems are confirmed to obtain lower background and higher over-expression induction times by observing and measuring mCherry fluorescence brightness and luciferase values before and after induction.

Example 3

In order to verify the low leakage effect of the mutant CuO-CymR induction system, a representative apoptosis gene is selected, and the over-expression of the CASP8 gene can cause the apoptosis of cells, so that the construction of a stable cell strain of CASP8 can be realized depending on the inducible system. The traditional CuO-CymR system has high apoptosis rate due to the leakage of CASP8 expression, and the induction expression of the screened stable strain is weak. And the mCuO03-CymR, mCuO04-CymR and mCuO06-CymR systems with lower background are used, so that the lower leakage of CASP8 is realized, and a stable cell strain with stronger induction of CASP8 is obtained.

The method specifically comprises the following steps:

1) construction of CASP8 inducible Lentiviral vectors

Based on pSLenti-CMV-CASP8-P2A-EGFP-PGK-Puro-WPRE (the structural schematic diagram of the vector is shown in figure 10), the following construction is carried out:

inserting CuO, mCuO03, mCuO04 and mCuO06 sequences into BsmBI and EcoRI respectively to obtain pSLenti-CMV-CuO-CASP8-P2A-EGFP-PGK-Puro-WPRE (CuO-CASP8), pSLenti-CMV-mCuO03-CASP8-P2A-EGFP-PGK-Puro-WPRE (mCuO03-CASP8), pSLenti-CMV-mCuO04-CASP8-P2A-EGFP-PGK-Puro-WPRE (mCuO04-CASP8) and pSLenti-CMV-mCuO06-CASP8-P2A-EGFP-PGK-Puro-WPRE (mCuO06-CASP8)

2) Stable cell line construction and induction

CuO-CASP8, mCuO03-CASP8, mCuO04-CASP8 and mCuO06-CASP8 viruses and CymR viruses pSLenti-EF1-CymR-IRES2-BSR-WPRE co-infect 293T cells respectively, stable cell strains are obtained after 2 weeks of co-screening of Puro + BSR, Cumate with the final concentration of 300 mug/ml is added for induction, fluorescence is observed after 48 hours, and the result is shown in FIG. 11. It can be seen that fluorescence of mutant CuO elements mCuO03, mCuO04 and mCuO06 before induction is weaker than that of wild CuO, and fluorescence after induction is stronger than that of wild CuO, which indicates that mutant CuO elements mCuO03, mCuO04 and mCuO06 can better inhibit expression of CASP8 apoptosis gene, and can better induce expression of CASP8 apoptosis gene after Cumate is added. Meanwhile, a WesternBlot experiment proves that after Cumate is added for induction, the expression level of CASP8 of stable strains of mCuO03-CASP8, mCuO04-CASP8 and mCuO06-CASP8 is obviously higher than that of a wild-type CuO-CASP8 stable strain, and the result is shown in figure 12.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> and Yuan Biotechnology (Shanghai) Ltd

<120> CuO mutant and application thereof

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cacaaacaga caaagtggtc tgtttgtg 28

<210> 2

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aacaaacaga ccaacctgtc tgtttgtt 28

<210> 3

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aacaaacaga caggttggtc tgtttgta 28

<210> 4

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tacaaacaga caacttgctc tgtttgta 28

<210> 5

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gacaaacaga caagttgatc tgtttgtc 28

<210> 6

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tacaaacaga cgacatgctc tgtttgta 28

<210> 7

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

aacaaacaga ctacgtggtc tgtttgtt 28

<210> 8

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cacaaacaga caagatagtc tgtttgtg 28

<210> 9

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gacaaacaga ctaggtcgtc tgtttgtt 28

<210> 10

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aacaaacaga caatctggtc tgtttgta 28

<210> 11

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

nacaaacaga cnnnnnngtc tgtttgtn 28

<210> 12

<211> 97

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ggagacgcca tccacgctgt tttgacctcc atagaagaca ccgactctac tagaggatcg 60

ctagcgctac cggactcaga tctcgagctc aagcttc 97

<210> 13

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ggagacgttg aanacaaaca gacnnnnnng tctgtttgtn ttataagtaa ggactagt 58

Claims

1. A mutant CuO element, wherein the nucleotide sequence of the mutant CuO element is set forth in SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: and 6.

2. A plasmid comprising the CuO element mutant of claim 1.

3. A kit comprising the plasmid of claim 2.

4. An inducible system of CuO-CymR comprising the mutant CuO element of claim 1.

5. A CASP8 overexpression stable cell line, wherein the CASP8 overexpression stable cell line is prepared by using the CuO-CymR inducible system of claim 4.

6. Use of the CuO element mutant of claim 1, the plasmid of claim 2, the kit of claim 3 or the CuO-CymR inducible system of claim 4 for gene-induced expression.