CN113621725B - Method for detecting watermelon fusarium wilt, tomato fusarium wilt and lotus root putrefying disease pathogens based on pathogenic bacteria mitochondrial genome sequence - Google Patents
Method for detecting watermelon fusarium wilt, tomato fusarium wilt and lotus root putrefying disease pathogens based on pathogenic bacteria mitochondrial genome sequence Download PDFInfo
- Publication number
- CN113621725B CN113621725B CN202010379737.4A CN202010379737A CN113621725B CN 113621725 B CN113621725 B CN 113621725B CN 202010379737 A CN202010379737 A CN 202010379737A CN 113621725 B CN113621725 B CN 113621725B
- Authority
- CN
- China
- Prior art keywords
- lamp
- primer
- oxysporum
- fusarium
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for rapidly identifying (or distinguishing) Fusarium communication strains and Fusarium oxysporum strains through mitochondrial genome differential sequences. The invention also discloses a method for directly detecting vascular bundle exudates or living materials of living plants by utilizing the differential sequence joint Loop-mediated isothermal amplification (Loop-mediated isothermal amplification, abbreviated as LAMP) technology, and the complicated steps of the nucleic acid extraction process are avoided. The invention can rapidly diagnose the pathogeny of watermelon fusarium wilt, tomato fusarium wilt and lotus root putrefying disease, can be used for predicting and forecasting related crop diseases, gains precious time for the prevention and control of related diseases, and reduces the loss caused by the occurrence of diseases.
Description
Technical Field
The invention discloses a method for rapidly detecting pathogenic bacteria of watermelon fusarium wilt, tomato fusarium wilt and lotus root putrefying disease by adopting a polymerase chain reaction (Polymerase Chain Reaction, abbreviated as PCR) and Loop-mediated isothermal amplification (Loop-mediated isothermal amplification, abbreviated as LAMP) technology, belonging to the field of biotechnology research.
Technical Field
The rot disease of lotus root is also called lotus root blast, is one of important diseases in the lotus root planting process, and can reduce the yield by 10-20% after the lotus root field is ill, and the serious yield can reach 60% -80%. In 1983, the disease was originally reported to be caused by infection with the fungus Fusarium oxysporum lotus specialization [ Fusarium oxysporum Schl.f. sp.Nelumbricola (Nis. & Wat.) Booth ], but related studies by domestic peer in recent years have shown that another Fusarium pathogenic fungus F.communication, which can also infect lotus roots and cause similar symptoms of lotus root spoilage disease. It is reported that the mechanisms of F.communication and F.oxysporum infection on plants are basically similar, and the infection is achieved through overwintering of mycelia and chlamydospores along with disease residues in lotus root field soil, invasion from underground stems or root systems and spreading in the stems and whole plants when the conditions are proper, so that the stem nodes and the root systems are discolored and rotten, and aerial leaves, leaf stalks and lotus seeders die.
In terms of genetics, F.communication and F.oxysporum are very similar, and the consistency of an internal transcription spacer (internal transcribed spacer, abbreviated as ITS) in the genome is 100%, so that the identification of the internal transcription spacer cannot be performed; morphologically, they are sister strains, and it is difficult for people who do not engage in fungus classification and identification to distinguish them quickly and accurately. At present, the common distinguishing means is to perform PCR amplification on the conserved sequences of housekeeping genes (such as mtSSU, EF1 alpha and the like), and after the Sanger method sequencing is completed, the sequences are aligned to realize the identification of pathogenic bacteria. However, this method requires a long waiting period of at least 3 days from preparation of the fungal sample, extraction of the genome to completion of the final sequencing, and is prone to errors after increasing the sample size, and the cost of the consumed reagents is low.
Watermelon and tomatoes planted on land are also threatened by fusarium pathogens, the most important of which are two soil-borne diseases, watermelon fusarium wilt and tomato fusarium wilt. The pathogens causing watermelon fusarium wilt are mainly caused by three types of fusarium oxysporum specialization, namely F.oxysporum f.sp.niveum, F.oxysporum f.sp.cuumerinum and F.oxysporum f.sp.radicis-cuumerinum; the pathogens responsible for tomato wilt are mainly F.oxysporum f.sp.lycopersici and F.oxysporum f.sp.radicis-lycopersici.
All the germs belong to soil-borne pathogenic fungi, and symptoms are not obvious in the initial stage of infection. It is therefore important to establish a rapid and accurate method for evaluating seedlings and the presence of the above-mentioned pathogens in plants at the beginning of the onset (or at a period of no onset). According to the evaluation and detection results, plant protection personnel and farmers can timely carry out remedial measures such as disease prevention and control, and provide basis and plan for follow-up field management and disease prevention and control.
Mitochondria (mitochondron) is an organelle that is widely found in eukaryotic cells, and is coated by two membranes, the primary site where the cell breathes aerobically. It is coupled to oxidative phosphorylation by electron transfer, producing the high energy compound adenosine triphosphate (adenosine triphosphate, ATP) that can be directly utilized by biological cells. In addition, mitochondria are involved in other cell biological processes including ion balance, intermediary metabolism, apoptosis, etc. (ion homeostasis, intermediary metabolism and apoptosis). In mitochondria, there is a set of deoxyribonucleic acids (DNA) independent of the nuclear chromosome genome, i.e., mitochondrial genomic DNA. Mitochondrial genomic DNA varies widely in size from a few kbp to a few hundred kbp among species, typically contains genes encoding 14 proteins, and synthesizes DNA sequences of 22-26 tRNA's, 2 rRNA's. Mitochondrial DNA is more abundant in copy number in a single cell than genomic DNA and is more easily released by ordinary physical action (freezing or high temperature), so that a method of detecting a specific sequence on mitochondrial DNA is very sensitive.
The accurate detection of the types and the amounts of pathogenic species in facility soil and seedlings before sowing or transplanting is a core technology for predicting and forecasting soil-borne diseases. The most traditional soil pathogen detection method adopts a plate dilution culture method (Scherm et al, 1998), but the method is time-consuming and labor-consuming, and the statistics of the true quantity of pathogenic bacteria by the mixed bacteria growing on the plate can be interfered. With the continued development of bioinformatics and molecular biology techniques, techniques based on polymerase chain reaction (Polymerase Chain Reaction, PCR), loop-mediated isothermal amplification (Loop-mediated isothermal amplification, LAMP), and fluorescent quantitative PCR are often applied to detection and quantitative analysis of soil-borne pathogens (Li et al, 2014; mbohung et al, 2011). The rationale for these is to amplify specific sequences of housekeeping genes on the target species genome, thus enabling the identification of specific pathogens and their quantitative analysis (Zitnick-Anderson et al, 2018; li et al, 2014). However, it is not easy to obtain high quality total genomic DNA of soil microorganisms, and there is a lower limit of detection in the above technique, and "false negatives" may occur in part of the detection results. Therefore, how to further improve the sensitivity of the detection method and further accurately predict the occurrence of the main soil-borne diseases becomes a hot spot of current research.
In mitochondria, there is a set of nucleic acid DNA independent of the nuclear genome, i.e., mitochondrial genomic DNA. Mitochondrial genomic DNA varies greatly among different species, but its sequence is very conserved in the same species (Burger et al, 2003). In a single eukaryotic cell, there is only one copy of genomic DNA, while there are tens or even hundreds of copies of mitochondrial genomic DNA. Therefore, the specific sequence on the mitochondrial DNA is used as a detection target, and a more sensitive and accurate detection method is provided.
Polymerase Chain Reaction (PCR) is a molecular biological technique used to amplify specific DNA fragments. Theoretically, it can amplify a trace amount of target DNA fragment by a factor of N to 2. The basic principle of PCR is that DNA forms single strand at 95 deg.c in vitro and combines with complementary single strand DNA in base pairing mode at low temperature, and at 72 deg.c, the DNA polymerase in the reaction system synthesizes and extends the complementary DNA strand from the primer combining position to the end of the paired template in the direction of 5'-3' of the nucleic acid strand.
Loop-mediated isothermal amplification (Lamp) technology was first published in journal of biology Nucleic Acids Research in 2000. The technology has high specificity and high sensitivity to the amplification of target nucleic acid sequences, and is very simple and convenient to operate. At present, detection technology based on Lamp is an important auxiliary means in the fields of diagnosis of human clinical diseases, qualitative and quantitative detection of animal and plant pathogenic microorganisms and the like. The principle can be briefly summarized as follows: the whole reaction requires at least 4 specific primers, namely FIP (upstream inner primer), BIP (downstream inner primer), F3 (upstream outer primer) and B3 (downstream outer primer), and two Loop primers can be added if the amplification efficiency is required to be improved. These primers, template, and highly active strand-displacing DNA polymerase are mixed in a concentration ratio such that the target DNA strand forms a single-stranded displacing DNA in a reaction solution containing the necessary ions and substrate at 65℃and then forms a neck ring structure at the positions of FIP and BIP. With the neck ring structure and the strand-displacing DNA polymerase, the strand-displacing DNA synthesis is constantly self-circulating and gradually prolonged and amplified. During the DNA synthesis reaction, a specific compound gradually accumulates in the reaction solution, and after a certain concentration is reached, a specific indication state such as discoloration or turbidity is presented in the reaction solution. Finally, whether the target DNA fragment exists in the detection sample can be judged by naked eyes or a turbidity meter. The method has been widely used in agricultural production due to low requirements on experimental conditions and platforms.
Disclosure of Invention
The invention utilizes mitochondrial DNA sequence assembly software GRAbB to assemble the second generation sequencing results of strains, and the sources of the nucleic acid sequences of the strains include: 2 lotus root pathogenic bacteria separated and subjected to second generation sequencing in the laboratory, 9 fusarium oxysporum (F.oxysporum) with published sequence information and 1 F.communication bacteria, and total 12 strains; by alignment and cluster analysis of these 12 mitochondrial genome segment sequences, a number of differences in mitochondrial sequence were found, of which 3 differential sequences are suitable for detection analysis, including 2 f.communication-specific sites and 1 f.oxysporum-specific sites; by utilizing the difference sequences, 2 sets of LAMP detection primers are designed, and the detection of living bodies of diseased watermelon seedlings, tomato seedlings and artificially inoculated lotus root nodes proves that the detection primers can quickly identify relevant pathogenic bacteria on the premise of not extracting nucleic acid.
The related technical route is as follows:
1. mitochondrial genome sequences corresponding to f.communication and f.oxysporum strains or corresponding second generation genome sequencing data were downloaded.
2. The second generation genomic sequencing data was assembled and spliced into mitochondrial genomic sequences using the GRAbB software.
3. Comparing the directly downloaded mitochondrial genome sequence with the mitochondrial genome sequence obtained by splicing by OMEGA software, wherein the website of the comparison tool is https: ,// www.ebi.ac.uk/Tools/msa/clustalo/.
4. And analyzing the results obtained by the OMEGA by using MEGA7 software, finding a difference site in the alignment chart, and designing a primer according to the sequence of the difference site. The common PCR primer adopts on-line primer design software https: the names of the primer are respectively: fc-specific 1-S, fc-specific 1-A, fc-specific 2-S, fc-specific 2-A, fo-specific 3-S, fo-specific 3-A. Wherein, the two sets of primers are F.communication specific detection primers, and one set of primers is F.oxysporum specific detection primers. In addition, lamp primer design was performed by http: the preferred primer combinations are obtained from the// primrexploer.jp/e/website. Primers include FIP (upstream inner primer), BIP (downstream inner primer), F3 (upstream outer primer), B3 (downstream outer primer), LF (upstream loop primer) and LB (downstream loop primer).
5. Pretreatment is performed according to different steps according to different samples and experimental purposes before PCR and LAMP detection, and the steps in the specific embodiment are detailed.
6. Finally, preparing a conventional PCR reaction reagent with the total volume of 25 mu l on an ice box according to the specification of the PCR enzyme; adding 1 μl of the culture solution after freeze thawing and splitting as a template into a PCR reaction system, uniformly mixing, setting a PCR instrument to perform PCR amplification reaction, and performing other steps according to the specification of PCR enzyme except the first step of pre-denaturation at 95 ℃ or 98 ℃ for 5 minutes. After completion of PCR, the analysis was performed by electrophoresis on a 2% agarose gel, and the electrophoresis band was observed by an ultraviolet imager.
7. For the LAMP reaction, a target sample is used as a template, which is added to a reaction solution that has been prepared in the following proportions (the preparation of the reaction solution is described in the detailed description section). After mixing, the PCR tube is kept at 62 ℃ (for detecting F.oxysporum) or 66 ℃ (for detecting F.communication) for reaction for 60-120 min (note: mineral oil is needed to be added into the PCR tube for preventing water from evaporating to the cover in the reaction condition of partial non-thermal cover), and then turbidity and color of the reaction tube are observed. If the reaction liquid in the reaction tube becomes turbid and the color of the reaction liquid changes from purple to sky blue, indicating that a target nucleic acid fragment exists in the sample corresponding to the reaction tube; if the reaction tube is purple in color, no target fragment is indicated. A conditional laboratory can analyze with 2% agarose gel electrophoresis and observe if the corresponding sample lane appears to be stepped from small to large with a UV imager, indicating that an amplification reaction has occurred.
8. For all the above PCR reactions, fluorescent quantitative PCR reactions and LAMP reactions, a negative control without template should be set, and if necessary, a positive control containing target template may be added.
The beneficial effects are that: the primer and the detection method designed by the invention can rapidly and accurately detect F.oxysporum or (sum) F.communication in the pathogenic plants, thereby avoiding the complicated work of separating and identifying a large number of pathogenic bacteria, shortening the detection and diagnosis time of pathogenic plant samples, winning precious time for timely prevention and control of related diseases and preventing the diseases from further expanding to cause larger loss.
Drawings
FIG. 1 mitochondrial differential sequences of F.oxysporum strain and F.communications strain of the examples
FIG. 2 identification results of a plurality of F.oxysporum strains and F.communication strains by conventional PCR, fluorescent quantitative PCR and LAMP methods used in the examples
FIG. 3 LAMP primer sensitivity analysis for detecting F.oxysporum strain and F.communication strain
FIG. 4 shows the results of detection of fusarium wilt (F.oxysporum) in diseased watermelon seedlings by LAMP method in examples.
FIG. 5 shows the results of detection of fusarium wilt (F.oxysporum) in tomato seedlings by LAMP method in examples.
FIG. 6 shows the results of detection of artificial inoculation of lotus root rot pathogen (F.communication) on lotus root node by LAMP method in application example.
Detailed Description
1. Mitochondrial genome sequence alignment analysis of related strains
Mitochondrial genome sequences comprising 12 different source strains of f.oxysporum and f.com were downloaded from National Center for Biotechnology Information (NCBI) website or assembled by GRAbB software, including f.oxysporum, f.oxysporum f.sp.niveum, f.oxysporum f.sp.cumerinum, f.oxysporum f.sp.cube TR4, f.oxysporum f.sp.lysopersici, f.oxysporum f.sp.cube, f.sp.con-tins, f.oxysporum f.sp.con, f.com, and f.oxysporum and f.com strains isolated from lotus roots in the laboratory. Mitochondrial genome information of the above fungi was put into online software https: the analysis is performed in/www.ebi.ac.uk/Tools/msa/clustalo/and after the analysis is completed, a clustalw property file is exported. Then, the file is opened by using MEGA7, the position and sequence of the difference between F.oxysporum and F.communication in the above sequence are searched, and recorded, and the comparison result of the nucleic acid region near the difference sequence is stored as fas and max attribute files. By alignment, 2 sites were obtained which were specifically present at F.communication and 1 site at F.oxysporum (FIG. 1). The relevant sequence information is as follows:
communication specific sequence 1#:
communication specific sequence # 2:
oxysporum specific sequence 3#:
through comparison of NCBI nucleic acid databases, the F.oxysporum specific sequence 3# is found to be highly conserved only in the F.oxysporum species, and the sequence similarity is lower in other species; for F.communication specific sequence 1# and F.communication specific sequence 2#, highly homologous sequences were found in F.oxysporum f.sp.lactucae strain 09-002 in addition to one F.communication-infectable F.oxysporum of lettuce, and highly similar sequences were not found in other species than F.communication. Most F.oxysporum plant pathogens have strict host specialization, and F.oxysporum f.sp.lactucae strain 09-002 cannot infect crops except for the Compositae, so that on crops such as lotus roots and chufa which can be infected by F.communications, F.communications specific sequences 1# and F.communications specific sequences 2# exist only in the F.communications.
2. PCR primers, fluorescent quantitative primers and LAMP specific primers were designed for the specific sites described above for distinguishing and detecting F.communication and F.oxysporum
The common PCR primer and the fluorescent quantitative primer adopt on-line primer design software https: the primer names, sequences and corresponding amplified regions are shown in Table 1 for the// www.ncbi.nlm.nih.gov/tools/primer-blast/obtained:
TABLE 1 common PCR primers and fluorescent quantitative primers
LAMP detection primer design was performed by http: the// primrexploer. Jp/e/website, including FIP (upstream inner primer), BIP (downstream inner primer), F3 (upstream outer primer), B3 (downstream outer primer), LF (upstream loop primer) and LB (downstream loop primer). Entering http: the primer V5 version of the primer is selected, the F.communication specific sequence 1# and the F.oxysporum specific sequence 3# to be detected are respectively introduced, and then primers are respectively designed for the primer. According to practical comprehensive consideration, among the listed primers, one set of most suitable primer combinations was selected, respectively, as shown in Table 2. Considering that Lamp detection is very sensitive, it is recommended that primers be synthesized by PAGE or HPLC methods with high accuracy.
TABLE 2 specific LAMP detection primers for F.Commine and F.oxysporum
3. Preparation of the sample to be tested
3.1 target is total DNA of strain to be tested: taking 22 F.commune and F.oxysporum strains stored in a laboratory (the sequence of strain information is shown in table 3), respectively collecting mycelia after culturing, grinding and crushing by liquid nitrogen, taking corresponding total DNA by a CTAB method, and the concentration of the DNA after dilution is between 100 ng/. Mu.l and 1 ng/. Mu.l.
| Strain numbering | Chinese strain name | English strain name | Strain species |
| 1 | Ginger 7 #) | Ginger-Fo-7# | Fo |
| 2 | Fo4287 | Fo4287 | Fo |
| 3 | Watermelon withering | Watermelon-Fo | Fo |
| 4 | Banana wilt (nan nong) | Banana-TR4 | Fo |
| 5 | GY16 | Watermelon-Fo-GY16 | Fo |
| 6 | African lotus seed-1 | Wuhan-seed-lotus-1# | Fc |
| 7 | Wuhan lotus root early-1 | Wuhan-lotus-1# | Fc |
| 8 | Lotus root rot-1 | Jinhua-lotus-1# | Fc |
| 9 | African lotus seed-5 | Wuhan-seed-lotus-5# | Fc |
| 10 | Wuhan lotus root-1 | Qianjiang-lotus-1# | Fo |
| 11 | Lotus root rot-7 | Jinhua-lotus-7# | Fc |
| 12 | Wuhan-2 | Qianjiang-lotus-2# | Fo |
| 13 | Lotus flower-1 | Wuhan-flower-lotus-1# | Fc |
| 14 | Jinhua lotus root rot-8 | Jinhua-lotus-8# | Fc |
| 15 | Wuhan lotus root early-3 | Wuhan-lotus-3# | Fc |
| 16 | Lotus root 1st | Lotus-1st | Fo |
| 17 | Guangchang 2-2 sequencing 6# | Guangchang-lotus-2-2# | Fc |
| 18 | FLG original No. 1 | Cabbage-Fo-1# | Fo |
| 19 | Yangzhou 6-2- (1) | Yangzhou-lotus-6-2# | Fc |
| 20 | Guangchang 2-4 | Guangchang-lotus-2-4# | Fc |
| 21 | African lotus seed-3 | Wuhan-seed-lotus-3# | Fc |
| 22 | Yangzhou 4-2(1) -1 | Yangzhou-lotus-4-2# | Fc |
Table 3 list of partial strains used in the examples
( And (3) injection: in the table, F.Commine and F.oxysporum are abbreviated as Fc and Fo, respectively )
3.2 cultures of the target strain to be tested: transferring the strain to be tested into 200 μl (2 ml sterilizing centrifuge tube) of liquid Potato Dextrose Broth (PDB), culturing at 25deg.C and 180rpm for 2 days, and freezing and thawing once in-20deg.C refrigerator or liquid nitrogen; directly after thawing the water bath was boiled for 10 minutes (for some strains, freeze thawing still does not release enough mitochondrial nucleic acid, this step can be added). Finally, after 10-fold dilution with sterilized double distilled water, 0.5. Mu.l was taken as template for the subsequent test.
3.3 target is plant stalk suspected to be infected: retrieving plants which are similar to symptoms of the wilt in the field or are artificially inoculated in a laboratory (note: part of plants are not yet developed after inoculation), cutting off the base of stems of the plants by about 2-5cm (or digging out inoculation parts on lotus root nodes), and repeatedly flushing the plants with tap water to remove impurities, soil or culture medium on the epidermis. For the young or low lignification stalks, juice in the stalks can be directly extruded at the cut-off position, 5-10 mu l of the juice can be collected by a pipette and a pollution-free 200 mu l PCR centrifuge tube, then 10 times of sterilized double distilled water is added, and after uniform mixing, boiling water bath or 95 ℃ high temperature treatment is carried out for 10 minutes, and 0.5-1 mu l of supernatant is taken as a reaction template of LAMP. For harder or more lignified samples, 0.05-0.1 g of the sample with color change or tissue browning of the vascular bundle system can be selected, the sample is ground by liquid nitrogen (taking care of cross contamination among samples) or is crushed by vibration of a crushing machine, 10 times of sterilized double distilled water is added, and after boiling water bath, 0.5-1 mu l of supernatant is taken as a reaction template of LAMP.
4. Specificity verification of ordinary PCR, fluorescent quantitative PCR and LAMP
Configuration of a common PCR reaction system: direct-amplification PCR enzyme (T5 Direct PCR Kit for Plant) was purchased from Nanjing department of Biotechnology, inc. 25. Mu.l of the PCR reaction system was prepared on ice box as required, 1. Mu.l of the corresponding total DNA (3.1 treated) or 0.5. Mu.l of the corresponding culture supernatant (3.1 treated) was added, and after mixing, the setting of the PCR instrument was performed according to the instructions provided by the enzyme, wherein the annealing temperature was set at 58 ℃.
Fluorescent quantitative PCR reactionConfiguration of the system: quantitative PCR kit (TB) purchased from TaKaRa company
Premix Ex Taq TM II) amplification was performed using a 3-step method, 40 cycles, and the annealing temperature was set at 58 ℃.
Configuration of LAMP reaction system: the reaction solution was prepared on an ice box according to the instructions of the LAMP reaction kit (Bst DNA Polymerase Large Fragment, P701): adding reactants except enzyme and template into a reaction tube; adding the mixture to the final concentration of 0.8 mol.L -1 Betaine and 180. Mu. Mol.L -1 Hydroxynaphthol blue (HNB); finally, adding the reaction enzyme and a proper amount of template (0.25-1 μl). The initial reaction solution was in a clear purple state, and after 60 to 120 minutes of reaction at 62 ℃ (for F.oxysporum) or 66 ℃ (for F.communication), the reaction tube containing the target template turned sky blue and exhibited a cloudy state.
The 22 strains in Table 3 were tested, wherein ordinary PCR and LAMP can use the culture-prepared template (3.2), whereas for fluorescent quantification, the extracted total DNA must be used as template (3.1). As can be seen from FIG. 2, all three methods can accurately identify the target strain, and from the fluorescent quantitative result, if the beta-tubulin sequence in the nuclear genome is taken as an internal reference, the copy number of the template amplified by the specific sequence in the mitochondria is 10 times or more than that of the internal reference, the detection sensitivity (the copy number is 10 times or more than that of the nuclear genome) can be improved by at least one order of magnitude by taking the mitochondrial genome as a detection target under the same reaction condition.
Sensitivity verification of LAMP detection
To further analyze the sensitivity of the LAMP detection method, total DNA of Lotus-1st and Guangchang-Lotus-2-2# extracted by CTAB method was subjected to gradient dilution, including the following nucleic acid concentrations: 200 ng/. Mu.l, 10 ng/. Mu.l, 1 ng/. Mu.l, 100 pg/. Mu.l, 10 pg/. Mu.l, 1 pg/. Mu.l, 100 fg/. Mu.l and 10 fg/. Mu.l. According to the condition of the detection primer, the respective reaction conditions were set, and after 90 minutes, the color of the reaction tube was observed, and agarose nucleic acid electrophoresis detection was performed. As can be seen from FIG. 3, the F.communication primer allows detection of the relevant target sample at a total nucleic acid concentration of at least 10 pg/. Mu.l, whereas the F.oxysporum allows detection of the target sample at a total nucleic acid concentration of 1 pg/. Mu.l, over a reaction time of 90 minutes.
Application of LAMP detection method in disease-causing watermelon and tomato plants (or lotus root node tissues)
After retrieving the plant sample, the sample is pretreated according to the 3.3 steps of the specific implementation method, then the corresponding primer is selected according to the pathogen to be detected, the LAMP reaction condition is set, after 120 minutes of reaction, the color change of the reaction tube is observed, and agarose gel electrophoresis analysis is carried out. As can be seen from fig. 4, on the diseased watermelon seedling, the presence of fusarium oxysporum (fusarium wilt) can be detected by detecting only the exudates extruded from the stalks; on tomato plants, the presence of fusarium wilt is also detected by the exudates from the stems (although some plants are not yet symptomatic), but the control reaction tubes of healthy plants are unchanged. For the lotus rhizome node artificially inoculated, the detection primer aiming at F.communication can detect the existence of related pathogenic bacteria on an inoculation part.
Sequence listing
<110> academy of agricultural sciences in Jiangsu province
<120> method for detecting watermelon fusarium wilt, tomato fusarium wilt and lotus root putrefying disease pathogen based on pathogenic bacteria mitochondrial genome sequence
<140> 202010379737.4
<141> 2020-05-07
<160> 27
<170> SIPOSequenceListing 1.0
<210> 1
<211> 225
<212> DNA
<213> Fusarium commune
<400> 1
gagtacactt tgttagagga cgagtaaaaa aaaatacatt tttttacccg tccccgcaag 60
ctaagctcta gctaattatt taaatatatc taaagtaact gtaggtaagt atttaaataa 120
tgaactaatc tataaaaacg agctttagca catttttcta ggaaggcgta agctctagcg 180
cagcctacat atttaaacct ataaattaat aattttgagt ataag 225
<210> 2
<211> 99
<212> DNA
<213> Fusarium commune
<400> 2
tatctcgtcc tccctactac acgattttat gtctatatga aggcgcaagc tcgtagatat 60
acccgtcctt tacctgattt agtaatgcta cgtcttgct 99
<210> 3
<211> 107
<212> DNA
<213> Fusarium oxysporum (Fusarium oxysporum)
<400> 3
cagtagcata ttatctgtgc tgtttttggc taaatctagt caccagctac cgctattaca 60
gaaattactg gtattagcta actataagct aagcttcggt tagccta 107
<210> 4
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
cgtccccgca agctaagctc t 21
<210> 5
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
acgccttcct agaaaaatgt gct 23
<210> 6
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
tatctcgtcc tccctactac ac 22
<210> 7
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
gacgtagcat tactaaatca gg 22
<210> 8
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
cagtagcata ttatctgtgc tgtt 24
<210> 9
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
taggctaacc gaagcttagc tt 22
<210> 10
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
agtatgatta gctttacccc ta 22
<210> 11
<211> 26
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
ctggactata ccttatttaa tatcga 26
<210> 12
<211> 57
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
gccaaatctg gttaaatagc ctctgttttt ttaatattct ttataggatc tgtggca 57
<210> 13
<211> 54
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
aagatcacaa attgctggaa tttctttttt tttgatcaca tctagtctct gaag 54
<210> 14
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
caaatggtgc tctattagtc tc 22
<210> 15
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
gagaatcagc aggtaatcaa ct 22
<210> 16
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
aacagtagca tattatctgt gc 22
<210> 17
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 17
gctatagctt actatttcta ccag 24
<210> 18
<211> 58
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 18
ccgaagctta gcttatagtt agctaatatt ttttgttttt gactaaatct agtcacca 58
<210> 19
<211> 62
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 19
atgactatag gtaagctatt actactaagt ttttttcacc ttaggataaa ttgttattgt 60
tc 62
<210> 20
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 20
ccagtaattt ctgtaatagc ggtag 25
<210> 21
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 21
gtttatattg aggaaagtta taat 24
<210> 22
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 22
cccgtttgac aggtgcacgt tc 22
<210> 23
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 23
cctgcaatca tcaactcaac ac 22
<210> 24
<211> 26
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 24
tctctgtgct gtttttggct aaatct 26
<210> 25
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 25
ggctaaccga agcttagctt atag 24
<210> 26
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 26
cctccctact acacgatttt atg 23
<210> 27
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 27
gcaagacgta gcattactaa atcag 25
Claims (5)
1. A marker for identifying Fusarium strains c and Fusarium oxysporum, wherein the marker is selected from the group consisting of f.com specific sequence 1#, f.com specific sequence 2# and f.oxysporum specific sequence 3#.
The sequence of the F.communication specific sequence 1# is shown as SEQ ID No. 1, and specifically comprises the following steps:
GAGTACACTTTGTTAGAGGACGAGTAAAAAAAAATACATTTTTTTACCCGTCCCCGCAAGCTAAGCTCTAGCTAATTATTTAAATATATCTAAAGTAACTGTAGGTAAGTATTTAAATAATGAACTAATCTATAAAAACGAGCTTTAGCACATTTTTCTAGGAAGGCGTAAGCTCTAGCGCAGCCTACATATTTAAACCTATAAATTAATAATTTTGAGTATAAG；
the sequence of the F.communication specific sequence No. 2 is shown in SEQ ID No. 2, and specifically comprises the following steps:
TATCTCGTCCTCCCTACTACACGATTTTATGTCTATATGAAGGCGCAAGCTCGTAGATATACCCGTCCTTTACCTGATTTAGTAATGCTACGTCTTGCT；
the sequence of the F.oxysporum specific sequence 3# is shown in SEQ ID No. 3, and specifically comprises the following steps:
CAGTAGCATATTATCTGTGCTGTTTTTGGCTAAATCTAGTCACCAGCTACCGCTATTACAGAAATTACTGGTATTAGCTAACTATAAGCTAAGCTTCGGTTAGCCTA。
2. an oligonucleotide primer designed according to f.communication specific sequence 1#, f.communication specific sequence 2# and f.oxysporum specific sequence 3# of claim 1, said oligonucleotide primer being a conventional PCR primer, a fluorescent quantitative PCR primer or a LAMP primer; the oligonucleotide primer is used for detecting pathogenic bacteria causing watermelon Fusarium wilt, tomato Fusarium wilt and lotus root putrefying disease, wherein the pathogenic bacteria are Fusarium communication and Fusarium oxysporum strains;
wherein, the common PCR primer comprises:
The fluorescent quantitative PCR primer comprises:
The LAMP primer includes:
。
3. Use of a marker according to claim 1, or an oligonucleotide primer according to claim 2, for detecting pathogenic bacteria causing watermelon fusarium wilt, tomato fusarium wilt and lotus root rot.
4. The use according to claim 3, characterized in that it is for the identification of Fusarium strains communications and Fusarium oxysporum, said identification comprising the steps of: the oligonucleotide primer of claim 2, wherein the f.communication specific sequence 1#, f.communication specific sequence 2# and f.oxysporum specific sequence 3# of claim 1 are amplified using polymerase chain reaction, loop-mediated isothermal amplification or fluorescent quantitative PCR.
5. The use according to claim 4, wherein the target pathogenic bacteria are detected by directly amplifying the culture supernatant of the target bacteria without any nucleic acid extraction step when using the polymerase chain reaction; or directly amplifying the supernatant of the culture of the target bacteria or the exudates of the stems of the pathogenic plants on the premise of not needing any nucleic acid extraction step when loop-mediated isothermal amplification is adopted, so as to detect the target pathogenic bacteria.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010379737.4A CN113621725B (en) | 2020-05-07 | 2020-05-07 | Method for detecting watermelon fusarium wilt, tomato fusarium wilt and lotus root putrefying disease pathogens based on pathogenic bacteria mitochondrial genome sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010379737.4A CN113621725B (en) | 2020-05-07 | 2020-05-07 | Method for detecting watermelon fusarium wilt, tomato fusarium wilt and lotus root putrefying disease pathogens based on pathogenic bacteria mitochondrial genome sequence |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113621725A CN113621725A (en) | 2021-11-09 |
| CN113621725B true CN113621725B (en) | 2023-06-20 |
Family
ID=78377084
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010379737.4A Active CN113621725B (en) | 2020-05-07 | 2020-05-07 | Method for detecting watermelon fusarium wilt, tomato fusarium wilt and lotus root putrefying disease pathogens based on pathogenic bacteria mitochondrial genome sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113621725B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113897454B (en) * | 2021-11-19 | 2023-09-15 | 青岛农业大学 | PCR-based rapid identification method for tomato wilt |
| CN115161412B (en) * | 2022-08-04 | 2024-06-04 | 云南省烟草农业科学研究院 | Detection method for shared fusarium and application thereof |
| CN116083630B (en) * | 2022-12-31 | 2024-04-12 | 昆明理工大学 | Primer group for detecting pathogenic bacteria Fusarium oxysporum of root rot of pseudo-ginseng by real-time fluorescent LAMP |
| CN117951530B (en) * | 2024-03-26 | 2024-06-07 | 阿坝州林业和草原科学技术研究所 | Disease and pest data analysis method and system for walnut with clip |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2006345844A (en) * | 2005-06-14 | 2006-12-28 | Saitama Prefecture | Molecular marker for indirectly discriminating tomato wilting disease fungus |
| CN103725782A (en) * | 2013-12-23 | 2014-04-16 | 湖南省植物保护研究所 | Method, kit and primer for detecting pathogenic bacteria of lotus fungal rot disease carried by lotus seeds |
| CN108866165A (en) * | 2018-07-17 | 2018-11-23 | 河北农业大学 | Quantitative detection primer and detection method for watermelon fusarium wilt |
| CN109182582A (en) * | 2018-10-18 | 2019-01-11 | 河北农业大学 | Qualitative detection primer and detection method for fusarium oxysporum f.sp.cubense |
| CN109355424A (en) * | 2018-12-07 | 2019-02-19 | 江苏省农业科学院 | A kind of detection method and its application of the lotus rhizome rot disease pathogen based on Lamp technology |
| CN110499386A (en) * | 2019-09-18 | 2019-11-26 | 扬州大学 | A kind of method of quick detection tomato wilt |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105950617B (en) * | 2016-07-04 | 2019-04-19 | 宁夏泰金种业有限公司 | Chain molecular labeling, preparation method and application with tomato wilt resistant gene |
-
2020
- 2020-05-07 CN CN202010379737.4A patent/CN113621725B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2006345844A (en) * | 2005-06-14 | 2006-12-28 | Saitama Prefecture | Molecular marker for indirectly discriminating tomato wilting disease fungus |
| CN103725782A (en) * | 2013-12-23 | 2014-04-16 | 湖南省植物保护研究所 | Method, kit and primer for detecting pathogenic bacteria of lotus fungal rot disease carried by lotus seeds |
| CN108866165A (en) * | 2018-07-17 | 2018-11-23 | 河北农业大学 | Quantitative detection primer and detection method for watermelon fusarium wilt |
| CN109182582A (en) * | 2018-10-18 | 2019-01-11 | 河北农业大学 | Qualitative detection primer and detection method for fusarium oxysporum f.sp.cubense |
| CN109355424A (en) * | 2018-12-07 | 2019-02-19 | 江苏省农业科学院 | A kind of detection method and its application of the lotus rhizome rot disease pathogen based on Lamp technology |
| CN110499386A (en) * | 2019-09-18 | 2019-11-26 | 扬州大学 | A kind of method of quick detection tomato wilt |
Non-Patent Citations (2)
| Title |
|---|
| Fusarium oxysporum and the Fusarium Wilt Syndrome;Thomas R. Gordon;《Annual Review of Phytopathology》;第23-39页 * |
| 西瓜枯萎病菌PCR分子检测方法研究;钟鑫;赵静;吴晓蕾;李敬蕊;吕桂云;;果树学报(12);第1771-1779页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113621725A (en) | 2021-11-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113621725B (en) | Method for detecting watermelon fusarium wilt, tomato fusarium wilt and lotus root putrefying disease pathogens based on pathogenic bacteria mitochondrial genome sequence | |
| CN106399490B (en) | LAMP primer group for detecting phytoplasma and kit and application thereof | |
| CN108085410B (en) | Seedling-stage strawberry anthracnose latent infection and rapid detection method for application of anthracnose latent infection | |
| Poletto et al. | Characterization and pathogenicity of Fusarium oxysporum associated with Carya illinoinensis seedlings | |
| Garcia et al. | Characterization of Fusarium spp. isolates recovered from bananas (Musa spp.) affected by Fusarium wilt in Puerto Rico | |
| CN109868324A (en) | One species-specific primer and its detection method | |
| CN116516058A (en) | Method and kit for visually detecting phytophthora sojae | |
| CN104946760A (en) | Method for detecting pythium inflatum and dedicated kit | |
| CN106544438A (en) | A kind of application of genetic marker in purpleapricot identification | |
| CN114517238B (en) | SSR molecular marker and method for identifying tremella aurantialba ZJJJE 001 strain | |
| CN106957915B (en) | Primer and kit for detecting apple tree/pear tree rot pathogen and quantitative detection method | |
| CN113151523A (en) | PCR detection method for ralstonia solanacearum | |
| CN110468233A (en) | A kind of primer, kit and the detection method of quick detection Machilus nanmu leaf blight | |
| CN111041124A (en) | LAMP primer and kit for detecting Neofuscoccum algeriense | |
| CN111020056A (en) | LAMP primer and kit for detecting Lasiodipodia curvata | |
| CN111020055B (en) | LAMP primer and kit for detecting Lasiodipia gonubiensis | |
| Takano et al. | Morphology, taxonomy and phylogenetic positions of two Spirogyra species (Zygnematophyceae, Streptophyta) with replicate and semi-replicate transverse walls from Japan | |
| CN109609683A (en) | A kind of LAMP detection primer detecting colletotrichum gloeosporioides Penz in olive tissue | |
| CN111041120B (en) | LAMP primer and kit for detecting Lasiodipia thailandica | |
| KR101434832B1 (en) | Primers of polymerase chain reactions for the detection of Phytophthora species broken out on kind of fruit tree or seedling, and detection kits and methods thereof | |
| Zidan et al. | Morphological and Molecular Characterization of Fusarium chlamydosporum, F. brachygibbosum and F. flocciferum Associated with Crown and Root Rot of Wheat. | |
| CN111041123B (en) | LAMP primer and kit for detecting Botryosphaeria sinensia | |
| CN117106953A (en) | Method for searching specific sites based on Mummer gene sequence comparison so as to design primers for distinguishing fusarium oxysporum tomato specialized strain from watermelon specialized strain | |
| AU2021101342A4 (en) | Enhanced loop-mediated isothermal amplification method for detecting latent xap infection in pomegranate | |
| CN111020057B (en) | LAMP primer and kit for detecting Botryosphaeria fabicciana |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |