CN113637614B - Bacterial strain for antagonizing pathogenic bacteria of tobacco target spot and application thereof - Google Patents
Bacterial strain for antagonizing pathogenic bacteria of tobacco target spot and application thereof Download PDFInfo
- Publication number
- CN113637614B CN113637614B CN202111094343.5A CN202111094343A CN113637614B CN 113637614 B CN113637614 B CN 113637614B CN 202111094343 A CN202111094343 A CN 202111094343A CN 113637614 B CN113637614 B CN 113637614B
- Authority
- CN
- China
- Prior art keywords
- tobacco
- strain
- target spot
- pathogenic bacteria
- tobacco target
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/20—Bacteria; Substances produced thereby or obtained therefrom
- A01N63/22—Bacillus
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Pest Control & Pesticides (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Agronomy & Crop Science (AREA)
- Dentistry (AREA)
- Wood Science & Technology (AREA)
- Environmental Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention discloses a bacterial strain for antagonizing pathogenic bacteria of tobacco target leaf spot, which is Bacillus belgii GT-5, is preserved in China Center for Type Culture Collection (CCTCC) with the preservation date of 2021 year, 7 months and 30 days, and has the preservation number of CCTCC NO: m2021952, the preservation address is China, wuhan university, the taxonomy is named as BacillusvelezensisGT-5; the strain which antagonizes pathogenic bacteria of the tobacco target spot is applied to the prevention and treatment of the tobacco target spot, thereby avoiding the generation of drug resistance and improving the prevention and treatment effect.
Description
Technical Field
The invention relates to the technical field of strain screening, in particular to a strain for antagonizing pathogenic bacteria of tobacco target spot and application thereof.
Background
Tobacco target leaf spot is a fungal disease caused by dermataceae citrullina. The target spot of tobacco can occur from the seedling stage to the mature stage of tobacco leaves, which not only infects leaves, but also harms stems. The infected leaves are initially round water stain-shaped spots, if the temperature is high, the humidity is high, and the wetting time of the leaves is long, the scab rapidly expands to form irregular spots with the diameter of 2-20cm, concentric rings are formed to form chlorotic halo and withered spots, necrotic parts of the scab are fragile to form through holes, and the scab is shaped like a hole left on a target after bullet shooting, so the target spot is called. When the humidity is high, mycelium, sexual generation sporoderm and basidiospore of the fungus are often generated at the edge of lesion spots on the lower surface of the leaf.
At present, the prevention and treatment measures of the tobacco target spot disease are mainly chemical pesticide prevention and treatment, however, pesticide residues exist when chemical agents are used for prevention and treatment, the environment is seriously polluted, people and livestock are harmed, certain drug resistance can be generated on plants when the same chemical pesticide is used for a long time, and the prevention and treatment effect can be greatly reduced. The biological control does not pollute the environment, does not harm the health of people and livestock, and can effectively control the spread of the disease.
Therefore, how to provide a strain capable of antagonizing the pathogenic bacteria of the target leaf spot of tobacco is a technical problem to be solved urgently by those skilled in the art.
Disclosure of Invention
In view of the above, the invention provides a strain for antagonizing pathogenic bacteria of tobacco target spot disease, and the strain is applied to control of the tobacco target spot disease.
In order to achieve the purpose, the invention adopts the following technical scheme:
the strain for antagonizing pathogenic bacteria of the tobacco target spot is Bacillus belgii GT-5, is preserved in China Center for Type Culture Collection (CCTCC) with the preservation date of 2021, 7 months and 30 days and the preservation number of CCTCC NO: m2021952, the preservation address is China, wuhan university, and the taxonomic name is Bacillus velezensis GT-5.
The application of the strain for antagonizing the pathogenic bacteria of the tobacco target spot disease in preventing and treating the tobacco target spot disease.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.
FIG. 1 is a diagram showing the results of the culture of GT-5 strain in accordance with the present invention and Rhizoctonia solani;
FIG. 2 is a diagram showing the bacteriostatic effect of the GT-5 strain on Rhizoctonia solani hyphae provided by the present invention;
FIG. 3 is a colony morphology of the GT-5 strain provided by the present invention;
FIG. 4 is a gel electrophoresis diagram of the 16S rDNA PCR product of the GT-5 strain provided by the present invention;
FIG. 5 is a diagram showing the results of homology alignment of GT-5 strains provided by the present invention;
FIG. 6 is a drawing showing the phylogenetic tree results of the GT-5 strain provided in the present invention.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Materials, reagents and instruments used in the examples:
tobacco rhizosphere soil: soil at the roots of tobacco seedlings collected from tobacco fields with serious tobacco target spots in 5 tobacco zones of Zhang Jiajiu city, yongshun county, longshan county, shimen county and Cili county in Hunan province.
Culture medium and medicament
LB medium: weighing 10g of peptone, 5g of yeast powder and 10g of NaCl by using an electronic balance, adding 500ml of deionized water, stirring by using a glass rod to completely dissolve the medicines, adding the deionized water to a constant volume of 1L, subpackaging 1L of culture medium in 500ml conical flasks, adding 200ml of culture medium in each flask, adding 1.5g of agar into each conical flask, carrying out moist heat sterilization at 121 ℃ for 25min by using a high-pressure steam sterilization pot, preparing an LB solid culture medium, and cooling for later use;
LB liquid medium: the preparation method is the same as above, but no agar is added, the culture medium is subpackaged into 50ml conical flasks, each flask is subpackaged with 20ml, and the culture medium is sterilized by moist heat at 121 ℃ for 25min in a high-pressure steam sterilization pot. Configured into LB liquid culture medium;
medicament: peptone, yeast powder, nacl, agar powder, CTAB, absolute ethanol, phenol-chloroform-isoamyl alcohol (25;
laboratory apparatus
2L measuring cylinder, glass rod, 2ml centrifuge tube, 15ml centrifuge tube, pipetting gun, coating rod, disposable culture dish, high pressure steam sterilization pot, super clean bench, shaking table and the like.
Example 1 Strain screening
1) Sampling
Digging healthy tobacco seedlings from tobacco fields with serious tobacco target spot disease in the tobacco fields in various tobacco regions in Hunan, storing the tobacco seedlings in sterilized paper bags, shaking off soil at the root of tobacco after the tobacco seedlings are brought back to a laboratory, and sieving coarse soil to leave fine soil.
2) Preparation of soil suspensions
Weighing soil sample 0.1g into 15ml centrifuge tube, adding sterile water 9.9ml to obtain 10% -2 g/ml of soil suspension, using a 1ml pipette to obtain a concentration of 10 -2 g/ml soil suspension in 9ml sterile water to 10ml 10 - 3 g/ml of soil suspension, according to which the soil suspension is further diluted to a concentration of 10 -6 g/ml、10 -7 g/ml and 10 -8 And (3) taking a soil suspension of g/ml, respectively taking 200ul of each of the three suspensions of different concentrations, adding the suspensions of the three concentrations to a PDA culture medium and an LB culture medium for coating and bacteria distribution, coating three culture dishes on each suspension of the three concentrations, putting the coated PDA culture dish into an incubator at 28 ℃, putting the coated LB culture dish into an incubator at 37 ℃, and inversely culturing the two culture dishes of different media. Observing the growth of the strains under different dilution concentrations after a period of time, selecting proper single colonies from the screened bacteria for streak purification, selecting hyphae from the screened fungi or beating fungus cakes on the edges of the single colonies for purification, numbering the strains obtained by separation, storing at 4 ℃ for next step of antagonistic experiment identification. The co-isolation yielded 33 strains, of which 23 strains of bacteria, 7 strains of fungi and 3 strains of actinomycetes.
3) Screening of biocontrol bacteria
Using tobacco target leaf spot pathogen (R.solani) as a target, and carrying out opposite culture on a strain separated from tobacco rhizosphere soil and Rsolani, wherein the specific steps are as follows: inoculating the activated tobacco target spot pathogen inoculation cake on a PDA culture dish, wherein the position of the activated tobacco target spot pathogen inoculation cake is about 1cm close to the edge of the culture dish, and then inoculating the screened bacteria and fungi on the opposite side of the Rsolani, and the distance between the screened bacteria and fungi and the edge of the PDA culture dish is also about 1 cm. The inoculation of the screened bacteria and actinomycetes is carried out by utilizing a single colony generated by streaking, the single colony is inoculated on the opposite side of the Rsolani by utilizing a sterilized toothpick, and the screened fungi are inoculated on the edge of the fungal colony in a way of beating a fungus cake and then are inoculated on the opposite side of the Rsolani. And (3) carrying out confronting culture on all the screened microorganisms and R.solani according to the method, inoculating three times of each strain, inoculating a sterile PDA strain cake and inoculating sterile water to serve as a control group, putting the inoculated PDA culture dish into an incubator at 28 ℃ for culture, and observing after culturing for a period of time. Screening out biocontrol bacteria with obvious inhibition effect on the growth of hyphae of the tobacco target leaf spot pathogen, wherein the numbers are GT-5 respectively, and the results are shown in figure 1;
4) Determination of biocontrol bacterium inhibition rate
Selecting the separated substance with the bacteriostatic effect obtained by screening, inoculating the Rsolani bacterium in the center of a PDA culture dish, inoculating the microorganism with the bacteriostatic effect around the Rsolani bacterium cake, inoculating four points, selecting a single colony with a toothpick for inoculation, repeating three times, setting a contrast group to be inoculated with a sterile PDA bacterium cake and sterile water, placing the PDA bacterium cake and the sterile water in an incubator at 28 ℃ for culture, measuring the diameter of the Rsolani after inoculation of antagonistic bacteria when the Rsolani hypha of the contrast group grows over the culture dish, and calculating the bacteriostatic ratio of the antagonistic bacteria according to the diameters (cm) of the processing group and the contrast group. The bacteriostatic rate (100%) = (control colony diameter-treated colony diameter)/control colony diameter × 100%.
