CN113621737A - Influenza virus detection kit and application thereof - Google Patents
Influenza virus detection kit and application thereof Download PDFInfo
- Publication number
- CN113621737A CN113621737A CN202111040012.3A CN202111040012A CN113621737A CN 113621737 A CN113621737 A CN 113621737A CN 202111040012 A CN202111040012 A CN 202111040012A CN 113621737 A CN113621737 A CN 113621737A
- Authority
- CN
- China
- Prior art keywords
- primer
- crrna
- flub
- flua
- influenza virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The invention discloses an influenza virus detection kit and application thereof, wherein the kit comprises the following components: magnesium acetate solution, Buffer solution, enzyme powder, CutSmart Buffer, recombined RNase Inhibitor, DNA fluorescent probe, Cas12a, primer group, FluA-crRNA and FluB-crRNA; the primer group comprises a FluA-RPA primer, a FluB-RPA primer, a FluA-crRNA primer and a FluB-crRNA primer. The influenza virus detection kit disclosed by the invention has the advantages of high sensitivity to influenza viruses, high detection precision and accuracy, short detection period, and very simple and convenient operation, does not depend on professionals, professional instruments and detection conditions, and is very suitable for being popularized in basic medical quarantine institutions.
Description
Technical Field
The invention relates to the technical field of biology, in particular to an influenza virus detection kit and application thereof.
Background
Influenza is an infectious respiratory disease caused by influenza virus and is prevalent around the world. Despite economic advances and advances in medical technology, influenza inevitably leads to hospitalization and considerable mortality. It is estimated that about 10 million cases worldwide per year are infected with symptomatic influenza virus, with 3-500 million cases of severe disease and 296.5 million influenza-associated respiratory deaths. This may be combined with a huge economic burden involving direct and indirect costs. From exposure to influenza virus to infection, the incubation period is about 4-5 days, the clinical manifestations are nonspecific, and the infection is not easily distinguished from other respiratory pathogens, so early, rapid and accurate diagnosis of influenza is particularly important for rapid implementation of antiviral therapy.
The current main detection methods of influenza comprise virus separation, virus antigen and gene detection, serology detection and the like, and nucleic acid detection is taken as the current main influenza virus diagnosis method, has high sensitivity and strong specificity, can diagnose early, and plays an important role in preventing epidemic outbreak, delaying the propagation speed and the like. However, the conventional PCR-based method requires three steps of denaturation, annealing and extension, and the temperature of each step is different, so that a special thermal cycler is required for performing the steps, thereby limiting the application range of the PCR-based method. In addition, the existing primer set for detecting influenza is only suitable for a specific method such as traditional PCR and the like, and is not suitable for RPA amplification, so that the existing primer set cannot be matched with detection conditions to achieve the best detection effect.
Disclosure of Invention
Therefore, the embodiment of the invention provides an influenza virus detection kit and an application thereof, so as to solve the problems in the prior art.
In order to achieve the above object, the embodiments of the present invention provide the following technical solutions:
in a first aspect, the embodiment of the present invention provides an influenza virus detection kit, including the following components:
magnesium acetate solution, Buffer solution, enzyme powder, CutSmart Buffer, recombined RNase Inhibitor, DNA fluorescent probe, Cas12a, primer group, FluA-crRNA and FluB-crRNA; the primer group comprises a FluA-RPA primer, a FluB-RPA primer, a FluA-crRNA primer and a FluB-crRNA primer
Preferably:
the nucleotide sequence of the FluA-RPA primer comprises:
primer A with the nucleic acid sequence of 5'-aagaccgatcttgtcacctctgac-3'
Primer B with the nucleic acid sequence of 5'-cattttggacaaatcgtctacgctg-3'
The nucleotide sequence of the FluB-RPA primer comprises:
primer C having the nucleic acid sequence of 5'-atcggatcctcaactcactcttcgagcg-3'
Primer D with the nucleic acid sequence of 5'-taatcggtgctcttgaccaaattg-3'
The nucleotide sequence of the FluA-crRNA primer comprises:
primer E having the nucleic acid sequence 5'-gaaattaatacgactcactatagggtaat-3'
Primer F having the nucleic acid sequence of 5'-cctaaaatccccttagtcagaggt-3'
The nucleotide sequence of the FluB-crRNA primer comprises:
primer G having the nucleic acid sequence of 5'-gaaattaatacgactcactatagggtaat-3'
And (3) a primer H, wherein the nucleic acid sequence of the primer H is 5'-cattcaaagccaattcgagcagct-3'.
Preferably, the concentration of the magnesium acetate solution is 279-281 mmol/L.
Preferably, the buffer is a rehydration buffer.
Further, the rehydration buffer solution is an alkaline buffer.
Preferably, the enzyme powder is lyophilized enzyme powder.
Further, the freeze-dried enzyme powder is one or more of recombinase capable of binding single-stranded nucleic acid, single-stranded DNA binding protein and strand displacement DNA polymerase.
In a second aspect, the embodiment of the present invention provides an application of the influenza virus detection kit in virus detection.
Compared with the prior art, the invention has at least the following beneficial effects:
(1) the primer group of the influenza virus detection kit provided by the embodiment of the invention is a specific amplification primer group designed aiming at a conserved sequence of influenza, and the influenza RPA-cas12a one-step detection method is established based on the primer group in the embodiment of the invention, so that the influenza can be qualitatively detected. The amplification primer group provided by the invention has strong specificity and high sensitivity, and the primer group provided by the invention has short detection time and does not need a special detection instrument.
(2) The influenza virus detection kit provided by the embodiment of the invention has the advantages that the detection precision and sensitivity can be compared with those of the existing precise detection method, the cost and time cost for detection are obviously reduced, and in addition, the operation simplicity is stronger, so that the influenza virus detection kit has higher popularization value in the primary medical quarantine institution.
Drawings
In order to more clearly illustrate the technical solution of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly described below. It should be apparent that the drawings in the following description are merely exemplary, and that other drawings may be derived from the provided drawings by those of ordinary skill in the art without inventive effort.
The drawings are only for purposes of illustration and description, and are not intended to limit the scope of the invention, which is defined by the claims, which follow.
FIG. 1 is a graph showing the results of fluorescence detection of test 1-a conducted on an example of the present invention;
FIG. 2 is a graph showing the results of fluorescence detection of test 1-b performed on an example of the present invention;
FIG. 3 is the result of fluorescence detection of test 2-a performed on an example of the present invention;
FIG. 4 is a graph showing the results of fluorescence detection of test 2-b performed on an example of the present invention;
FIG. 5 is the result of fluorescence detection of test 3-a performed on an example of the present invention;
FIG. 6 shows the results of fluorescence detection of test 3-b performed in the examples of the present invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
In the description of the present invention, the terms "comprises," "comprising," and any other variations thereof, are intended to cover a non-exclusive inclusion, such that a process, method, system, article, or apparatus that comprises a list of steps or elements is not necessarily limited to those steps or elements specifically listed, but may include other steps or elements not expressly listed or inherent to such process, method, article, or apparatus or additional steps or elements based on further optimization of the inventive concepts.
Examples
The embodiment provides an influenza virus detection kit, which comprises the following components:
a reagent, which consists of FluA-crRNA, FluB-crRNA, CutSmart Buffer, recombined RNase Inhibitor, a DNA fluorescent probe, Cas12a (Cpf1), a 280mmol/L magnesium acetate solution, an alkaline rehydration Buffer solution, freeze-dried enzyme powder and a primer set, wherein the primer set comprises a FluA-RPA primer, a FluB-RPA primer, a FluA-crRNA primer and a FluB-crRNA primer, and the method comprises the following steps:
the nucleotide sequence of the FluA-RPA primer comprises:
SEQ ID NO.1(FluA-RPA-A)：5'-aagaccgatcttgtcacctctgac-3'
SEQ ID NO.2(FluA-RPA-B)：5'-cattttggacaaatcgtctacgctg-3'
the nucleotide sequence of the FluB-RPA primer comprises:
SEQ ID NO.3(FluB-RPA-C)：5'-atcggatcctcaactcactcttcgagcg-3'
SEQ ID NO.4(FluB-RPA-D)：5'-taatcggtgctcttgaccaaattg-3'
the nucleotide sequence of the FluA-crRNA primer comprises:
SEQ ID NO.5(FluA-crRNA-E)：5'-gaaattaatacgactcactatagggtaat-3'
SEQ ID NO.6(FluA-crRNA-F)：5'-cctaaaatccccttagtcagaggt-3'
the nucleotide sequence of the FluB-crRNA primer comprises:
SEQ ID NO.7(FluB-crRNA-G)：5'-gaaattaatacgactcactatagggtaat-3'
SEQ ID NO.8(FluB-crRNA-H)：5'-cattcaaagccaattcgagcagct-3'。
the full-length nucleic acid sequence of the FluA amplification product is shown as follows:
5'-gacaagaccgatcctgtcacctctgactaaggggattttagggtttgtgttcacgctcaccgtgcccagtgag cgaggactgcagcgtagacgatttgtccaaaatg-3'；
the full-length nucleic acid sequence of the FluB amplification product is shown as follows:
5'-atcggatcctcaactcactcttcgagcgtctcaatgaaggacattcaaagccaattcgagcagctgaaactgc ggtgggagtcttatcccaatttggtcaagagcaccgatta-3'。
the above embodiments are now tested to illustrate the beneficial effects of the embodiments of the present invention.
(1) Test 1-a: FluA-RPA-cas12a fluorescence detection
The DNA of a sample to be detected is used as a template, the influenza virus detection kit provided by the embodiment is adopted, and the RPA-FluA-A primer group, the RPA-FluA-B primer group and the FluA-crRNA in the kit are used for carrying out the RPA-cas12a one-step detection. Meanwhile, the DNA template is set as a control without nuclease water.
The preparation method of the RPA-cas12a detection system is as follows: adding 29.5 muL of rehydration Buffer solution, 8.1 muL of deionized water, 1 mumol/L of RPA-FluA-A and 1.5 muL of 10 mumol/L of RPA-FluA-B into a 0.2mL twist Amp reaction tube containing lyophilized enzyme powder, respectively, 1.5 muL of CutSmart Buffer 9 muL, 1nmol/L of Cas12a (Cpf1)4.5 mu L, FluA-crRNA 4.5 muL and Recombinant RNase Inhibitor 4.5 muL, diluting with nuclease-free water at a mass ratio of 2:3 and 10nmol/L of DNA fluorescent probe 4.5 muL, diluting with nuclease-free water at a mass ratio of 1:4, mixing to obtain a mixture, centrifuging to obtain a mixture, dividing the mixture into three parts, each 22.5 muL, adding one part of the mixture into 0.2mL EP tubes, selecting one as an experimental group, adding the rest two control groups, adding 0.5 muL of the control substance into the experimental group, adding 0.5 muL of the control substance into the three parts, finally, adding 280mmol/L magnesium acetate solution 2 mu L into the three groups respectively; an EP tube was also prepared without any addition of material as a blank.
RPA-cas12a reaction conditions: the RPA-cas12a detection system is fully mixed and centrifuged, and the mixture is incubated in an incubator at 37 ℃.
RPA-cas12a fluorescence detection: and (3) respectively detecting fluorescence after incubation for 20min, 30min, 45min, 1h and 1.5 h.
The detection results are shown in FIG. 1; in fig. 1, the column marked with "+" is an experimental group, the column marked with "1" is a blank group, and the two columns marked with "-" are control groups.
As can be seen from FIG. 1, the experimental group has fluorescence, and the other three groups have no fluorescence, which indicates that the kit provided in this example can effectively detect FluA.
(2) Test 1-b: FluB-RPA-cas12a fluorescence detection
The method and procedure for test 1-b are the same as for test 1-a, except that:
the primers are RPA-FluB-C and RPA-FluB-D;
the used crRNA is FluB-crRNA;
selecting two EP tubes added with the mixed solution as an experimental group, taking the remaining one EP tube added with the mixed solution as a control group, respectively adding template DNA into the two experimental groups, and adding a control substance into the control group.
The detection results are shown in FIG. 2; in fig. 2, the two columns marked with "+" are experimental groups, the column marked with "B" is blank group, and the column marked with "-" is control group.
As can be seen from FIG. 2, two experimental groups showed fluorescence, while the other two groups showed no fluorescence, indicating that the kit provided in this example can effectively detect FluB.
(1) Test 2-a: FluA-RPA primer set specific detection
The method and procedure for test 2-a is the same as for test 1-a, except that:
adding the mixed solution into four EP tubes, selecting one EP tube as an experimental group, adding template DNA into the experimental group, selecting two EP tubes as a control group 1, adding human genome DNA into the experimental group, selecting one EP tube as a control group 2, and adding a control substance into the control group.
The detection results are shown in FIG. 3; in fig. 3, one column labeled with "fluor" is an experimental group, two columns labeled with "1" and "2" are both control groups 1, and one column labeled with "-" is a control group 2.
As can be seen from FIG. 3, the experimental group showed fluorescence, while the remaining three groups showed no fluorescence, indicating that the kit provided in this example was not affected by human genomic DNA, and the FluA-RPA primer had specificity.
(2) Test 2-b: FluB-RPA primer set specific detection
The method and procedure for test 2-b was the same as for test 2-a, except that:
the primers are RPA-FluB-C and RPA-FluB-D;
the crRNA used was FluB-crRNA.
The detection results are shown in FIG. 4; in fig. 4, one column labeled with "B" is an experimental group, two columns labeled with "1" and "2" are both control groups 1, and one column labeled with "-" is a control group 2.
As can be seen from FIG. 4, the experimental group showed fluorescence, while the remaining three groups showed no fluorescence, indicating that the kit provided in this example was not affected by human genomic DNA, and the FluB-RPA primer had specificity.
Test 3
(1) Test 3-a: sensitivity detection of kit to FluA
FluA DNA was diluted in a gradient to obtain 1, 0.1, 0.01 and 0.001 ng/. mu.L FluA DNA, respectively.
The DNA of FluA with the above concentration was used as a template for detection, and the detection method and procedure were the same as those of test 1-a, except that:
no blank group was set and only one control group was present.
The results of the detection are shown in FIG. 5. As can be seen from FIG. 5, even if the DNA concentration of FluA decreases exponentially, the fluorescence is still clearly visible, which indicates that the kit provided by this embodiment has very high detection sensitivity for FluA.
(2) Test 3-b: sensitive detection of kit for FluB
FluB DNA was diluted in a gradient to obtain 1, 0.1, 0.01 and 0.001 ng/. mu.L FluB DNA, respectively.
The DNA of FluB with the above concentration is used as a template to detect, and the detection method and the steps are the same as those of the test 3-a, except that:
the primers are RPA-FluB-C and RPA-FluB-D;
the crRNA used was FluB-crRNA.
The results of the detection are shown in FIG. 6. As can be seen from FIG. 6, even if the concentration of FluB decreases exponentially, the fluorescence is still clearly visible, which indicates that the kit provided in this example has very high detection sensitivity for FluB.
All the technical features of the above embodiments can be combined arbitrarily, and for simplicity of description, all possible combinations of the technical features of the above embodiments are not described; these examples, which are not explicitly described, should be considered to be within the scope of the present description.
The present invention has been described in considerable detail by the general description and the specific examples given above. It should be noted that it is obvious that several variations and modifications can be made to these specific embodiments without departing from the inventive concept, which falls within the scope of protection of the present application. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> Liaoning Bai Hao Biotech Ltd
<120> influenza virus detection kit and application thereof
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 1
aagaccgatc ttgtcacctc tgac 24
<210> 2
<211> 25
<212> DNA
<213> Artificial Sequence
<400> 2
cattttggac aaatcgtcta cgctg 25
<210> 3
<211> 28
<212> DNA
<213> Artificial Sequence
<400> 3
atcggatcct caactcactc ttcgagcg 28
<210> 4
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 4
taatcggtgc tcttgaccaa attg 24
<210> 5
<211> 29
<212> DNA
<213> Artificial Sequence
<400> 5
gaaattaata cgactcacta tagggtaat 29
<210> 6
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 6
cctaaaatcc ccttagtcag aggt 24
<210> 7
<211> 29
<212> DNA
<213> Artificial Sequence
<400> 7
gaaattaata cgactcacta tagggtaat 29
<210> 8
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 8
cattcaaagc caattcgagc agct 24
<210> 9
<211> 107
<212> DNA
<213> Artificial Sequence
<400> 9
gacaagaccg atcctgtcac ctctgactaa ggggatttta gggtttgtgt tcacgctcac 60
cgtgcccagt gagcgaggac tgcagcgtag acgatttgtc caaaatg 107
<210> 10
<211> 113
<212> DNA
<213> Artificial Sequence
<400> 10
atcggatcct caactcactc ttcgagcgtc tcaatgaagg acattcaaag ccaattcgag 60
cagctgaaac tgcggtggga gtcttatccc aatttggtca agagcaccga tta 113
Claims (8)
1. An influenza virus detection kit is characterized by comprising the following components:
magnesium acetate solution, Buffer solution, enzyme powder, CutSmart Buffer, recombined RNase Inhibitor, DNA fluorescent probe, Cas12a, primer group, FluA-crRNA and FluB-crRNA; the primer group comprises a FluA-RPA primer, a FluB-RPA primer, a FluA-crRNA primer and a FluB-crRNA primer.
2. The influenza virus detection kit of claim 1, wherein the FluA-RPA primer comprises:
primer A, whose nucleic acid sequence is 5'-aagaccgatcttgtcacctctgac-3';
primer B with the nucleic acid sequence of 5'-cattttggacaaatcgtctacgctg-3';
the FluB-RPA primer comprises:
primer C having a nucleic acid sequence of 5'-atcggatcctcaactcactcttcgagcg-3';
primer D, its nucleic acid sequence is 5'-taatcggtgctcttgaccaaattg-3';
the FluA-crRNA primer comprises:
primer E having a nucleic acid sequence of 5'-gaaattaatacgactcactatagggtaat-3';
primer F having the nucleic acid sequence of 5'-cctaaaatccccttagtcagaggt-3';
the FluB-crRNA primer comprises:
primer G having the nucleic acid sequence of 5'-gaaattaatacgactcactatagggtaat-3';
and (3) a primer H, wherein the nucleic acid sequence of the primer H is 5'-cattcaaagccaattcgagcagct-3'.
3. The influenza virus detection kit as claimed in claim 1, wherein the concentration of the magnesium acetate solution is 279-281 mmol/L.
4. The influenza virus detection kit of claim 1, wherein the buffer is a rehydration buffer.
5. The influenza virus detection kit of claim 4, wherein the rehydration buffer is an alkaline buffer.
6. The influenza virus detection kit of claim 1, wherein the enzyme powder is lyophilized enzyme powder.
7. The influenza virus detection kit of claim 6, wherein the lyophilized enzyme powder is one or more of a recombinase capable of binding single-stranded nucleic acid, a single-stranded DNA binding protein, and a strand-displacement DNA polymerase.
8. The influenza virus detection kit of claim 1 for use in virus detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111040012.3A CN113621737A (en) | 2021-09-06 | 2021-09-06 | Influenza virus detection kit and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111040012.3A CN113621737A (en) | 2021-09-06 | 2021-09-06 | Influenza virus detection kit and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113621737A true CN113621737A (en) | 2021-11-09 |
Family
ID=78389337
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111040012.3A Pending CN113621737A (en) | 2021-09-06 | 2021-09-06 | Influenza virus detection kit and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113621737A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114427009A (en) * | 2021-12-20 | 2022-05-03 | 杭州丹威生物科技有限公司 | Multiple enrichment detection method for influenza A, influenza B and respiratory syncytial virus |
| CN115404268A (en) * | 2022-10-11 | 2022-11-29 | 芜湖森爱驰生物科技有限公司 | SRY gene detection probe and kit |
-
2021
- 2021-09-06 CN CN202111040012.3A patent/CN113621737A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114427009A (en) * | 2021-12-20 | 2022-05-03 | 杭州丹威生物科技有限公司 | Multiple enrichment detection method for influenza A, influenza B and respiratory syncytial virus |
| CN115404268A (en) * | 2022-10-11 | 2022-11-29 | 芜湖森爱驰生物科技有限公司 | SRY gene detection probe and kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mahony et al. | Multiplex loop-mediated isothermal amplification (M-LAMP) assay for the detection of influenza A/H1, A/H3 and influenza B can provide a specimen-to-result diagnosis in 40 min with single genome copy sensitivity | |
| EP3339451B1 (en) | Primers for detecting influenza by using lamp, and use thereof | |
| Li et al. | Rapid detection of peste des petits ruminants virus by a reverse transcription loop-mediated isothermal amplification assay | |
| Liu et al. | Rapid detection of tobacco mosaic virus using the reverse transcription loop-mediated isothermal amplification method | |
| CN111321249A (en) | Loop-mediated isothermal amplification detection primer group, kit and method for SARS-CoV-2 | |
| CN113621737A (en) | Influenza virus detection kit and application thereof | |
| CN106755571B (en) | Kit for detecting Zika virus, dengue fever virus and chikungunya virus | |
| WO2022089550A1 (en) | Novel compositions and methods for coronavirus detection | |
| CN114369688B (en) | Compositions, kits, methods and uses for detecting a variant of SARS-CoV-2 Oncuronte | |
| CN116676429B (en) | LAMP primer group for detecting pangolin respiratory syncytial virus type B and application thereof | |
| CN111910017A (en) | Multiplex-time PCR (polymerase chain reaction) kit for detecting respiratory pathogens, method and application | |
| CN111286559A (en) | Primer, probe and kit for detecting African swine fever virus | |
| CN111926114A (en) | Multiplex-time PCR (polymerase chain reaction) kit for detecting parainfluenza virus, method and application | |
| EP2597162A1 (en) | Nucleic acid detection | |
| KR102019804B1 (en) | Primer set for detection of SFTSV and SFTSV detection method using the same | |
| US10047406B2 (en) | Compositions and methods for detecting HEV nucleic acid | |
| CN116356005B (en) | Composition for detecting CAR-T cell copy number and application thereof | |
| CN112831601A (en) | Primer probe set, kit and detection method for multiple detection of respiratory syncytial virus subtype based on fluorescent RMA method | |
| CN106011308B (en) | Hepatitis C virus genotyping detection kit, oligonucleotide and application thereof | |
| CN108130385A (en) | A kind of human cytomegalovirus kit for detecting nucleic acid | |
| CN111500782B (en) | Establishment and application of novel HIV-1 reverse transcriptase drug-resistant mutation site detection method | |
| CN116103437A (en) | Kit and primer combination and method for LAMP detection of influenza A virus, influenza B virus and respiratory syncytial virus | |
| CN113817870A (en) | Primer composition for simultaneously detecting seven respiratory tract-related viruses and application thereof | |
| CN104212919B (en) | A kind of LAMP primer composition thing for detecting HIV-1 virus and application thereof | |
| RU2797000C1 (en) | SET OF PRIMERS FOR THE SPECIES-SPECIFIC DETECTION OF THE SARS-CoV-2 CORONAVIRUS BY THE E- GENE FRAGMENT |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |