CN113637674A

CN113637674A - LAMP2 mutant gene, mutant and Danon disease detection kit

Info

Publication number: CN113637674A
Application number: CN202110934388.2A
Authority: CN
Inventors: 刘哲; 梁庆渊; 赵娜娜; 赖开生; 刘昕超; 高璇; 李方玉; 侯青; 惠汝太
Original assignee: Bestnovo Beijing Medical Technology Co Ltd
Current assignee: Bestnovo Beijing Medical Technology Co Ltd
Priority date: 2021-08-16
Filing date: 2021-08-16
Publication date: 2021-11-12
Anticipated expiration: 2041-08-16
Also published as: CN113637674B

Abstract

The invention relates to the technical field of human genetics and cardiovascular in internal medicine, in particular to a LAMP2 mutant gene, wherein a base T is mutated into A at a genome position chrX: 119575687. The invention also relates to a LAMP2 mutant with p.Cys331Ser mutation. The invention also relates to a Danon disease detection kit. The LAMP2 mutant gene provided by the invention can distinguish Danon patients from normal people, and can be used as a biomarker for clinical auxiliary diagnosis of Danon diseases; the carrier for detecting the variation can provide bearing and rearing guidance and genetic counseling for the testee and reduce the birth of the infant; provides possible drug targets for overcoming the Danon disease of human beings and promotes the research and development of innovative drugs.

Description

LAMP2 mutant gene, mutant and Danon disease detection kit

Technical Field

The invention relates to the technical field of human genetics and cardiovascular in internal medicine, in particular to a LAMP2 mutant gene, a LAMP2 mutant and a Danon disease detection kit.

Background

In 1981, Danon et al first reported two cases of non-infarct Hypertrophic Cardiomyopathy (HCM), which was called "acid maltase normal lysosomal glycogen storage disease" and was hereafter named Danon disease. Danon disease is an X-linked dominant genetic lysosome disease, and takes the triple symptoms of hypertrophic cardiomyopathy, skeletal myopathy and intellectual disturbance as main clinical manifestations, and the cardiomyopathy caused by the Danon disease is similar to the typical hypertrophic cardiomyopathy. The male has more and early onset of diseases, hypertrophic cardiomyopathy, myasthenia and hypophrenia gradually appear, and eyeground pigment retinopathy appears in part of patients; female patients typically develop cardiomyopathy after adulthood with occasional mild muscle weakness.

Mutations in the gene encoding the lysosome-associated membrane protein type ii (LAMP 2) are the major cause of Danon's disease. With the year 2000, after the LAMP2 gene mutation is reported for the first time by Nishino et al to cause Danon disease, a plurality of mutation sites of LAMP2 gene are discovered in sequence. Because the clinical change of the Danon disease has no specificity, no clinical symptoms, sudden cardiac death and more symptoms involving multiple systems in the whole body and difficult prevention, the gene detection becomes a main means for diagnosing the Danon disease, and the discovery of any mutation site of LAMP2 is an important technical contribution to the field.

Disclosure of Invention

The present invention aims to provide a LAMP2 mutant gene and mutant, and a kit for detecting Danon's disease, in view of the above-mentioned drawbacks.

By analyzing the family members of the Danon disease, the invention unexpectedly discovers that the Danon disease patients in the family have the following mutations:

the sequence of the CDS region of wild-type LAMP2 is SEQ ID NO: 1. The amino acid sequence of the protein coded by the wild-type LAMP2 gene is SEQ ID NO. 2. c.991T > A indicates: in the CDS region of the wild-type LAMP2, the 991 th base T is mutated into a base A; cys331ser represents: the LAMP2 mutant gene encodes a protein with the 331 st amino acid changed from cysteine (Cys or C) to serine (Ser or S).

At the genome position chrX 119575652-chrX 119575701, the sequence of the wild-type LAMP2 is SEQ ID NO 3, and the specific sequence is GAAGTTCTTATATGTGCAACAAAGAGCAGACTGTTTCAGTGTCTGGAGCA, whereinTIs a pre-mutation base. The sequence of the LAMP2 mutant gene is SEQ ID NO. 4, and the specific sequence is as follows:

GAAGTTCTTATATGAGCAACAAAGAGCAGACTGTTTCAGTGTCTGGAGCA, whereinAIs a post-mutation base.

Based on the above findings, the technical scheme provided by the invention is as follows:

the invention provides a LAMP2 mutant gene, wherein a base T is mutated into A at a genome position chrX 119575687; the reference genomic version is GRCh 37.

The invention also provides the LAMP2 mutant with p.Cys331Ser mutation.

The mutation was found to be a rare mutation by querying the population frequency database (thousand genomes: none, ESP 6500: none, ExAC: none). The variation was not carried by both the cardiomyocytes and the control population in the Baishano local cohort database. A plurality of biological information prediction software (including SIFT, Polyphen-2 and the like) are subjected to cross prediction, the results are mostly harmful (SIFT is 'D', Polyphen-2 is 'D', MutationTaster _ pred is 'D', VEST3 is scored as '0.435', and the others are '4D/1M/1T'), and the amino acid is changed from cysteine without charge of polarity into serine without charge of polarity, which indicates that the amino acid change caused by the mutation possibly influences the protein function. The database was queried to find that the amino acid at this position was highly conserved in vertebrates. Querying ClinVar and HGMD databases to find no variation, and evaluating missense variation p.Trp321Arg near the site as the pathogenic mutation of Danon disease by a reporter (ClinVar database); the literature search does not find the mutation and disease related report. According to the existing evidence: the mutation is a rare variation, and software predicts that the variation may have an influence on protein function, and the amino acid at the position is highly conserved in vertebrates, but lacks family linkage and functional evidence support, so the variation is suspicious pathogenic variation.

The invention also provides application of the LAMP2 mutant gene in preparation of a Danon disease detection kit.

The invention also provides application of the LAMP2 mutant in preparation of a Danon disease detection kit.

The invention also provides a Danon disease detection kit, which comprises a reagent for detecting LAMP2 mutant genes and/or LAMP2 mutants, wherein at the genome position chrX:119575687, the base T is mutated into A5687, and the base T is mutated into A; the LAMP2 mutant has a p.cys331ser mutation.

Preferably, the primer also comprises a forward primer and a reverse primer, wherein the sequence of the forward primer is SEQ ID NO. 5, and the sequence of the reverse primer is SEQ ID NO. 6.

The beneficial effects of the invention are as follows:

danon disease belongs to a rare neuroendocrine tumor, and patients with heterozygous missense variation of mutation of base T to A (namely LAMP2 mutant gene c.991T > A) at genome position chrX:119575687 can involve adrenal glands, so that pheochromocytoma is generated and transmitted in families in a mode of dominant inheritance of a common chromosome, and the inheritance probability is 50%. The LAMP2 mutant gene and the LAMP2 mutant can be used as biomarkers for clinical auxiliary diagnosis of the Danon disease, provide possible drug targets for the human beings to overcome the Danon disease and promote the research and development of innovative drugs; the detection kit for the Danon disease developed based on the LAMP2 mutant gene and the LAMP2 mutant can distinguish Danon patients from normal people, can provide prenatal and postnatal care guidance and genetic counseling for a subject, and reduces the birth of children patients.

Drawings

FIG. 1 is a drawing of a Danon patient family;

FIG. 2 is a Sanger sequencing graph of proband and Cologe;

FIG. 3 is a plot of the sequencing of non-diseased members of Sanger in the pedigree.

Detailed Description

The following is further detailed by way of specific embodiments:

example 1 proband verification experiment

Sample source: in the first-person hospital in Changzhou city, 5-10mL of whole blood sample is sent under the premise that the proband (31 years old) and the family members voluntarily sign informed consent, a medical record database is established, and the data of the disease condition, family condition and the like of the proband are recorded in detail. The study was approved by the ethical committee of the unit.

Clinical profile of proband:

TABLE 1 clinical profiles of probands

The method adopts Sanger sequencing method to carry out gene detection on LAMP2 genes of proband and the family members thereof, and comprises the following specific steps:

s1, extracting genome DNA;

the whole genome DNA extraction reagent of the magnetic bead method whole genome DNA extraction reagent of Jiangsu Baishinuo medical science and technology Limited company is adopted to extract the whole genome DNA of the anticoagulation sample of the human whole blood EDTA of the proband and the family members thereof, and the concentration and the purity of the DNA are detected.

S2, amplifying the LAMP2 gene by using the designed primer combination;

(1) the PCR amplification reagents were prepared, and the compositions of the PCR amplification reagents are specifically shown in the following Table 2:

TABLE 2 composition of PCR amplification reagents

2 × Taq MasterMix (Dye) contains the following components: taq DNA Polymerase, PCR Buffer, Mg² ⁺dNTPs, a PCR stabilizer, an enhancer and other components required by conventional PCR; the concentration of the forward primer and the reverse primer were 10. mu. mol/L.

The primer information required for amplification is shown in table 3 below:

TABLE 3 primer information

Sequence numbering	Primer name	Sequence (5 '→ 3')
			SEQ ID NO:5	Forward primer (LAMP2-E8F1)	AGGCCTTCACTGAAAAACCCTGA
SEQ ID NO:6	Reverse primer (LAMP2-E8R1)	TGCTGCTCCCAAGTGCCAT

(2) Amplification of a fragment of interest

Mixing the reaction system, and carrying out amplification reaction of the target gene fragment on a PCR instrument, wherein the amplification procedure is as follows: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 30s, annealing at 61 ℃ for 30s, and extension at 72 ℃ for 30s for 30 cycles. Final extension at 72 ℃ for 2 min.

2 mu L of PCR product is taken, 1.5% agarose gel electrophoresis is used for detecting the PCR product, and 1000bp Marker is selected as reference.

S3, PCR products were sequenced using a 3730XL Genetic Analyzer full-automatic sequencer. The reference sequences and sequencing results were obtained from the NCBI (https:// www.ncbi.nlm.nih.gov /) database and aligned.

The results show that proband carries suspected pathogenic variant LAMP2 gene c.991T > A heterozygous missense variant of Danon disease (LAMP2: p.Cys331Ser het) as shown in FIGS. 1-3. The parents, husband and son of the proband do not carry the LAMP2 gene c.991T > A heterozygosis variation. The Cologe of proband also carries the LAMP2 gene c.991T > A heterozygous missense variation, but neither the wife nor the son of the Cologe of proband carries the LAMP2 gene c.991T > A heterozygous missense variation.

The LAMP2 gene c.991T > A heterozygosis variation has definite pathogenic mutation, and a follow-up plan is established for carriers in the later period, and genetic counseling related to fertility is provided.

Example 2A Danon disease detection kit

This example provides a kit for detecting human LAMP2 gene c.991T > A heterozygosis variation, including 2 × Taq MasterMix (Dye), primers designed according to LAMP2 mutant gene and/or LAMP2 mutant, and the specific composition of the kit is shown in Table 4 below.

The method for screening the Danon disease by using the kit comprises the following specific steps: the DNA of the subject was extracted according to the procedure of example 1, and then the LAMP2 gene was amplified using the designed primer combinations (SEQ ID NO:5 and SEQ ID NO:6) to obtain a PCR product, and finally the PCR product was sequenced. And obtaining a reference sequence from an NCBI (https:// www.ncbi.nlm.nih.gov /) database, comparing the reference sequence with a sequencing result, judging whether the LAMP2 gene of the testee carries c.991T > A heterozygous missense variation, and assisting the clinical confirmation of whether the testee has the Danon disease.

TABLE 4 kit composition

Example 3 mutation verification against non-familial normal persons

The LAMP2 gene c.991T > A mutation site detection was carried out on 290 ethnic groups of unrelated normal persons (i.e., out-of-family normal persons) according to the method of example 1, and none of the results was able to detect the mutation.

Taken together, based on the results, the c.991T > A heterozygosis variation of the LAMP2 gene can cause the protein coded by the LAMP2 gene to be changed by p.Cys331Ser, while the LAMP2 gene is a known pathogenic gene of the Danon disease, so that the c.991T > A heterozygosis variation of the LAMP2 gene is proved to be a pathogenic mutation of the Danon disease.

The foregoing detailed description of the preferred embodiments of the invention has been presented. It should be understood that numerous modifications and variations could be devised by those skilled in the art in light of the present teachings without departing from the inventive concepts. Therefore, the technical solutions available to those skilled in the art through logic analysis, reasoning and limited experiments based on the prior art according to the concept of the present invention should be within the scope of protection defined by the claims.

Sequence listing

<110> Baishinuo (Beijing) medical science and technology Co., Ltd

<120> LAMP2 mutant gene, mutant and Danon disease detection kit

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1236

<212> DNA

<213> Homo sapiens

<400> 1

atggtgtgct tccgcctctt cccggttccg ggctcagggc tcgttctggt ctgcctagtc 60

ctgggagctg tgcggtctta tgcattggaa cttaatttga cagattcaga aaatgccact 120

tgcctttatg caaaatggca gatgaatttc acagtacgct atgaaactac aaataaaact 180

tataaaactg taaccatttc agaccatggc actgtgacat ataatggaag catttgtggg 240

gatgatcaga atggtcccaa aatagcagtg cagttcggac ctggcttttc ctggattgcg 300

aattttacca aggcagcatc tacttattca attgacagcg tctcattttc ctacaacact 360

ggtgataaca caacatttcc tgatgctgaa gataaaggaa ttcttactgt tgatgaactt 420

ttggccatca gaattccatt gaatgacctt tttagatgca atagtttatc aactttggaa 480

aagaatgatg ttgtccaaca ctactgggat gttcttgtac aagcttttgt ccaaaatggc 540

acagtgagca caaatgagtt cctgtgtgat aaagacaaaa cttcaacagt ggcacccacc 600

atacacacca ctgtgccatc tcctactaca acacctactc caaaggaaaa accagaagct 660

ggaacctatt cagttaataa tggcaatgat acttgtctgc tggctaccat ggggctgcag 720

ctgaacatca ctcaggataa ggttgcttca gttattaaca tcaaccccaa tacaactcac 780

tccacaggca gctgccgttc tcacactgct ctacttagac tcaatagcag caccattaag 840

tatctagact ttgtctttgc tgtgaaaaat gaaaaccgat tttatctgaa ggaagtgaac 900

atcagcatgt atttggttaa tggctccgtt ttcagcattg caaataacaa tctcagctac 960

tgggatgccc ccctgggaag ttcttatatg tgcaacaaag agcagactgt ttcagtgtct 1020

ggagcatttc agataaatac ctttgatcta agggttcagc ctttcaatgt gacacaagga 1080

aagtattcta cagctgaaga atgttctgct gactctgacc tcaactttct tattcctgtt 1140

gcagtgggtg tggccttggg cttccttata attgttgtct ttatctctta tatgattgga 1200

agaaggaaaa gtcgtactgg ttatcagtct gtgtaa 1236

<210> 2

<211> 410

<212> PRT

<213> Homo sapiens

<400> 2

Met Val Cys Phe Arg Leu Phe Pro Val Pro Gly Ser Gly Leu Val Leu

1 5 10 15

Val Cys Leu Val Leu Gly Ala Val Arg Ser Tyr Ala Leu Glu Leu Asn

20 25 30

Leu Thr Asp Ser Glu Asn Ala Thr Cys Leu Tyr Ala Lys Trp Gln Met

35 40 45

Asn Phe Thr Val Arg Tyr Glu Thr Thr Asn Lys Thr Tyr Lys Thr Val

50 55 60

Thr Ile Ser Asp His Gly Thr Val Thr Tyr Asn Gly Ser Ile Cys Gly

65 70 75 80

Asp Asp Gln Asn Gly Pro Lys Ile Ala Val Gln Phe Gly Pro Gly Phe

85 90 95

Ser Trp Ile Ala Asn Phe Thr Lys Ala Ala Ser Thr Tyr Ser Ile Asp

100 105 110

Ser Val Ser Phe Ser Tyr Asn Thr Gly Asp Asn Thr Thr Phe Pro Asp

115 120 125

Ala Glu Asp Lys Gly Ile Leu Thr Val Asp Glu Leu Leu Ala Ile Arg

130 135 140

Ile Pro Leu Asn Asp Leu Phe Arg Cys Asn Ser Leu Ser Thr Leu Glu

145 150 155 160

Lys Asn Asp Val Val Gln His Tyr Trp Asp Val Leu Val Gln Ala Phe

165 170 175

Val Gln Asn Gly Thr Val Ser Thr Asn Glu Phe Leu Cys Asp Lys Asp

180 185 190

Lys Thr Ser Thr Val Ala Pro Thr Ile His Thr Thr Val Pro Ser Pro

195 200 205

Thr Thr Thr Pro Thr Pro Lys Glu Lys Pro Glu Ala Gly Thr Tyr Ser

210 215 220

Val Asn Asn Gly Asn Asp Thr Cys Leu Leu Ala Thr Met Gly Leu Gln

225 230 235 240

Leu Asn Ile Thr Gln Asp Lys Val Ala Ser Val Ile Asn Ile Asn Pro

245 250 255

Asn Thr Thr His Ser Thr Gly Ser Cys Arg Ser His Thr Ala Leu Leu

260 265 270

Arg Leu Asn Ser Ser Thr Ile Lys Tyr Leu Asp Phe Val Phe Ala Val

275 280 285

Lys Asn Glu Asn Arg Phe Tyr Leu Lys Glu Val Asn Ile Ser Met Tyr

290 295 300

Leu Val Asn Gly Ser Val Phe Ser Ile Ala Asn Asn Asn Leu Ser Tyr

305 310 315 320

Arg Asp Ala Pro Leu Gly Ser Ser Tyr Met Cys Asn Lys Glu Gln Thr

325 330 335

Val Ser Val Ser Gly Ala Phe Gln Ile Asn Thr Phe Asp Leu Arg Val

340 345 350

Gln Pro Phe Asn Val Thr Gln Gly Lys Tyr Ser Thr Ala Gln Glu Cys

355 360 365

Ser Leu Asp Asp Asp Thr Ile Leu Ile Pro Ile Ile Val Gly Ala Gly

370 375 380

Leu Ser Gly Leu Ile Ile Val Ile Val Ile Ala Tyr Val Ile Gly Arg

385 390 395 400

Arg Lys Ser Tyr Ala Xaa Tyr Gln Thr Leu

405 410

<210> 3

<211> 50

<212> DNA

<213> Homo sapiens

<400> 3

gaagttctta tatgtgcaac aaagagcaga ctgtttcagt gtctggagca 50

<210> 4

<211> 50

<212> DNA

<213> Homo sapiens

<400> 4

gaagttctta tatgagcaac aaagagcaga ctgtttcagt gtctggagca 50

<210> 5

<211> 23

<212> DNA

<213> Homo sapiens

<400> 5

aggccttcac tgaaaaaccc tga 23

<210> 6

<211> 19

<212> DNA

<213> Homo sapiens

<400> 6

tgctgctccc aagtgccat 19

Claims

1. The LAMP2 mutant gene is characterized in that a base T is mutated into A at a genome position chrX 119575687; the reference genomic version is GRCh 37.

2. The application of the LAMP2 mutant gene in preparing a Danon disease detection kit according to claim 1.

3. A LAMP2 mutant, comprising a p.cys331ser mutation.

4. The use of the LAMP2 mutant according to claim 3 in the preparation of a Danon disease detection kit.

5. A Danon disease detection kit is characterized by comprising a reagent for detecting LAMP2 mutant gene and/or LAMP2 mutant, wherein at the genomic position chrX:119575687, the base T is mutated into A; the LAMP2 mutant has a p.cys331ser mutation.

6. The Danon disease detection kit of claim 5, further comprising a forward primer and a reverse primer, wherein the forward primer has the sequence of SEQ ID NO. 5 and the reverse primer has the sequence of SEQ ID NO. 6.