After the rhizoctonia solani of the control group grows to a culture dish with the diameter of 90mm, measuring the colony diameter of the rhizoctonia solani after inoculation of biocontrol bacteria by using a vernier caliper, setting three times of repetition, calculating the average diameter (mm) of the colony after biocontrol bacteria treatment, and calculating the bacteriostasis rate of the strain GT-5 to be 63.98 percent, as shown in figure 2 and table 1;
TABLE 1
5) Identification of biocontrol strain
Morphological observation
The colony of the strain GT-5 is nearly circular, the edge is not flat, the middle is slightly wet and convex, the color of the center of the colony is milky, the color of the edge is light, the colony is viscous and easy to pick up, and the figure is 3;
(1) Extraction of biocontrol bacteria DNA
And (3) performing molecular identification on the screened strain with the antagonistic effect, and extracting DNA of the strain by adopting an improved CTAB method.
Selecting a single colony obtained by scribing, inoculating the single colony into an LB liquid culture medium, culturing for 3d at the temperature of 30 ℃ in a shaking table at 200rpm, sucking 1ml of bacterial liquid into a 2ml centrifuge tube by using a pipette gun in an ultraclean workbench, centrifuging for 5min at 10000rpm of a centrifuge, discarding supernatant, and reserving precipitate for later use;
1) Adding 500 μ l CTAB into 2ml centrifuge tube filled with bacterial liquid precipitate of bacteria, water bathing at 60 deg.C for 45min, and shaking once every 15 min;
2) After completion of the water bath, 500. Mu.l of phenol-chloroform-isoamyl alcohol (25;
3) Chloroform-isopropanol (24
4) After the centrifugation, taking the supernatant into a new centrifuge tube, adding chloroform-isoamyl alcohol (24);
5) Adding the supernatant into a new 2ml centrifugal tube, adding anhydrous ethanol with twice volume, and standing in a refrigerator at-20 deg.C for 30min;
6) Centrifuging at 12000rpm for 10min, pouring out liquid, adding 1ml of 75% absolute ethyl alcohol, centrifuging at 8000rpm for 5min, discarding supernatant, reversing the centrifugal tube on absorbent paper to volatilize residual liquid in the tube, adding 50 μ l of ultrapure water to dissolve DNA, and preserving at-20 deg.C for later use.
(2) PCR amplification of DNA
The PCR amplification universal primers of the biocontrol bacteria are 27F (5 'AGAGAGTTTGATCCTGGCTCAG3' shown in SEQ ID NO. 1) and 1492R (5 'CTACGGCTACTTGTTACGAGA 3' shown in SEQ ID NO. 2) as primers (subscribed to Shanghai Biotech engineering Co., ltd.).
The PCR amplification system is shown in Table 2;
the procedure is as follows: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 59 ℃ for 30s, extension at 72 ℃ for 1min, re-extension at 72 ℃ for 10min, and preservation for 30 cycles at 4 ℃.
TABLE 2 1696 rDNA Universal amplification System
Taking DNA extracted by CTAB method as template, using 16S rDNA universal primer, observing PCR product in gel imaging system via PCR amplification to obtain clear and bright single band, as shown in FIG. 4, with fragment size of about 1500 bp;
(3) Sequencing of DNA samples
After the PCR products which are remained after the successful amplification sample application are written with the labels, the PCR products are sent to be sequenced, a segment of sequence obtained by sequencing is copied on NCBI to be subjected to BLAST comparison, and the comparison result is shown in figure 5; bacterial sequences belonging to the same genus as the strain GT-5 were downloaded from NCBI, and a phylogenetic tree was constructed using the NJ method using Pseudomonas aeruginosa (Pseudomonas asaruginosa) as an exogen, as shown in FIG. 6.
6) Evaluation of field control of strain GT-5 on tobacco target spot
2 mu of tobacco field with serious tobacco target spot disease is selected in Huayuan county of Hunan west, and 4 treatments are set in the experiment: 80% mancozeb wettable powder; 10% of validamycin aqua and GT-5 fermentation liquor; media (control). Each process set 4 repetitions for 16 cells, each cell area about 50m2. The dosage of each treatment is as follows: 80% mancozeb wettable powder is diluted 1000 times and applied; the GT-5 fermentation liquor is applied according to 200 ml/mu by adding 50kg of water; the 10% validamycin aqua is diluted by 600 times for application. The medicine is administered at the beginning of sporadic scab, and is administered 3 times every 5-7 days. The medication method comprises the following steps: spraying, and spraying on the front and back surfaces of the leaf.
Each cell was investigated for all leaves on 15 tobacco plants before each application and 10 days after the last application, and 9-stage investigation was conducted on leaves according to "tobacco pest classification and investigation method" (GBT 23222-2008). The disease index =100 × ∑ (number of diseased leaves at each stage × representative value at each stage)/(total number of examined leaves × representative value at the highest stage), and relative control effect (%) = (control disease index — treatment disease index)/control disease index × 100.
The field plot test investigation results are shown in table 3, and table 3 shows that the morbidity and disease index of a control group (CK), 80% mancozeb wettable powder, 10% validamycin aqueous solution and a GT-5 fermentation liquor treatment group are gradually increased along with the prolonging of the application time, the morbidity reaches the highest in the last investigation, the morbidity is respectively 61.32%, 36.67%, 27.08% and 14.97%, the morbidity and disease index of the GT-5 fermentation liquor treatment group are obviously lower, and the prevention effect on the tobacco target spot disease can reach 74.57% at the highest.
TABLE 3 prevention and treatment effects of GT-5 on tobacco target leaf spot
The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other.
The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Sequence listing
<110> Hunan university of agriculture
China tobacco Zhongnan agricultural test station
<120> a strain for antagonizing pathogenic bacteria of tobacco target leaf spot
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
agagtttgat cctggctcag 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ctacggctac cttgttacga 20
Claims (2)
1. The strain for antagonizing pathogenic bacteria of the tobacco target spot is characterized in that the strain is Bacillus belgii GT-5, is preserved in China center for type culture Collection, has the preservation date of 2021 year, 7 months and 30 days, and has the preservation number of CCTCC NO: m2021952, the preservation address is China, wuhan university, and the taxonomic name is Bacillus velezensis GT-5.
2. The use of a strain that antagonizes pathogenic bacteria of tobacco target spot disease as defined in claim 1 for controlling tobacco target spot disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111094343.5A CN113637614B (en) | 2021-09-17 | 2021-09-17 | Bacterial strain for antagonizing pathogenic bacteria of tobacco target spot and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111094343.5A CN113637614B (en) | 2021-09-17 | 2021-09-17 | Bacterial strain for antagonizing pathogenic bacteria of tobacco target spot and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113637614A CN113637614A (en) | 2021-11-12 |
| CN113637614B true CN113637614B (en) | 2023-01-31 |
Family
ID=78426289
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111094343.5A Active CN113637614B (en) | 2021-09-17 | 2021-09-17 | Bacterial strain for antagonizing pathogenic bacteria of tobacco target spot and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113637614B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114190404B (en) * | 2021-12-27 | 2022-10-04 | 沈阳农业大学 | Biological control method for tobacco target spot and application |
| CN115039794A (en) * | 2022-06-30 | 2022-09-13 | 中国烟草总公司辽宁省公司 | Biocontrol microbial inoculum for preventing and treating tobacco target leaf spot disease as well as preparation method and application thereof |
| CN116496918A (en) * | 2022-08-23 | 2023-07-28 | 湖南农业大学 | Mortierella pseudomonad antagonizing tobacco target spot |
| CN116731890A (en) * | 2022-12-01 | 2023-09-12 | 中国烟草中南农业试验站 | Bacterial strain for antagonizing pathogenic bacteria of tobacco wildfire and application thereof |
| CN117866846B (en) * | 2024-01-20 | 2024-09-13 | 中国烟草中南农业试验站 | Bacterial strain for antagonizing pathogenic bacteria of tobacco target spot disease, biocontrol agent and application of bacterial strain |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109868250A (en) * | 2019-04-15 | 2019-06-11 | 沈阳农业大学 | One plant inhibits virus, the Bei Laisi bacillus for promoting plant growth and its application |
| CN111575199A (en) * | 2020-04-21 | 2020-08-25 | 华南农业大学 | Pseudomonas aeruginosa JT86 and application thereof in preventing and treating sclerotinia rot |
| CN112375700A (en) * | 2020-11-11 | 2021-02-19 | 云南省烟草农业科学研究院 | Bacillus belgii 05-1205, acquisition method and application thereof |
| CN112442548A (en) * | 2020-12-17 | 2021-03-05 | 湖南省烟草公司郴州市公司 | LAMP primer group containing kit for detecting tobacco target spot disease, application and detection method thereof |
-
2021
- 2021-09-17 CN CN202111094343.5A patent/CN113637614B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109868250A (en) * | 2019-04-15 | 2019-06-11 | 沈阳农业大学 | One plant inhibits virus, the Bei Laisi bacillus for promoting plant growth and its application |
| CN111575199A (en) * | 2020-04-21 | 2020-08-25 | 华南农业大学 | Pseudomonas aeruginosa JT86 and application thereof in preventing and treating sclerotinia rot |
| CN112375700A (en) * | 2020-11-11 | 2021-02-19 | 云南省烟草农业科学研究院 | Bacillus belgii 05-1205, acquisition method and application thereof |
| CN112442548A (en) * | 2020-12-17 | 2021-03-05 | 湖南省烟草公司郴州市公司 | LAMP primer group containing kit for detecting tobacco target spot disease, application and detection method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113637614A (en) | 2021-11-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113637614B (en) | Bacterial strain for antagonizing pathogenic bacteria of tobacco target spot and application thereof | |
| CN113652377B (en) | Bacterial strain for antagonizing pathogenic bacteria of tobacco target spot and application thereof | |
| CN112899201B (en) | Bacillus belgii, application thereof and method for preventing and treating banana wilt | |
| CN111534460B (en) | Preparation method and application of bacillus beiLeisi capable of efficiently antagonizing fusarium graminearum | |
| CN108277182B (en) | Streptomyces spectabilis XWSTSP130906J234 and application thereof in prevention and treatment of panax notoginseng epidemic disease | |
| CN112280716B (en) | Bacillus altitudinis YG045 and application thereof | |
| CN112143686B (en) | Bacillus altitudinis ST15 for antagonizing xanthomonas oryzae and application thereof | |
| CN113913302B (en) | Trichoderma atroviride and application thereof in inhibiting ginseng pathogenic bacteria | |
| CN112725241A (en) | Pseudomonas chlororaphis and application thereof in prevention and treatment of leaf spot of phomopsis stolonifera | |
| CN106497852B (en) | Burkholderia strain ES-89 for preventing and treating plant fungal diseases as well as culture method and application thereof | |
| CN115058358A (en) | Salt-tolerant bacillus and application thereof | |
| CN105567600A (en) | Pathogen verticillium antagonistic bacterium and application thereof | |
| CN113025522B (en) | Bacillus amyloliquefaciens, application thereof and method for preventing and/or treating banana vascular wilt | |
| CN112920975B (en) | Bacillus belgii YL94 and application thereof | |
| CN107904196B (en) | Streptomyces yanshi and application thereof | |
| CN108865925A (en) | One bacillus amyloliquefaciens, tunning and the preparation method and application thereof | |
| CN117025466A (en) | Bacillus bailii and application thereof in controlling melon crop diseases | |
| CN102154178A (en) | Bacillus brevis for preventing and treating hot pepper epidemic disease as well as preparation method and application of biological agent | |
| CN115074286B (en) | Bacillus pumilus for antagonizing tinea pedis pathogenic fungi and application thereof | |
| CN116286466A (en) | Bacterial strain for antagonizing tobacco brown spot pathogenic bacteria and application thereof | |
| CN107058183B (en) | Bacillus methylotrophicus, and biocontrol microbial inoculum and application thereof | |
| CN112961782B (en) | Epicoccocus sorghum, microbial inoculum and herbicide containing same and application thereof | |
| CN116987648B (en) | Bacillus pumilus and application thereof in kiwi fruit canker prevention and treatment | |
| CN116731890A (en) | Bacterial strain for antagonizing pathogenic bacteria of tobacco wildfire and application thereof | |
| CN116286536B (en) | Bacillus cereus YZ-228 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |