CN113621700B - A method for screening erythroid transcription factor EKLF gene mutations and its application - Google Patents

Abstract

The invention belongs to the field of biological medicine, and in particular relates to a method for screening red transcription factor EKLF gene mutation and application thereof. The method is characterized in that an amplification primer is designed according to an EKLF gene sequence, and an optimized high-resolution melting curve reaction system is utilized to screen unknown mutation of the EKLF gene in a sample. The detection method provided by the invention has the advantages of simple operation, high speed, high flux, no need of post-treatment of PCR products, capability of detecting the difference of single base, and really realizing closed-tube operation, and wide clinical application prospect.

Description

A method for screening erythroid transcription factor EKLF gene mutations and its application

Technical field

The invention belongs to the field of biomedicine, and specifically relates to a method for screening erythroid transcription factor EKLF gene mutations and its application.

Background technique

The erythroid transcription factor EKLF/KLF1 was first discovered by Bieker, a scientist at Mount Sinai School of Medicine in the United States. It regulates a series of growth and development processes of red blood cells by specifically recognizing and binding to conserved DNA sequences to initiate the transcription of downstream genes. The EKLF gene (NC_000019.10) is located at 19p13.2, with a full length of 2781bp, containing three exons and two introns. The protein consists of 2 functional domains: one is located at the N-terminus and is enriched in proline. Transcription activation domain; the other is located at the C-terminus and is a zinc finger domain that binds conserved DNA sequences. Studies have shown that dominant mutations or double mutations in the EKLF gene can lead to a series of hematological disease phenotypes, while single-allelic mutations in the EKLF gene can lead to a series of benign phenotypes, such as increased fetal hemoglobin HbF and adult hemoglobin A2 (HbA2). , thereby producing a phenotypic modification effect on the clinical phenotype of b-thalassemia.

The main methods for screening unknown mutations in genes include denaturing high-performance liquid chromatography (DHPLC), single-strand conformation polymorphism (SSCP), Sanger sequencing (gold standard), and next-generation sequencing. However, these detection methods have more or less shortcomings such as cumbersome operation steps, long detection cycles, and high detection costs. High resolution melting analysis (HRM) technology is a genetic analysis method that can achieve high-throughput and obtain reliable results for mutation scanning and genotyping. The main principle of HRM screening for mutations is that based on the differences in fragment length, GC content, and base complementary pairing of different nucleic acid molecules, when the PCR product is heated and denatured, even a single base change is enough to affect the melting temperature (Tm) of the fragment. value), the double-stranded DNA molecules simultaneously form a unique shape and position of the melting curve, so that the samples can be distinguished based on the differences in the melting curves, and the positive samples for the screened mutations are finally confirmed by Sanger sequencing.

Therefore, the application of HRM to screen for EKLF gene mutations has important application value. Currently, the most common screening method is Sanger sequencing. The experiment is performed step by step. The required reagents are complex, time-consuming and labor-intensive, high economic cost, easy to contaminate, and not applicable. For large-scale population screening, exploring a method and detection kit suitable for large-scale population screening of EKLF gene mutations has become a hot issue in clinical experimental research.

Contents of the invention

In response to the above problems, the purpose of the present invention is to provide a detection kit for detecting unknown mutations in the EKLF gene using HRM technology, so as to solve the problem in the above background technology that the reagent raw materials currently used for detection require multiple preparations, and the experimental operation steps are cumbersome and time-consuming. It is long, easy to contaminate, and has high detection costs.

In order to achieve the above objects, the present invention provides the following technical solutions.

The present invention provides a PCR primer set for detecting EKLF gene mutations based on high-resolution melting curve technology. It is characterized in that the primer set includes 9 pairs of primers, and the details are as follows:

(1) The upstream and downstream primers of the EKLF gene promoter region are: SEQ ID NO:1 and SEQ ID NO:2;

(2) The upstream and downstream primers for the exon 1 region of the EKLF gene are: SEQ ID NO: 3 and SEQ ID NO: 4;

(3) The upstream and downstream primers for the exon 2-1 region of the EKLF gene are: SEQ ID NO:5 and SEQ ID NO:6;

(4) The upstream and downstream primers for the exon 2-2 region of the EKLF gene are: SEQ ID NO:7 and SEQ ID NO:8;

(5) The upstream and downstream primers for the exon 2-3 region of the EKLF gene are: SEQ ID NO: 9 and SEQ ID NO: 10;

(6) The upstream and downstream primers for the exon 2-4 region of the EKLF gene are: SEQ ID NO: 11 and SEQ ID NO: 12;

(7) The upstream and downstream primers for the exon 3 region of the EKLF gene are: SEQ ID NO: 13 and SEQ ID NO: 14;

(8) The upstream and downstream primers of the 3'UTR-1 region of the EKLF gene are: SEQ ID NO: 15 and SEQ ID NO: 16;

(9) The upstream and downstream primers of the 3'UTR-2 region of the EKLF gene are: SEQ ID NO: 17 and SEQ ID NO: 18 respectively.

The present invention also provides a detection reaction system for detecting EKLF gene mutations based on high-resolution melting curve technology, characterized in that the reaction system contains one or more sets of PCR primer sets according to claim 1.

Further, the reaction system also includes negative quality control products, PCR buffer, dNTPs, DNA polymerase, LCGreen, Betain, deionized water and DMSO; the dNTPs mixture includes dATP, dTTP, dGTP and dCTP.

Furthermore, the DNA polymerase is Guangzhou Dingguo Biotech Taq DNA polymerase.

More recently, the Betain is 5M.

The present invention also provides a detection kit for detecting EKLF gene mutation based on high-resolution melting curve technology, which is characterized in that the kit contains one or more sets of PCR primer sets according to claim 1.

Further, the kit further includes the detection reaction system according to claim 3.

The present invention also provides a detection method for detecting EKLF gene mutations based on high-resolution melting curve technology, which is characterized in that the detection method includes the following steps:

(1) Preparation of sample DNA to be tested: Collect peripheral blood samples from the subjects to be tested, and extract sample DNA using column method;

(2) High-resolution melting curve reaction system:

The 10μL PCR reaction system includes: 10×Taq buffer (containing 20mM Mg2+) 1.0μL, 2.5nM dNTPs 0.4μL, 5U/μl Taq DNA polymerase 0.2μL, 10μM upstream and downstream primers 0.6μL, 1×LC Green 1μL, template DNA 0.8μL, 5MBetain 2.0μL, DMSO 1.0μL, deionized water 3.0μL;

(3) PCR reaction program: Carry out on a PCR machine according to specific cycling conditions, pre-denaturation at 95°C for 5 minutes; 95°C for 30 seconds, 63-68°C for 30 seconds, 72°C for 30 seconds, a total of 45 cycles; 95°C 1 minutes, keep warm at 4°C;

(4) After PCR amplification is completed, fluorescence is detected on a high-resolution melting curve analyzer (LightScanner HRⅠ96). The starting temperature is 55°C, the stop temperature is 98°C, and the standby temperature is 42°C; the abscissa is temperature, and the vertical axis is temperature. The coordinates are relative fluorescence intensity.

The present invention also provides a detection kit for detecting EKLF gene mutations based on high-resolution melting curve technology, which is characterized in that the kit is used in detecting EKLF gene mutations in samples.

Compared with the prior art, the present invention has beneficial effects.

1) The reaction system of the present invention is used for screening unknown mutations in the EKLF gene.

2) The primers designed in the present invention have high sensitivity and strong specificity.

3) The operation is simple and fast, and mutated positive samples can be screened out on the same day.

4) PCR products do not require post-processing and can detect the difference of a single base. It achieves true closed-tube operation to reduce the risk of contamination and is very suitable for the analysis of a large number of samples.

5) The detection system of the present invention has low cost, short cycle and simple operation. It has been widely promoted in the market and has high commercial returns.

Description of the drawings

Figure 1 is a schematic diagram of 9 primer pairs covering the EKLF gene region; F represents the forward primer and R represents the reverse primer.

Figure 2 is a schematic diagram of the results of HRM screening of partial mutations in the EKLF gene with 9 PCR amplicons. The different curve shapes of the bulge represent different variant-positive samples.

Figure 3 is the sequencing chart of some mutation-positive samples screened by HRM that were verified by Sanger sequencing.

Detailed ways

The present invention will be further described below in conjunction with specific embodiments. It should be understood that these examples are only used to illustrate the invention and are not intended to limit the scope of the invention.

The experimental methods used in the following examples are conventional methods unless otherwise specified.

Example 1.

Based on the EKLF gene sequence in GenBank, the present invention uses Primer Express3.0 software gene mutation region to design 9 pairs of specific primers covering the non-coding region of the EKLF gene (promoter region, splicing site, 5'UTR and 3'UTR) and all coding regions (exon 1, exon 2 and exon 3), the shortest amplicon fragment length is 179bp and the longest is 348bp, and its specificity was initially identified through the BLAST function of NCBI. The positions of the primers cover each other to avoid "dead spots" in screening.

The 9 pairs of upstream and downstream primers are as follows:

1) The upstream and downstream primers of the EKLF gene promoter region are: 5'-TACCCAGCACCTGGACCCTC-3', 5'-GAGGCTGTGATAGCCCCTTCG-3';

2) The upstream and downstream primers for the exon 1 region of the EKLF gene are: 5'-CTAAGGACAGAGAGGAGCCC-3', 5'-CAGCCAGCCCACCTAGAC-3';

3) The upstream and downstream primers for the exon 2-1 region of the EKLF gene are: 5'-CCAGTGTCCACCGAACCTC-3', 5'-ATCCTCCGAACCCAAAAGCC-3';

4) The upstream and downstream primers for the exon 2-2 region of the EKLF gene are: 5'-CGAGACTCTGGGCGCATA-3', 5'-GGAAGTGCCCTTGGTACTGA-3';

5) The upstream and downstream primers for the exon 2-3 region of the EKLF gene are: 5'-GTACCCCGCGATGTACCC-3', 5'-CGGTCTCGGCTATCACACC-3';

6) The upstream and downstream primers for the exon 2-4 region of the EKLF gene are: 5'-GGGGACTGCAGAGGATCCA-3', 5'-GCGCCCTTTCTCATGTCC-3';

7) The upstream and downstream primers for the exon 3 region of the EKLF gene are: 5'-CAGACAGTGGCGCTTATGG-3', 5'-CCCCAGTCACTAGGAGAGTCC-3';

8) The upstream and downstream primers of the 3'UTR-1 region of the EKLF gene are: 5'-CATGAAGCGCCACCTTTGAGC-3', 5'-TCTCACTGGGTTTGCACCGACA-3';

9) The upstream and downstream primers of the 3'UTR-2 region of the EKLF gene are: 5'-GAGCCACACAGAGATGTCCAAAC-3', 5'-TTACAGCCTCCTGCCATCTTCC-3'.

Example 2.

The invention discloses a reaction system and PCR reaction conditions containing the above PCR primer set. The reaction system mainly includes the following components: 9 sets of primer pair mixture (10 μM) described in Example 1, negative quality control products, 10×Taq buffer (containing 20mM Mg2+), 2.5nM dNTPs, 5U/μl Taq DNA polymerase, 1×LC Green, template DNA, 5M Betain, DMSO and deionized water.

The reaction conditions are:

1) PCR amplification conditions: pre-denaturation at 95°C for 5 minutes; 45 cycles (melting: 95°C for 30 seconds, annealing: 63-68°C for 30 seconds, extension: 72°C for 30 seconds); denaturation: 95°C for 1 minute, Keep warm at 4℃.

2) Reaction conditions for HRM analysis using a resolution melting curve analyzer (LightScanner HRⅠ96): starting temperature "Start Temp" is 55°C, end temperature "End Temp" is 98°C and standby temperature "Hold Temp" is 42°C. When the temperature gradually increases at 0.1°C/s, the DNA double strands gradually denature and unravel, the LC Green dye falls off from the DNA molecule double strands, and the fluorescence value gradually decreases. The instrument detects the fluorescence value in real time and establishes the fluorescence value as it changes over time. The melting curve obtained by decreasing as the temperature increases can be used to determine whether the unknown sample has mutations by comparing the difference in the melting curve between the unknown sequence and the known wild-type sequence (negative quality control product).

Example 3 takes the EKLF gene promoter region mutation screening as an example to perform HRM detection of EKLF gene mutations.

1) Specifically includes the following:

Step 1. Preparation of sample DNA to be tested: collect peripheral blood samples from the subject and extract sample DNA using column method;

Step 2, aliquot the reaction solution: Mix the upstream and downstream primers of the EKLF gene promoter region and the PCR reaction solution, and distribute it into a Bio-Rad 96-well PCR plate. Each well includes 1.0 μL of 10× Taq buffer (containing 20mM Mg2+). , 2.5nM dNTPs 0.4μL, 5U/μl Taq DNA polymerase 0.2μL, 10μM upstream and downstream primers 0.6μL, 1×LC Green 1μL, template DNA 0.8μL, 5M Betain 2.0μL, DMSO 1.0μL, deionized water 3.0μL;

Step 3, add the DNA of the sample to be tested: add 1 μL of negative quality control to the first three wells of the 96-well PCR plate, and add 1 μL of different sample DNA to be tested to the remaining 96 wells, and then briefly centrifuge the 96-well plate to ensure that the DNA is mixed in The reaction solution is then liquid-sealed with liquid paraffin, and finally the upper part of the 96-well PCR plate is covered with tin foil;

Step 4, PCR reaction: Carry out on a PCR machine according to specific cycling conditions - pre-denaturation at 95°C for 5 minutes; 45 cycles (melting: 95°C for 30 seconds, annealing: 63-68°C for 30 seconds, extension: 72°C for 30 seconds seconds); Denaturation: 95°C for 1 minute, incubation at 4°C;

Step 5, HRM analysis: After the PCR amplification is completed, detect fluorescence on a high-resolution melting curve analyzer (LightScanner HRⅠ96). The starting temperature "Start Temp" is 55°C, the end temperature "End Temp" is 98°C and The standby temperature "Hold Temp" is 42℃;

Step 6, result interpretation: Select positive samples based on the melting curve scanned by the HRM instrument.

2) Results: The HRM analysis results are shown in Figure 3. The detected positive samples were DNA sequenced and compared using NCBI Blast. The comparison results were consistent with the results of analyzing the high-resolution melting curve using a high-resolution melting curve analyzer (LightScanner HRⅠ96), proving that the detection method provided by the present invention can effectively EKLF Mutated genes are tested.

3) Conclusion: This invention uses high-resolution melting curves to detect EKLF gene mutations for the first time, expanding the application of EKLF gene mutation screening. This kit is simple to operate and fast. The PCR product does not require post-processing, can detect the difference of a single base, truly realizes closed-tube operation, and can detect EKLF gene mutations.

sequence list

<110>Guangdong Maternal and Child Health Hospital

<120>A method for screening erythroid transcription factor EKLF gene mutations and its application

<141> 2021-09-22

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213>Artificial sequence

<400> 1

tacccagcacctggacccctc 20

<210> 2

<211> 21

<212> DNA

<213>Artificial sequence

<400> 2

gaggctgtga tagccccttc g 21

<210> 3

<211> 20

<212> DNA

<213>Artificial sequence

<400> 3

ctaaggacag agaggagccc 20

<210> 4

<211> 18

<212> DNA

<213>Artificial sequence

<400> 4

cagccagccc acctagac 18

<210> 5

<211> 19

<212> DNA

<213>Artificial sequence

<400> 5

ccagtgtcca ccgaacctc 19

<210> 6

<211> 20

<212> DNA

<213>Artificial sequence

<400> 6

atcctccgaacccaaaagcc 20

<210> 7

<211> 18

<212> DNA

<213>Artificial sequence

<400> 7

cgagactctg ggcgcata 18

<210> 8

<211> 20

<212> DNA

<213>Artificial sequence

<400> 8

ggaagtgcccttggtactga 20

<210> 9

<211> 18

<212> DNA

<213>Artificial sequence

<400> 9

gtaccccgcg atgtaccc 18

<210> 10

<211> 19

<212> DNA

<213>Artificial sequence

<400> 10

cggtctcggc tatcacacc 19

<210> 11

<211> 19

<212> DNA

<213>Artificial sequence

<400> 11

ggggactgca gaggatcca 19

<210> 12

<211> 18

<212> DNA

<213>Artificial sequence

<400> 12

gcgccctttc tcatgtcc 18

<210> 13

<211> 19

<212> DNA

<213>Artificial sequence

<400> 13

cagacagtgg cgcttatgg 19

<210> 14

<211> 21

<212> DNA

<213>Artificial sequence

<400> 14

ccccagtcac taggagagtc c 21

<210> 15

<211> 21

<212> DNA

<213>Artificial sequence

<400> 15

catgaagcgc cacctttgag c 21

<210> 16

<211> 21

<212> DNA

<213>Artificial sequence

<400> 16

tctcactggg tttgcacgac a 21

<210> 17

<211> 23

<212> DNA

<213>Artificial sequence

<400> 17

gagccacaca gagatgtcca aac 23

<210> 18

<211> 22

<212> DNA

<213>Artificial sequence

<400> 18

ttacagcctc ctgccatctt cc 22

Claims (9)

1. A PCR primer set for detecting EKLF gene mutation based on a high-resolution melting curve technology, which is characterized by comprising 9 pairs of primers, and is characterized in that the following details are:

(1) The upstream and downstream primers of the EKLF gene promoter region are respectively as follows: SEQ ID NO. 1 and SEQ ID NO. 2;

(2) The primers upstream and downstream of the exon 1 region of the EKLF gene are respectively as follows: SEQ ID NO. 3 and SEQ ID NO. 4;

(3) The primers upstream and downstream of the 2-1 region of the exon of the EKLF gene are respectively as follows: SEQ ID NO. 5 and SEQ ID NO. 6;

(4) The primers upstream and downstream of the exon 2-2 region of the EKLF gene are respectively as follows: SEQ ID NO. 7 and SEQ ID NO. 8;

(5) The primers upstream and downstream of the region 2-3 of the exon of the EKLF gene are respectively as follows: SEQ ID NO. 9 and SEQ ID NO. 10;

(6) The primers upstream and downstream of the region 2-4 of the exon of the EKLF gene are respectively as follows: 11 and 12;

(7) The primers upstream and downstream of the region of exon 3 of the EKLF gene are respectively as follows: SEQ ID NO. 13 and SEQ ID NO. 14;

(8) The primers upstream and downstream of the 3' UTR-1 region of the EKLF gene are respectively: 15 and 16;

(9) The primers upstream and downstream of the 3' UTR-2 region of the EKLF gene are respectively: SEQ ID NO. 17 and SEQ ID NO. 18.

2. A detection reaction system for detecting EKLF gene mutation based on a high-resolution melting curve technology, which is characterized by comprising the PCR primer group of 9 groups according to claim 1.

3. The detection reaction system of claim 2, wherein the reaction system further comprises a negative quality control, PCR buffer, dNTPs, DNA polymerase, LC Green, betain, deionized water, and DMSO; the dNTPs mixture includes dATP, dTTP, dGTP and dCTP.

4. The detection reaction system according to claim 3, wherein the DNA polymerase is Taq DNA polymerase of the tripod China organism.

5. The detection reaction system according to claim 3, wherein the Betain concentration is 5M.

6. A detection kit for detecting EKLF gene mutation based on high resolution melting curve technology, characterized in that the kit contains the PCR primer set of 9 sets according to claim 1.

7. The test kit according to claim 6, further comprising the test reaction system according to claim 3.

8. A method for detecting EKLF gene mutations based on high resolution melting curve technology for non-diagnostic and therapeutic purposes, comprising the steps of:

(1) Preparing DNA of a sample to be tested: collecting a peripheral blood specimen of a detected person, and extracting sample DNA by a column method;

(2) High resolution melting curve reaction system:

the 10. Mu.LPCR reaction system comprises 10 XTaq buffer 1.0. Mu.L, 2.5nM dNTPs 0.4. Mu.L, 5U/. Mu.l Taq DNA polymerase 0.2. Mu.L, 10. Mu.M upstream and downstream primer 0.6. Mu.L, 1 XLC Green 1. Mu.L, template DNA 0.8. Mu.L, 5MBetain 2.0. Mu.L, DMSO 1.0. Mu.L, deionized water 3.0. Mu.L; the 10 xTaq buffer is 20mM Mg ²⁺ ；

(3) PCR reaction procedure:

performing on a PCR instrument according to specific circulation conditions, and pre-denaturing for 5 minutes at 95 ℃;95 ℃ for 30 seconds, 63-68 ℃ for 30 seconds, 72 ℃ for 30 seconds, 45 cycles in total; preserving heat at 95 ℃ for 1 minute and 4 ℃;

(4) Detecting fluorescence on a high-resolution melting curve analyzer with the model of LightScanner HR I96 after the PCR amplification is finished, wherein the initial temperature is 55 ℃, the end temperature is 98 ℃ and the standby temperature is 42 ℃; the abscissa is temperature and the ordinate is relative fluorescence intensity.

9. Use of a kit according to claim 6 or 7 for the detection of EKLF gene mutations in samples for non-diagnostic and therapeutic purposes.