CN113684210B - Anti-novel coronavirus nucleic acid, and pharmaceutical composition and application thereof - Google Patents
Anti-novel coronavirus nucleic acid, and pharmaceutical composition and application thereof Download PDFInfo
- Publication number
- CN113684210B CN113684210B CN202110815075.5A CN202110815075A CN113684210B CN 113684210 B CN113684210 B CN 113684210B CN 202110815075 A CN202110815075 A CN 202110815075A CN 113684210 B CN113684210 B CN 113684210B
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- stem
- novel coronavirus
- acid molecule
- pharmaceutical composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Zoology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biophysics (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Plant Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention provides a nucleic acid for resisting a novel coronavirus, a pharmaceutical composition and an application thereof, wherein the nucleic acid for resisting the novel coronavirus comprises: nucleic acid molecule SL: 1, can form a stem-loop structure SL, inhibits the synthesis of virus protein and further inhibits the replication of viruses, wherein the stem-loop structure SL comprises 6 stem-loop segments including SL1, SL2, SL3, SL4, SL4.5 and SL5; and at least one of individual SL1, SL2, SL3, SL4, SL4.5, and SL5 nucleic acid molecules and tandem structures thereof of different lengths; the nucleic acid can form a stem-loop structure, can target NSP1 after being transferred into cells, inhibits the synthesis of virus protein, further inhibits the replication of virus, and can provide a new idea and scheme for treating SARS-CoV-2 patients.
Description
Technical Field
The invention relates to the technical field of biomedicine, in particular to a novel coronavirus resistant nucleic acid, a pharmaceutical composition and application thereof.
Background
Vaccines are effective prophylactic against viral disease infection, and antiviral drugs provide effective therapeutic means for patients already infected with the virus. Because of the incomplete understanding of the interaction between virus and host, it is difficult to develop highly effective and safe antiviral chemical drugs. The broad spectrum antiviral drugs, reidesciclovir and dexamethasone, have been reported to exhibit activity against SARS-CoV-2. However, the global shortage of Reidesciclovir, the relatively high price and the lack of significant efficacy in patients with severe recurrent coronary pneumonia have not been widely used so far. Dexamethasone is used for the treatment of patients with severe new coronary pneumonia who require mechanical ventilation, however, has limited efficacy in patients with mild new coronary pneumonia who do not require respiratory support. New, non-traditional antiviral drug design and development ideas and approaches are therefore urgently needed.
The nucleic acid is also called as nucleotide medicine, is various oligoribonucleotide (RNA) or oligodeoxyribonucleotide (DNA) with different functions, the action target of the nucleic acid is the base sequence of the gene, and the design is relatively easy, so the nucleic acid medicine has wide application prospect. More than 10 nucleic acid drugs are currently approved worldwide. For example, ASONs can bind to target messenger RNA to form a duplex, thereby degrading mRNA; fomivirsen (trade name Vitravene), norcisane sodium (trade name Spinraza), etc. are approved for clinical treatment by the U.S. FDA and the European Commission (EC). To date, no clinical reports have been found for the use of nucleic acid drugs in the treatment of SARS-CoV-2 patients.
Therefore, there is a need to develop a nucleic acid that provides new ideas and protocols for the treatment of SARS-CoV-2 patients.
Disclosure of Invention
The invention aims to provide a novel coronavirus resistant nucleic acid, a pharmaceutical composition and an application thereof, wherein the novel coronavirus resistant nucleic acid comprises a plurality of nucleic acid molecules, the sequences of the nucleic acid molecules can form Stem-loop Structures (SL), after the nucleic acid molecules are transferred into cells, the SL can target NSP1 and inhibit the synthesis of viral proteins so as to inhibit the replication of viruses, and a novel thought and scheme can be provided for treating SARS-CoV-2 patients.
In a first aspect of the present invention, there is provided a nucleic acid against a novel coronavirus capable of forming a stem-loop structure, which is antiviral by inhibiting protein synthesis of SARS-CoV-2; the nucleic acid resisting the novel coronavirus comprises at least one of the following nucleic acid molecules:
nucleic acid molecule SL: has a nucleotide sequence shown as SEQ ID NO. 1; a stem-loop structure SL can be formed comprising 6 stem-loop segments SL1, SL2, SL3, SL4, SL4.5 and SL5;
nucleic acid molecule SL1: has a nucleotide sequence shown as SEQ ID NO. 2 and can form a stem-loop structure SL1;
nucleic acid molecule SL2: has a nucleotide sequence shown as SEQ ID NO. 3 and can form a stem-loop structure SL2;
nucleic acid molecule SL3: has a nucleotide sequence shown as SEQ ID NO. 4, can form a stem-loop structure SL3;
nucleic acid molecule SL4: has a nucleotide sequence shown as SEQ ID NO. 5, can form a stem-loop structure SL4;
nucleic acid molecule SL4.5: has a nucleotide sequence shown as SEQ ID NO. 6 and can form a stem-loop structure SL4.5;
nucleic acid molecule SL5: has a nucleotide sequence shown as SEQ ID NO. 7, can form a stem-loop structure SL5;
nucleic acid molecule SL1-2: a series configuration with SL1+ SL2;
nucleic acid molecule SL1-3: a series configuration having SL1+ SL2+ SL3;
nucleic acid molecules SL1-4: a series configuration having SL1+ SL2+ SL3+ SL4;
nucleic acid molecule SL1-4.5: a series configuration of SL1+ SL2+ SL3+ SL4+ SL4.5;
nucleic acid molecules SL1 to 5: a series configuration of SL1+ SL2+ SL3+ SL4+ SL4.5+ SL5;
nucleic acid molecule SL2-5: a series configuration of SL2+ SL3+ SL4+ SL4.5+ SL5;
nucleic acid molecule SL3-5: a series arrangement 5 with SL3+ SL4+ SL4.5+ SL;
nucleic acid molecule SL4-5: a series configuration with SL4+ SL4.5+ SL5;
nucleic acid molecule SL4.5-5: has a series structure of SL4.5+ SL 5.
Further, the nucleic acid against a novel coronavirus further comprises: a series structure of one of SL5a, SL5b, and SL5c and two-by-two combinations among the SL5a, SL5b, and SL5 c; wherein, the SL5a, the SL5b and the SL5c are 3 stem-loop segments of SL5, and the nucleotide sequences are respectively shown as SEQ ID NO 8-SEQ ID NO 10.
Further, the nucleic acid against a novel coronavirus further comprises: a series structure of at least one of SL5a, SL5b and SL5c and at least one of SL1, SL2, SL3, SL4, SL 4.5.
Furthermore, the tandem structures are all connected by using a linker, the linker comprises a sequence contained in the SL full length or a flexible protein linker, and the flexible protein linker is formed by glycine G and serine SFormed (GGGS) n Or (GGGGS) n Or (G) n And n is an integer not less than 1.
Furthermore, the 5' ends of the nucleic acid molecules are added with a motif of a T7 promoter, and the nucleotide sequence of the T7 promoter is shown as SEQ ID NO. 11.
Further, the nucleic acid against a novel coronavirus further comprises: the nucleic acid molecule is modified by at least one modification, the modification comprising at least one of phosphorylation, methylation, amination, thiolation, substitution of oxygen with sulfur, substitution of oxygen with selenium, or isotopolication.
Further, the nucleic acid against a novel coronavirus further comprises: at least one of said nucleic acid molecules having attached thereto a substance for labeling or treatment; the substance for labeling or treatment includes: at least one of a fluorescent marker, a radioactive substance, a therapeutic substance, biotin, digoxin, a nano-luminescent material, a small peptide, and siRNA.
In a second aspect of the invention, there is provided a method for the in vitro preparation of said nucleic acid against a novel coronavirus, said method comprising:
adding a T7 or SP6 motif to the 5' end of the nucleotide of the nucleic acid molecule, and amplifying by PCR to obtain cDNA of the nucleic acid molecule;
and (3) carrying out in vitro transcription on the cDNA of the nucleic acid molecule to obtain the nucleic acid for resisting the novel coronavirus.
In a specific embodiment, a T7 or SP6 motif can be added to the 5' end of the SL nucleotide by a kit, and the T7 or SP6 promoter can be used to transcribe in vitro nucleic acid against the novel coronavirus according to the method of the kit. The nucleotide sequence of the T7 promoter is shown as SEQ ID NO. 11.
In a third aspect of the present invention, there is provided a pharmaceutical composition against a novel coronavirus, the pharmaceutical composition comprising:
an effective amount of a pharmacologically acceptable nucleic acid against said novel coronavirus;
and a pharmaceutically acceptable carrier.
In the fourth aspect of the invention, the application of the nucleic acid resisting the novel coronavirus and the pharmaceutical composition resisting the novel coronavirus in the preparation of the therapeutic medicine for SARS-CoV-2 is provided.
Further, the mechanism of the therapeutic drug for SARS-CoV-2 is that the nucleic acid against the novel coronavirus and the pharmaceutical composition against the novel coronavirus are used for inhibiting the protein synthesis of SARS-CoV-2.
One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:
the invention provides a nucleic acid for resisting a novel coronavirus, a pharmaceutical composition and an application thereof, wherein the nucleic acid for resisting the novel coronavirus comprises a plurality of nucleic acid molecules, the sequences of the nucleic acid molecules can form a Stem-loop (SL), after the nucleic acid is transferred into a cell, the SL can target NSP1 and inhibit the synthesis of virus protein so as to inhibit the replication of the virus, and a new thought and a new scheme can be provided for treating SARS-CoV-2 patients.
Drawings
In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on the drawings without creative efforts.
FIG. 1 is a schematic diagram of tandem design of nucleic acids SL;
FIG. 2 is a schematic diagram of the viral genome escape of the NSP1 translational repression function;
FIG. 3 is a graph showing the translation inhibitory function of viral genome escape NSP 1; FIG. 3A shows the inhibition of host gene expression by NSP1 (reported as CMV-renilla activity), and FIG. 3B shows the translation inhibition of viral genome escape NSP1 (reported as 5' UTR-luciferase activity)
FIG. 4 is the effect of different tandem forms of SL on the expression activity of the viral 5'UTR promoter (reported as the activity of 5' UTR-luciferase);
FIG. 5 shows that SL inhibits SARS-CoV-2 virus N protein expression (reported as activity of 5' UTR-N);
FIG. 6 shows the result of suppression of virus 5' UTR promoter N protein expression by a SL5 truncated small stem-loop nucleotide;
FIG. 7 shows that SL5 inhibits protein expression of SARS-CoV-2 live virus;
FIG. 8 is a pattern diagram of each fragment of the stem loop of the full-length nucleic acid SL.
Detailed Description
The present invention will be described in detail below with reference to specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly apparent therefrom. It will be understood by those skilled in the art that these specific embodiments and examples are provided to illustrate the invention, and not to limit the invention.
Throughout the specification, unless otherwise specifically noted, terms used herein should be understood as having meanings as commonly used in the art. Accordingly, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is a conflict, the present specification will control.
Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or can be obtained by an existing method.
In order to solve the technical problems, the general idea of the embodiment of the application is as follows:
the prior art discloses that SARS-CoV-2 is a single strand positive strand RNA virus with enveloped genome size varying from 29.8kb to 29.9kb, belonging to the genus beta of the coronavirus family. Two large overlapping open reading frames (ORF 1a and ORF1 b) and various structural and non-structural auxiliary proteins are encoded in SARS-CoV-2 genome gene 1. After infection, SARS-CoV-2 hijacks the translation machinery of the host cell, synthesizing ORF1a and ORF1b polyproteins, which are subsequently cleaved by protease hydrolysis into 16 mature non-structural proteins, namely NSP1 to NSP16. Among them, NSP1 is an important virulence factor of coronavirus, and through direct binding with 40S small ribosome subunit, effectively inhibits translation of host mRNA, and plays an important role in inhibiting host gene expression, promoting virus replication and immune evasion. On the other hand, NSP1 can promote translation by binding to the 5' UTR of SARS-CoV-2. NSP1 is therefore a potential therapeutic target for limiting the replication of SARS-CoV-2.
The invention takes NSP1 as a target spot, discovers a plurality of nucleic acids, the nucleic acid sequence can form Stem-loop Structure (SL), after the Stem-loop structure is transferred into cells, the SL can target NSP1, inhibit the synthesis of virus protein and further inhibit the replication of virus, and can provide a new thought and scheme for treating SARS-CoV-2 patients. Specifically, the method comprises the following steps:
the Applicant has first found that the nucleic acid molecule 1: has a nucleotide sequence shown as SEQ ID NO. 1; the stem-loop structure SL can be formed to inhibit the synthesis of virus protein and further inhibit the replication of virus, and comprises 6 stem-loop segments of SL1, SL2, SL3, SL4, SL4.5 and SL5;
subsequently, the applicant has experimentally found that the individual SL1, SL2, SL3, SL4, SL4.5 and SL5 nucleic acid molecules and the concatemerization thereof with different lengths can form stem-loop structures to inhibit the synthesis of viral proteins and further inhibit the replication of viruses, such as SL1+ SL2, SL1+ SL2+ SL3+ SL4+ SL4.5, SL2+ SL3+ SL4+ SL4.5+ SL5, SL3+ SL4+ SL4.5+ SL5, SL4+ SL4.5+ SL5 and SL4.5+ SL5, respectively.
Therefore, one or any combination of more than one of the above nucleic acid molecules can be used as a nucleic acid drug against the novel coronavirus.
The details of a novel coronavirus resistant nucleic acid, its pharmaceutical composition and its application are described in the following examples and experimental data.
Example 1 tandem design of Stem-Loop structures and in vitro Synthesis
1. Stem-loop SL nucleotide tandem design
As shown in FIG. 1, six RNA sequences named SL1, SL2, SL3, SL4, SL4.5 and SL5 are constructed and serially connected in different lengths, namely SL1+ SL2, SL1+ SL2+ SL3, SL1+ SL2+ SL3+ SL4, SL1+ SL2+ SL3+ SL4+ SL4.5, SL2+ SL3+ SL4+ SL4.5+ SL5, SL3+ SL4+ SL4.5, SL4+ SL4.5+ SL5, SL4+ SL4.5, SL4.5+ SL5, SL1-2, SL1-3, SL1-4, SL1-4.5, SL1-5, SL2-5, SL3-5, SL4-5, SL4.5-5.
2. In vitro synthesis of stem-loop SL nucleotide tandem
(1) Obtaining cDNA of each stem-loop SL nucleotide
As shown in the following table, the T7 promoter motif TAATACGACTCACTATAGGG (SEQ ID NO: 11) was added to the 5' end of the SL nucleotides of different tandem lengths as described above and was entrusted to the synthesis by Scobiology Biotechnology Inc. The sp6 motif ATTTAGGTGACACTATAGAAGGNG (SEQ ID NO: 12) may also be used in other embodiments; and respectively obtaining the cDNA of SL1, SL2, SL3, SL4, SL4.5, SL5, SL1-SL2, SL1-SL3, SL1-SL4, SL1-SL4.5, SL1-SL5, SL2-SL5, SL3-SL5, SL4-SL5 and SL4.5-SL5 by PCR amplification by taking the synthesized SL sequence as a template.
The primer pairs used are shown in table 1:
TABLE 1 amplification of cDNA corresponding primers
| cDNA sequence of interest | Upstream primer | Downstream primer |
| SL1 | SL1 F | SL1 R |
| SL2 | SL2 F | SL2 R |
| SL3 | SL3 F | SL3 R |
| SL4 | SL4 F | SL4 R |
| SL4.5 | SL4.5 F | SL4.5 R |
| SL5 | SL5 F | SL5 R |
| SL1-SL2 | SL1 F | SL2 R |
| SL1-SL3 | SL1 F | SL3 R |
| SL1-SL4 | SL1 F | SL4 R |
| SL1-SL4.5 | SL1 F | SL4.5 R |
| SL1-SL5 | SL1 F | SL5 R |
| SL2-SL5 | SL2 F | SL5 R |
| SL3-SL5 | SL3 F | SL5 R |
| SL4-SL5 | SL4 F | SL5 R |
| SL4.5-SL5 | SL4.5 F | SL5 R |
TABLE 2 primers
The PCR reaction system is shown in Table 3:
TABLE 3
| Composition (A) | |
| ddH 2 O | 32μL |
| Upstream primer | 1μL |
| Downstream primer | 1μL |
| 10xPCR buffer | 5μL |
| dNTP | 5μL |
| MgSO 4 | 3μL |
| SARS-CoV-2 genome | 1μL |
| KOD-plus-neo | 1μL |
PCR reaction procedure: enter cycle after 2min at 94 ℃,2 min: 10s at 98 ℃; 30s at 55 ℃;68 ℃ for 30s. For a total of 35 cycles, then stored at 4 ℃. The cDNA for each SL nucleotide was subsequently recovered by DNA agarose electrophoresis. Then through OMEGA e.z.n.a.
Gel Extraction Kit, purification of the cDNA obtained above, the procedure was as follows:
(1) add 100. Mu.L binding buffer and 100. Mu.L PCR product to EP tube, mix well, add the mixture to adsorption column, centrifuge for 1min at maximum number of revolutions, discard waste liquid.
(2) Adding 300 μ L binding buffer into the adsorption column, centrifuging at maximum revolution for 1min, and discarding the waste liquid.
(3) Adding 700. Mu.L of SPW buffer into the adsorption column, centrifuging at maximum revolution for 1min, and discarding the waste liquid.
(4) Repetition (3)
(5) The adsorption column was replaced with the collection tube and centrifuged at maximum for 1min.
(6) The adsorption column was placed in a new 1.5mL centrifuge tube, 20. Mu.L of Elution buffer was added dropwise to the column, allowed to stand at room temperature for 2min, and centrifuged at maximum rpm for 1min.
(2) The RNA sequence corresponding to each cDNA can be obtained by in vitro Transcription of the purified cDNA by using a full-scale gold T7 High Efficiency Transcription Kit, and the reaction system and the steps are as follows:
TABLE 4
| Composition (A) | |
| Form panel | 1μg |
| 5xT7 buffer | 4μL |
| NTP Mix | 8μL |
| T7 Transcripton Reation Buffer | 2μL |
| ddH 2 O | 5μL |
Mixing, incubating at 37 deg.C for 2h, adding 1 μ L DNase I, reacting at 37 deg.C for 15min, adding 1 μ L500 mM EDTA (pH 8.0) to terminate the reaction to obtain RNA;
the RNA obtained in the above step needs further purification, and the operation steps are as follows:
(1) adding phenol: chloroform: isoamyl alcohol volume ratio of 25
(2) Adding 1/10 volume of 5M ammonium acetate and 2 times volume of absolute ethanol, and standing at-20 deg.C for 15min.
(3) Centrifuging at 13000rpm for 15min at 4 deg.C, discarding supernatant, air drying, adding 100 μ L DEPC water, and storing at-80 deg.C.
Example 2 SL5 leads to transcriptional repression of viral RNA by competitive binding to NSP1
(1) Luciferase reporter System detecting inhibition of protein translation by 5' UTR of NSP1 protein
The document reports that SARS-CoV-2 non-structural protein NSP1 binds to host cell ribosome, prevents the host cell mRNA from entering ribosome, and inhibits the translation of host cell mRNA, as shown in FIG. 2A. However, since the 5' utr of the viral genome forms a stem-loop structure and binds to NSP1, and is released from the ribosome, the viral RNA genome can enter the ribosome and be translated into viral proteins, as shown in fig. 2B. To verify the above functions, a luciferase reporter plasmid with viral 5'UTR as a promoter was designed to mimic viral RNA transcription (5' UTR-luciferase), and a reporter plasmid with CMV promoter was used to mimic cellular mRNA transcription (CMV-renilla), and the co-transferred NSP1 protein was examined for its effect of promoting viral RNA translation and inhibiting host RNA translation. The specific operation is as follows:
293A cells were plated in 24-well plates and when cells grew to 30% -50%, group 1 was co-transfected with 500ng CMV-renilla and 100ng pCAG-unloaded or pCAG-NSP1, and group 2 was co-transfected with 500ng 5' UTR-luciferase and 100ng pCAG-unloaded or pCAG-NSP 1. Fluorescence was measured after incubation at 37 ℃ for 24 h. The experimental result is shown in fig. 3, NSP1 can significantly inhibit the expression of CMV-renilla (fig. 3A), which indicates that NSP1 has significant inhibitory effect on mRNA translation of cells; while NSP1 did not inhibit transcription of the 5'UTR-luciferase reporter plasmid (FIG. 3B), indicating that 5' UTR of viral RNA could escape from the translational inhibition by NSP 1.
(2) Detection of interference function of SL nucleotide on NSP1 translation inhibition
293A cells were plated in 24-well plates, and when the cells grew to 30% -50%, group 1 and group 2 were transfected with 20pmol ncRNA, and group 3-group 18 were transfected with 20pmol stem-loop RNA SL1, SL2, SL3, SL4, SL4.5, SL5, SL1-2, SL1-3, SL1-4, SL1-4.5, SL1-5, SL2-5, SL3-5, SL4-5, SL4.5-5, and cultured at 37 ℃ for 8 hours.
Group 1 co-transferred 500ng 5'UTR-luc and 100ng pCAG, and groups 2-18 co-transferred 500ng 5' UTR-luciferase and 100ng pCAG-NSP 1. Fluorescence was measured after incubation at 37 ℃ for 24 h.
As a result of the experiment, when NSP1 is expressed, the luciferase gene having SARS-CoV-2 virus 5' UTR can escape the protein translation inhibitory action of NSP1, and normal protein expression can be performed. At this time, the fluorescence values of 5'UTR-luciferase were decreased to different extents after transfection of different stem-loop nucleotides SL, and SL5 and different truncated SLs containing SL5 inhibited expression of 5' UTR-luciferase most significantly (as shown in FIG. 4), indicating that the stem-loop nucleotides, particularly SL5, could counteract the translation inhibitory function of 5 UTR escape NSP1, that is, SL5 was inhibited similarly by competitive binding to NSP 1-induced pathogenic RNA, and thus SL5 had a potential function of inhibiting SARS-CoV-2 protein expression.
Example 3 detection of inhibitory Effect of SL on SARS-CoV-2 protein expression
(1) Detecting function of SL nucleotide pairs with different tandem on translation inhibition of 5' UTR-N protein
In order to verify whether or not the SL nucleotide designed according to the present invention inhibits the expression of SARS-CoV-2 protein, an experiment was performed using SARS-CoV-2 structural protein N of 5' UTR promoter.
293A cells were plated in a 24-well plate, and when the cells grew to 30% -50%, 20pmol ncRNA was transfected in group 1 and group 2, 20pmol stem-loop RNA SL1, SL1-2, SL1-3, SL1-4, SL1-4.5, SL1-5, SL2-5, SL3-5, SL4-5, SL4.5-5, SL5 were transfected in group 3-group 13, and cultured at 37 ℃ for 8 hours.
Group 1 co-transferred 500ng 5'UTR-luciferase and 100ng pCAG, and groups 2-13 co-transferred 500ng 5' UTR-N and 100ng pCAG-NSP 1. And culturing at 37 ℃ for 24h, and detecting the expression quantity of the N protein.
As a result, as shown in FIG. 5, in the case of NSP1 expression, the expression level of N protein in the 5'UTR promoter was not affected, but after co-transfection of SL nucleotides in different tandem forms, the expression level of N protein was decreased to a different extent, and particularly, the suppression of 5' UTR-N expression by SL5 or SL nucleotide in tandem with SL5 was most significant. Indicating that SL5 can significantly inhibit the N protein expression of the 5' UTR promoter; nucleotide SL (SL 1-5, SL2-5, SL3-5, SL4-5, SL4.5-5) in tandem with SL5 has the function of inhibiting N protein expression of 5' UTR promoter.
(2) Detection of function of SL5 truncated stem-loop RNA to translational inhibition of 5' UTR-N protein
In order to verify whether the SL5 nucleotide-truncated stem-loop RNAs (i.e., SL5a, SL5b, SL5 c) designed according to the present invention inhibit the expression of SARS-CoV-2 protein, experiments were performed using SARS-CoV-2 structural protein N of 5' UTR promoter in the present example.
The 293A cells were plated on a 24-well plate, and when the cells grew to 30% -50%, 100ng pCAG-NSP1 was transfected into each group, and at the same time, 20pmol ncRNA was transfected into group 1, and 2 pmol SL5, SL5a, SL5b, SL5c, and N protein expression was measured after culturing at 37 ℃ for 24 hours in each of experimental group 2 to group 5.
As shown in FIG. 6, in the case of NSP1 expression, the expression level of the N protein in 5' UTR of the transfected ncRNA group was not affected, while the expression level of the N protein was significantly decreased after co-transfection of SL5; similarly, 5' UTR-N expression after co-transfection with truncated nucleotides SL5a, SL5b, SL5c of SL5 was also significantly reduced. It was shown that the truncated nucleotides of SL5 and SL5 have a function of inhibiting the expression of N protein from the 5' UTR promoter.
(3) Detection of the inhibitory Effect of SL5 on the protein expression of SARS-CoV-2 live Virus
In order to further verify whether the SL5 designed by the present invention inhibits the protein expression of the SARS-CoV-2 live virus, in this embodiment, different doses of SL5 are used to transfect Vero-E6-ACE2 cells, then the cells are infected with the SARS-CoV-2 live virus, and the expression of the virus N protein and S protein in the cell lysis solution is detected, specifically, the following operations are performed:
293A cells were plated in 24-well plates, and when the cells grew to 30% -50%, group 1 was left untreated, group 2 was transfected with 200pmol ncRNA, and groups 3-5 were transfected with 50pmol, 100pmol, and 200pmol stem-loop RNA SL5, respectively, and cultured at 37 ℃ for 8h.
Subsequently, the cell culture plate was transferred to ABSL-3 laboratory and infected with SARS-CoV-2 with MOI =0.01, and after further culturing for 24 hours, the cells were collected, 2x SDS loading buffer was added, and 100 ℃ metal bath was carried out for 15min, and then the expression of SARS-CoV-2N protein and S protein was analyzed by western blot.
The experimental results are shown in FIG. 6, after SARS-CoV-2 infection of the cell transfected with the control ncRNA, the expression of the viral N protein and S protein is not affected, while after SARS-CoV-2 infection of the cell transfected with different dosage of SL5, the expression of the viral N protein and S protein is inhibited by SL5 dosage dependently, which shows that SL5 has the function of inhibiting the expression of SARS-CoV-2 live virus protein and is a potential nucleic acid drug for inhibiting the replication of SARS-CoV-2.
The results of the experiments in FIG. 5 and FIG. 6 show that other stem-loop structures such as SL1-5, SL2-5, SL3-5, SL4-5, and SL4.5-5 have the effect of inhibiting the expression of SARS-CoV-2 protein. This shows that other SL nucleotides in tandem with SL5 all have the function of inhibiting the expression of SARS-CoV-2 protein, and are potential nucleic acid drugs for inhibiting the replication of SARS-CoV-2.
Finally, it should also be noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.
While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.
It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.
Sequence listing
<110> Wuhan university
<120> anti-novel coronavirus nucleic acid, pharmaceutical composition and application thereof
<160> 24
<170> SIPOSequenceListing 1.0
<210> 1
<211> 300
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
auuaaagguu uauaccuucc cagguaacaa accaaccaac uuucgaucuc uuguagaucu 60
guucucuaaa cgaacuuuaa aaucugugug gcugucacuc ggcugcaugc uuagugcacu 120
cacgcaguau aauuaauaac uaauuacugu cguugacagg acacgaguaa cucgucuauc 180
uucugcaggc ugcuuacggu uucguccgug uugcagccga ucaucagcac aucuagguuu 240
cguccgggug ugaccgaaag guaagaugga gagccuuguc ccugguuuca acgagaaaac 300
<210> 2
<211> 39
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
auuaaagguu uauaccuucc cagguaacaa accaaccaa 39
<210> 3
<211> 15
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gaucucuugu agauc 15
<210> 4
<211> 15
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
guucucuaaa cgaac 15
<210> 5
<211> 44
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cuguguggcu gucacucggc ugcaugcuua gugcacucac gcag 44
<210> 6
<211> 17
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
uaauuaauaa cuaauua 17
<210> 7
<211> 145
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ucguugacag gacacgagua acucgucuau cuucugcagg cugcuuacgg uuucguccgu 60
guugcagccg aucaucagca caucuagguu ucguccgggu gugaccgaaa gguaagaugg 120
agagccuugu cccugguuuc aacga 145
<210> 8
<211> 31
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ggcugcuuac gguuucgucc guguugcagc c 31
<210> 9
<211> 25
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
cacaucuagg uuucguccgg gugug 25
<210> 10
<211> 10
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
accgaaaggu 10
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
taatacgact cactataggg 20
<210> 12
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
atttaggtga cactatagaa gng 23
<210> 13
<211> 59
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
taatacgact cactataggg attaaaggtt tataccttcc caggtaacaa accaaccaa 59
<210> 14
<211> 59
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
ttggttggtt tgttacctgg gaaggtataa acctttaatc cctatagtga gtcgtatta 59
<210> 15
<211> 51
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
taatacgact cactataggg gatctcttgt agatctgttc tctaaacgaa c 51
<210> 16
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
gatctacaag agatccccta tagtgagtcg tatta 35
<210> 17
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
taatacgact cactataggg gttctctaaa cgaac 35
<210> 18
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
gttcgtttag agaaccccta tagtgagtcg tatta 35
<210> 19
<211> 64
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
taatacgact cactataggg ctgtgtggct gtcactcggc tgcatgctta gtgcactcac 60
gcag 64
<210> 20
<211> 64
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
ctgcgtgagt gcactaagca tgcagccgag tgacagccac acagccctat agtgagtcgt 60
atta 64
<210> 21
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
taatacgact cactataggg taattaataa ctaatta 37
<210> 22
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
taattagtta ttaattaccc tatagtgagt cgtatta 37
<210> 23
<211> 54
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
taatacgact cactataggg tcgttgacag gacacgagta actcgtctat cttc 54
<210> 24
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
tcgttgaaac cagggacaag gctctccatc ttacctttcg gtcacacccg 50
Claims (8)
1. A nucleic acid pharmaceutical composition against a novel coronavirus, comprising: an effective amount of a pharmacologically acceptable anti-novel coronavirus nucleic acid and a pharmaceutically acceptable carrier;
the anti-novel coronavirus nucleic acid can form a stem-loop structure and resist viruses by inhibiting protein synthesis of SARS-CoV-2; the anti-novel coronavirus nucleic acid comprises at least one of the following nucleic acid molecules:
nucleic acid molecule SL: is a nucleotide sequence shown as SEQ ID NO. 1; a stem-loop structure SL can be formed comprising 6 stem-loop segments SL1, SL2, SL3, SL4, SL4.5 and SL5;
nucleic acid molecule SL1: is a nucleotide sequence shown as SEQ ID NO. 2 and can form a stem-loop structure SL1;
nucleic acid molecule SL2: is a nucleotide sequence shown as SEQ ID NO. 3 and can form a stem-loop structure SL2;
nucleic acid molecule SL3: is a nucleotide sequence shown as SEQ ID NO. 4 and can form a stem-loop structure SL3;
nucleic acid molecule SL4: is a nucleotide sequence shown as SEQ ID NO. 5 and can form a stem-loop structure SL4;
nucleic acid molecule SL4.5: is a nucleotide sequence shown as SEQ ID NO. 6 and can form a stem-loop structure SL4.5;
nucleic acid molecule SL5: is a nucleotide sequence shown as SEQ ID NO. 7 and can form a stem-loop structure SL5;
nucleic acid molecule SL1-2: is a series structure of SL1+ SL2;
nucleic acid molecules SL1-3: is a series structure of SL1+ SL2+ SL3;
nucleic acid molecules SL1-4: is a series structure of SL1+ SL2+ SL3+ SL4;
nucleic acid molecule SL1-4.5: is a series structure of SL1+ SL2+ SL3+ SL4+ SL4.5;
nucleic acid molecules SL1 to 5: is a series structure of SL1+ SL2+ SL3+ SL4+ SL4.5+ SL5;
nucleic acid molecule SL2-5: is a series structure of SL2+ SL3+ SL4+ SL4.5+ SL5;
nucleic acid molecule SL3-5: is a series structure with SL3+ SL4+ SL4.5+ SL5;
nucleic acid molecule SL4-5: is a series structure of SL4+ SL4.5+ SL5;
nucleic acid molecule SL4.5-5: is a series structure of SL4.5+ SL 5.
2. The anti-neocoronavirus nucleic acid pharmaceutical composition of claim 1, wherein the anti-neocoronavirus nucleic acid further comprises: inner stem-loop of stem-loop structure SL5: one of SL5a, SL5b and SL5c, and a tandem structure of two-by-two combinations among the SL5a, SL5b and SL5 c; wherein, the SL5a, the SL5b and the SL5c are 3 stem-loop segments of SL5, and the nucleotide sequences are respectively shown as SEQ ID NO 8-SEQ ID NO 10.
3. The anti-neocoronavirus nucleic acid pharmaceutical composition of claim 2, wherein the anti-neocoronavirus nucleic acid further comprises: a series structure of at least one of SL5a, SL5b and SL5c and at least one of SL1, SL2, SL3, SL4, SL 4.5.
4. The nucleic acid pharmaceutical composition against novel coronavirus according to any one of claims 1-3, wherein the tandem structures are connected by a linker, the linker comprises a sequence contained in the full length of SL or a flexible protein linker, the flexible protein linker is (GGGS) n or (GGGGS) n or (G) n consisting of glycine G and serine S, and n is an integer of more than or equal to 1.
5. The nucleic acid pharmaceutical composition against a novel coronavirus of claim 1, wherein the nucleic acid against a novel coronavirus further comprises: the nucleic acid molecule is modified by at least one modification, including at least one of phosphorylation, methylation, amination, sulfhydrylation, substitution of oxygen with sulfur, substitution of oxygen with selenium, or isotyping.
6. The anti-neocoronavirus nucleic acid pharmaceutical composition of claim 5, wherein the anti-neocoronavirus nucleic acid further comprises: at least one of the nucleic acid molecules is linked with a substance for labeling or treatment; the substance for labeling or treatment includes: at least one of a fluorescent marker, a radioactive substance, a therapeutic substance, biotin, digoxin, a nano-luminescent material, a small peptide, and siRNA.
7. Use of the nucleic acid pharmaceutical composition against the novel coronavirus according to any one of claims 1-6 for the preparation of a therapeutic agent for SARS-CoV-2.
8. The use according to claim 7, wherein the mechanism of the therapeutic agent for SARS-CoV-2 is that the anti-novel coronavirus nucleic acid and the anti-novel coronavirus pharmaceutical composition are used for inhibiting the protein synthesis of SARS-CoV-2.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110815075.5A CN113684210B (en) | 2021-07-19 | 2021-07-19 | Anti-novel coronavirus nucleic acid, and pharmaceutical composition and application thereof |
| PCT/CN2022/106058 WO2023001080A1 (en) | 2021-07-19 | 2022-07-15 | Nucleic acid against novel coronavirus, and pharmaceutical composition and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110815075.5A CN113684210B (en) | 2021-07-19 | 2021-07-19 | Anti-novel coronavirus nucleic acid, and pharmaceutical composition and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113684210A CN113684210A (en) | 2021-11-23 |
| CN113684210B true CN113684210B (en) | 2022-12-30 |
Family
ID=78577423
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110815075.5A Active CN113684210B (en) | 2021-07-19 | 2021-07-19 | Anti-novel coronavirus nucleic acid, and pharmaceutical composition and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN113684210B (en) |
| WO (1) | WO2023001080A1 (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112029781B (en) * | 2020-08-14 | 2023-01-03 | 中山大学 | Novel coronavirus SARS-CoV-2 safety replicon system and application thereof |
| CN113684210B (en) * | 2021-07-19 | 2022-12-30 | 武汉大学 | Anti-novel coronavirus nucleic acid, and pharmaceutical composition and application thereof |
| CN114672591B (en) * | 2022-01-11 | 2022-11-01 | 湖北省疾病预防控制中心（湖北省预防医学科学院） | Primer group and kit for identifying novel coronavirus and application of primer group and kit |
| WO2024059910A1 (en) * | 2022-09-21 | 2024-03-28 | Newsouth Innovations Pty Limited | Antiviral sirna therapeutic for sars-cov-2 |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102272800B1 (en) * | 2020-06-30 | 2021-07-05 | 국방과학연구소 | Coronavirus specific siRNA and a composition for preventing and treating coronavirus infection-19 comprising the same |
| CN113684210B (en) * | 2021-07-19 | 2022-12-30 | 武汉大学 | Anti-novel coronavirus nucleic acid, and pharmaceutical composition and application thereof |
-
2021
- 2021-07-19 CN CN202110815075.5A patent/CN113684210B/en active Active
-
2022
- 2022-07-15 WO PCT/CN2022/106058 patent/WO2023001080A1/en unknown
Non-Patent Citations (4)
| Title |
|---|
| An intranasal ASO therapeutic targeting SARS-CoV-2;Chi Zhu等;《bioRxiv》;20210518;表1和第2-4、8页 * |
| Chi Zhu等.An intranasal ASO therapeutic targeting SARS-CoV-2.《bioRxiv》.2021, * |
| Secondary structure of the SARS-CoV-2 5"-UTR;Zhichao Miao等;《RNA Biol》;20210430;第18卷(第4期);图6 * |
| Structure of the SARS-CoV-2 Nsp1/5’-Untranslated Region Complex and Implications for Potential Therapeutic Target, a Vaccine, and Virulence;Naveen Vankadari等;《J Phys Chem Lett》;20201102;摘要和第9666页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2023001080A1 (en) | 2023-01-26 |
| CN113684210A (en) | 2021-11-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113684210B (en) | Anti-novel coronavirus nucleic acid, and pharmaceutical composition and application thereof | |
| Das et al. | Circular RNAs in myogenesis | |
| Gruber et al. | Ars2 promotes proper replication-dependent histone mRNA 3′ end formation | |
| Zhang et al. | Circular intronic long noncoding RNAs | |
| Jia et al. | miR-16 controls myoblast proliferation and apoptosis through directly suppressing Bcl2 and FOXO1 activities | |
| EP2123752A2 (en) | Novel nucleic acid | |
| EP2077326A1 (en) | Novel nucleic acid | |
| Lin et al. | HuR and Ago2 bind the internal ribosome entry site of enterovirus 71 and promote virus translation and replication | |
| Tagawa et al. | Characterizing expression and regulation of gamma-herpesviral circular RNAs | |
| Li et al. | Interferon-stimulated genes inhibit caprine parainfluenza virus type 3 replication in Madin-Darby bovine kidney cells | |
| Basavappa et al. | The lncRNA ALPHA specifically targets chikungunya virus to control infection | |
| CN111378664B (en) | Circular RNA and application thereof | |
| US6448000B1 (en) | Mammalian genes involved in viral infection and tumor suppression | |
| Wang et al. | MiR-CLIP reveals iso-miR selective regulation in the miR-124 targetome | |
| CN111454954A (en) | shRNA for inhibiting expression of porcine epidemic diarrhea virus M gene, recombinant expression vector and application thereof | |
| US10457938B2 (en) | TTV miRNA sequences as an early marker for the future development of cancer and as a target for cancer treatment and prevention | |
| CN115786374B (en) | Method for precisely preparing circular RNA by utilizing anabaena introns self-cleaving ribozyme | |
| Meseguer et al. | SARS-CoV-2-encoded small RNAs are able to repress the host expression of SERINC5 to facilitate viral replication | |
| US10487328B2 (en) | Blocking Hepatitis C Virus infection associated liver tumor development with HCV-specific antisense RNA | |
| Wightman et al. | Influence of RNA circularity on Target RNA-Directed MicroRNA Degradation | |
| CN112063620A (en) | shRNA for inhibiting expression of porcine epidemic diarrhea virus M gene | |
| CN111549028A (en) | shRNA and application thereof | |
| Zhang et al. | Downregulation of miR-122 by porcine reproductive and respiratory syndrome virus promotes viral replication by targeting SOCS3 | |
| CN112375758B (en) | Anti-hantavirus antisense nucleic acid sequence and application thereof | |
| CN113817729B (en) | siRNA for inhibiting novel coronavirus (CoV 19) and composition and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |