CN113621549A

CN113621549A - Application of recombinant bacillus subtilis and method for producing tetrahydropyrimidine by using waste water generated in enzymatic synthesis of nicotinamide mononucleotide

Info

Publication number: CN113621549A
Application number: CN202111022825.XA
Authority: CN
Inventors: 李浪; 岳亮; 赵弘; 方欣; 戴柱; 樊卫; 丁小妹; 廖立新; 宓鹏程; 于铁妹; 潘俊锋; 刘建
Original assignee: Zhuhai Ruidelin Biology Co ltd
Current assignee: Zhuhai Ruidelin Biology Co ltd
Priority date: 2021-09-01
Filing date: 2021-09-01
Publication date: 2021-11-09

Abstract

The invention relates to the technical field of microbial fermentation, and discloses application of recombinant bacillus subtilis and a method for producing tetrahydropyrimidine by utilizing waste water generated in enzymatic synthesis of nicotinamide mononucleotide. The invention constructs a recombinant bacillus subtilis strain by a genetic engineering technology, which can utilize waste water generated by synthesizing nicotinamide mononucleotide by an enzyme method to ferment and obtain fermentation liquor containing tetrahydropyrimidine. The method has the advantages of simple and convenient operation, resource saving, safety, environmental protection, low cost and the like, and is suitable for industrial popularization and application.

Description

Application of recombinant bacillus subtilis and method for producing tetrahydropyrimidine by using waste water generated in enzymatic synthesis of nicotinamide mononucleotide

Technical Field

The invention relates to the technical field of microbial fermentation, in particular to application of recombinant bacillus subtilis and a method for producing tetrahydropyrimidine by utilizing waste water generated in enzymatic synthesis of nicotinamide mononucleotide.

Background

Tetrahydropyrimidine (Ectoine) is a compatible solute generated in cells by many salt-tolerant and halophilic microorganisms to maintain osmotic pressure balance, and can provide protection for cells, proteins, cell membranes, nucleic acids and the like under the stimulation of extreme conditions such as external high temperature, freezing, ray, drying and the like. In addition, the tetrahydropyrimidine has certain curative effect on neurological diseases such as Alzheimer's disease, Parkinson's disease and the like, and recent research finds that the tetrahydropyrimidine can improve the regeneration capability of skin and delay the aging of the skin. Therefore, the tetrahydropyrimidine has wide application prospect in the industries of fine chemical engineering, biological medicine and the like.

At present, the production method of tetrahydropyrimidine is mainly obtained by high-density fermentation of halophilic microorganisms (particularly, halomonas). There are also patents reporting the production of tetrahydropyrimidine by fermentation of transgenic engineering bacteria of Escherichia coli (CN105018403A, CN106754603B, CN112280726A, etc.) and transgenic engineering bacteria of Corynebacterium glutamicum (CN107142234B, CN 110699310A, etc.), and also by fermentation of Bacillus clausii and Halomonas salina.

At present, the existing production strains and the method for producing tetrahydropyrimidine by using the same need high NaCl concentration to stimulate thalli to accumulate more products, the fermentation period is longer, the high-concentration sodium chloride solution seriously corrodes fermentation equipment, and is not suitable for large-scale industrial production, and meanwhile, high-salt fermentation waste liquid causes higher pressure to the environment; the substrate for producing tetrahydropyrimidine by an enzyme catalysis method is sodium aspartate, and the enzyme needs to be induced, expressed and extracted, so the operation is more complex and the production cost is higher. The industrial production and large-scale application of the tetrahydropyrimidine are severely restricted, so that the production cost is reduced, and the method has important practical significance for the application of the tetrahydropyrimidine.

The high-phosphorus high-salt wastewater generated in the prior production of nicotinamide mononucleotide by a fermentation method or an enzyme catalysis method is difficult to treat, so that the production cost of nicotinamide mononucleotide is higher. The bacillus subtilis is not inhibited by the waste water components of nicotinamide mononucleotide by a fermentation method or an enzyme catalysis method, and can generate tetrahydropyrimidine under the coordination of low salinity to medium salinity through mutagenesis or gene recombination, so that the production cost of the tetrahydropyrimidine is greatly reduced, and the problem that the high-phosphorus high-salt waste water of the nicotinamide mononucleotide is difficult to treat is solved. At present, bacillus subtilis is mainly used for industrial production of alpha amylase and neutral protease, and no report related to the application of bacillus subtilis in industrial production of tetrahydropyrimidine is found.

Disclosure of Invention

In view of the above, the present invention aims to provide an application of recombinant bacillus subtilis in the production of tetrahydropyrimidine by using waste water from enzymatic synthesis of nicotinamide mononucleotide, so that tetrahydropyrimidine can be produced by using waste water from enzymatic synthesis of nicotinamide mononucleotide;

another object of the present invention is to provide a method for producing tetrahydropyrimidine using the above recombinant Bacillus subtilis.

In order to achieve the purpose, the invention provides the following technical scheme:

a recombinant Bacillus subtilis capable of expressing EctA, EctB and EctC derived from Bacillus alcalophilus DTY 1. Wherein, the protein sequence of EctA is shown as SEQ ID NO.1, the protein sequence of EctB is shown as SEQ ID NO.2, and the protein sequence of EctC is shown as SEQ ID NO. 3.

The coding genes for expressing the three proteins can be three proteins which are respectively expressed as independent gene elements: the promoter, the EctA/B/C coding gene and the terminator are recombined into bacillus subtilis to be expressed, or can be expressed together in a coding gene mode of a ectoine synthetic gene cluster EctABC, and a gene element consists of the promoter, the EctA coding gene, a spacer sequence, the EctB coding gene, the spacer sequence, the EctC coding sequence and the terminator. Preferably, the promoter is a natural promoter (1-812bp sequence shown in SEQ ID NO. 4) derived from Bacillus alcalophilus DTY1, a P43 promoter or a promoter on a pHY300PLK vector.

In a specific embodiment of the invention, the invention provides an EctABC encoding gene of a tetrahydropyrimidine synthesis gene cluster shown in SEQ ID NO.4 and derived from Bacillus alcalophilus DTY1, the EctBC encoding gene is recombined into Bacillus subtilis engineering bacteria to express related proteins EctA, EctB and EctC, and the EctBC encoding gene of the tetrahydropyrimidine synthesis gene cluster can realize expression or replace a required promoter in a mode of gene integration or chimeric transformation on a vector and the like. The gene cluster coding gene of the tetrahydropyrimidine synthetase shown in SEQ ID NO.4 is different from the sequence used in the conventional method, and the front end of the gene cluster coding gene is provided with a natural promoter sequence (1-812bp) of Bacillus alcalophilus DTY1, so that the expression intensity of tetrahydropyrimidine can be increased along with the increase of salt concentration; 813-1322bp is an EctA coding gene, 1404-2693bp is an EctB coding gene, 2761-3159bp is an EctC coding gene, 1323-1403bp and 2694-2760bp are interval sequences among the coding genes, and 3160-3856bp is a terminator sequence.

The natural promoter has a regulating effect on the expression of the tetrahydropyrimidine synthetase. When the concentration of salt in the wastewater reaches a certain amount, the promoter can start the expression of the tetrahydropyrimidine synthetase, and the EctABC expression is regulated and controlled to increase along with the increase of salinity. In addition, the P43 promoter can be used for replacing the original promoter, and the expression of the tetrahydropyrimidine synthetase can be started without the salt concentration in the wastewater reaching a certain amount; at the same time, a commercial vector such as pHY300PLK carrying EctABC coding gene is transformed into Bacillus subtilis to form recombinant Bacillus subtilis.

In order to further improve the capability of the recombinant bacillus subtilis to produce tetrahydropyrimidine, the recombinant bacillus subtilis also comprises a transmembrane transport protein OpuC which can not express the tetrahydropyrimidine, and the method can be carried out by adopting a method of knocking out an OpuC coding gene completely; in order to avoid the influence on the expression of other genes downstream of the OpuC gene cluster as much as possible and improve the stability of the recombinant engineered bacteria, the invention preferably disrupts the normal expression of the protein by introducing a stop codon in the OpuC encoding gene by the method of GRISPR, in particular by introducing a stop codon (such as TAA) in the middle of each of its individual genes (OpuCA, OpuCB, OpuCC, OpuCD).

Furthermore, the recombinant Bacillus subtilis can not express neutral protease nprE, alkaline protease aprE, amylase amyE and sporulation transcription factor spo0A, and related enzymes or proteins can be realized by knocking out coding genes in whole

The recombinant bacillus subtilis constructed by the invention is applied to the waste water for synthesizing nicotinamide mononucleotide by an enzyme method for fermentation, 8.1-32.7kg of tetrahydropyrimidine and 23.1-26.0kg of bacterial dreg protein feed can be obtained from each ton of waste water, not only can more target product tetrahydropyrimidine be obtained, but also byproduct bacterial dreg protein feed can be obtained, and the COD, BOD, total phosphorus, ammonia nitrogen and the like in the discharged waste water are reduced by 70.4-95.8% compared with those in the original waste water. Based on the above, the invention provides the application of the recombinant bacillus in the production of tetrahydropyrimidine by using the wastewater generated in the enzymatic synthesis of nicotinamide mononucleotide as a raw material.

According to the application, the invention also provides a method for producing tetrahydropyrimidine by utilizing wastewater generated in enzymatic synthesis of nicotinamide mononucleotide, which comprises the following steps:

step 1, providing waste water for synthesizing nicotinamide mononucleotide by an enzymatic method;

step 2, inoculating the recombinant bacillus subtilis into the wastewater for fermentation to obtain a fermentation liquor containing tetrahydropyrimidine intracellularly, and centrifuging or plate-and-frame filter-pressing the fermentation liquor to obtain wet thalli;

step 3, performing membrane filtration after wall breaking of the wet thalli, adsorbing tetrahydropyrimidine by using cation exchange resin, and eluting tetrahydropyrimidine by using ammonia water; or

Stirring and washing the wet thalli by using water, adsorbing tetrahydropyrimidine by using cation exchange resin after centrifugation, and eluting tetrahydropyrimidine by using ammonia water; or

Leaching the wet bacteria with ethanol, recovering ethanol from the leaching liquor, adsorbing tetrahydropyrimidine by using cation exchange resin, and eluting tetrahydropyrimidine by using ammonia water;

and 4, refining the eluted tetrahydropyrimidine to obtain a tetrahydropyrimidine finished product.

Preferably, the wastewater from the enzymatic synthesis of nicotinamide mononucleotide is an enzyme solution from the production of D-ribokinase, nucleic acid phosphopyrophosphokinase and nicotinamide phosphoribosyltransferase by microbial fermentation, and the wastewater from the synthesis process of carnosine from a catalytic carnosine synthesis raw material comprises enzyme fermentation wastewater and enzyme reaction purification wastewater.

In a specific embodiment of the present invention, the fermentation wastewater of the enzyme is obtained by the following method:

carrying out centrifugal separation on fermentation liquor obtained after fermentation of transgenic microbial strains capable of expressing D-ribokinase, nucleic acid phosphopyrophosphoric kinase and nicotinamide phosphoribosyl transferase to obtain a microbial fluid and a supernatant; homogenizing the thallus fluid, breaking thallus, and filtering with membrane to obtain thallus fragments; the supernatant and the thallus fragment liquid are combined to be used as the fermentation wastewater of the enzyme.

In a specific embodiment of the present invention, the enzyme reaction purification wastewater is obtained by:

nicotinamide mononucleotide synthetic raw materials (D-ribose, nicotinamide and ATP) are added into enzyme solutions of D-ribokinase, nucleic acid phosphopyrophosphorykinase and nicotinamide phosphoribosyltransferase for reaction to obtain a nicotinamide mononucleotide crude product solution, the nicotinamide mononucleotide crude product solution is purified by membrane separation, ion exchange column chromatography and crystallization processes in sequence to obtain a pure nicotinamide mononucleotide product, and waste liquid intercepted by membrane separation and ion exchange column chromatography is used as enzyme reaction purification waste water.

Preferably, the fermentation is carried out for 18-36h under the conditions of pH7.0, 32 ℃ and dissolved oxygen control of 20-30%; preferably, the refining comprises the operation steps of activated carbon decolorization, concentration and alcohol precipitation, recrystallization, drying and the like;

preferably, the mushroom dregs after centrifugation or membrane filtration or ethanol extraction in the step 3 can be dried into protein feed.

According to the technical scheme, the recombinant bacillus subtilis is constructed by the genetic engineering technology, and can be fermented by utilizing the waste water generated by synthesizing nicotinamide mononucleotide by an enzyme method to obtain the fermentation liquor containing tetrahydropyrimidine. The method has the advantages of simple and convenient operation, resource saving, safety, environmental protection, low cost and the like, and is suitable for industrial popularization and application.

Drawings

FIG. 1 shows a map of plasmid vector pHT-Cpf 1;

FIG. 2 shows a map of the plasmid vector pHT-opuC-Cpf 1.

Detailed Description

The invention discloses application of recombinant bacillus subtilis and a method for producing tetrahydropyrimidine by utilizing waste water generated in enzymatic synthesis of nicotinamide mononucleotide. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the recombinant Bacillus subtilis and its use and related methods of the present invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the art that the techniques of the present invention can be practiced and used with modification, or with appropriate modification and combination, of the recombinant Bacillus subtilis and its use and related methods herein without departing from the spirit, scope, and spirit of the invention.

In the embodiment of the invention, the collection process of the wastewater from the enzymatic synthesis of nicotinamide mononucleotide is as follows:

the enzyme catalysis process of nicotinamide mononucleotide includes fermenting transgenic colibacillus expressing D-ribokinase, nucleic acid phosphopyrophosphoric kinase and nicotinamide phosphoribosyl transferase in certain culture medium to obtain fermented liquid, centrifuging the fermented liquid to obtain bacteria liquid, homogenizing the bacteria liquid, and membrane filtering to obtain coarse enzyme liquid. Combining the centrifugal supernatant and the membrane filtration thallus fragment liquid as wastewater to be discharged (the characteristic indexes are COD30500mg/L, total phosphorus 2794mg/L and ammonia nitrogen 1379mg/L, BOD17030 mg/L); reacting nicotinamide mononucleotide raw material (D-ribose, nicotinamide and ATP) reaction liquid with crude enzyme liquid, purifying the reaction liquid crude product solution after the reaction is finished through membrane separation, ion exchange column chromatography and crystallization processes to obtain a pure product, intercepting and enriching parts of membrane separation and ion exchange column chromatography respectively by COD, total phosphorus, ammonia nitrogen, BOD and the like in the reaction liquid, and using the intercepted waste liquid as crude enzyme liquid to catalyze nicotinamide mononucleotide reaction purification waste water, wherein the characteristic indexes of the waste liquid are COD16420mg/L, total phosphorus 3450mg/L, ammonia nitrogen 964mg/L, BOD9270 92 9270mg/L and sodium chloride 7%.

The two waste hydrates (the characteristic indexes are COD23460mg/L, total phosphorus 3122mg/L, ammonia nitrogen 1172mg/L, BOD13300mg/L and sodium chloride 3.5%) are inoculated into the recombinant bacillus subtilis through sterilization and fermented for 18-36 hours under the conditions of pH7.0, 32 ℃ and dissolved oxygen control of 20-30%, the specific fermentation conditions can be adjusted according to actual conditions, and the specific fermentation conditions are only described by way of example.

The meanings of the abbreviations used in the present invention are shown in the following Table 1;

TABLE 1

In addition to the above-mentioned sequence information, some other sequence information related to the present invention is as follows:

OpuCA protein sequence: SEQ ID No. 5;

the OpuCA coding sequence: SEQ ID No. 6;

OpuCB protein sequence: SEQ ID No. 7;

the OpuCB coding sequence: SEQ ID No. 8;

OpuCC protein sequence: SEQ ID No. 9;

the OpuCC coding sequence: SEQ ID No. 10;

OpuCD protein sequence: SEQ ID No. 11;

the OpuCD coding sequence: SEQ ID No. 12;

nprE protein sequence: SEQ ID No. 13;

aprE protein sequence: SEQ ID No. 14;

amyE protein sequence: SEQ ID No. 15;

spo0A protein sequence: SEQ ID No. 16;

the invention is further illustrated by the following examples.

Example 1: construction of recombinant Bacillus subtilis

1) Coding sequence for amplifying ectoine synthetic gene cluster ectABC

The method comprises the steps of carrying out PCR amplification by using genome DNA of Bacillus alcalophilus DTY1 as a template and using primers EctABC-P1 and EctABC-P2 designed aiming at an EctABC coding gene of a tetrahydropyrimidine synthetic gene cluster to obtain a PCR amplification product.

EctABC-P1：5′-ATTAGTAAACAAATGACACTAG-3′

EctABC-P2：5′-TTACTACGTTTATTCTTCGC-3′

2) Enzyme digestion and connection

The PCR amplification product was digested with BamHI and SmaI, and ligated to a large fragment of pHY300PLK vector previously digested with BamHI and SmaI to obtain a recombinant plasmid.

3) Transformation, screening and sequence verification

The recombinant plasmid prepared above was transformed into E.coli DH 5. alpha. by Heat Shock (Heat Shock). The positive clone was designated DH5 alpha-pHY 300 PLK-EctABC. And extracting plasmids, and marking positive plasmids as pHY300 PLK-ectABC. The correct sequence was confirmed by gene sequencing.

4) Construction of recombinant expression strains

The recombinant plasmid pHY300PLK-EctABC was transformed into Bacillus subtilis ATCC6051 (or B.subtilis W800N) by electrotransfection (Electroporation) to obtain recombinant BS-pHY300 PLK-EctABC.

5) Cell modification

Genes such as transport protein OpuC, nprE (neutral protease), aprE (alkaline protease), amyE (amylase), spo0A (sporulation transcription factor) and the like of the recombinant BS-pHY300PLK-EctABC are knocked out by using a CRISPR/Cas12a method.

A. The detailed steps are described below by taking an example of introducing a termination code "TAA" to modify OpuCA in the method of griprpr, and the exemplary method should not have a limiting effect on the present invention:

taking Bacillus subtilis ATCC6051a as an example, the OpuCA sequence CDS in the genome is as follows:

>NC_020507.1:c3470982-3469840Bacillus subtilis subsp.subtilis6051-HGW,complete sequence

determination of PAM recognition motif and design of crRNA: three bases (TTG) of the opuCA sequence located at 259-261 were determined as PAM recognition sites, and the crRNA sequence was designed as follows:

Oligo top：5’-TTTCCCCCATATGACCATCCAGCAGAGT-3’

Oligo bottom：5’-TCTGCTGGATGGTCATATGGGGGAAATC-3’

② constructing pAC-crRNA expression vector

The two oligomeric strands were phosphorylated and annealed (simultaneously), and 10. mu.l of the reaction was as follows: 10X T4 DNA ligase buffer 1. mu.l; oligo Top (100. mu.M) 1. mu.l; oligo Bottom (100. mu.M) 1. mu.l; t4 polynuceotide Kinase (10U/. mu.l) 0.5. mu.l; ddH2O 6.5. mu.l. After incubation for 5min at 95 ℃, the temperature is naturally reduced to about 25 ℃ to obtain double-stranded crRNA.

T4 ligase is used for connecting double-stranded crRNA and pAC plasmid subjected to Bpm I enzyme digestion, and colony PCR identification and sequencing identification of E.coli Top10 competent cells and positive clones are subjected to heat shock transformation to obtain a corresponding pAC-crRNA (opuCA) expression vector.

③ design of donor ssDNA:

5 '-T G AGGAGAAAAATCGGCTATGTGATACAGCAGATTGGTTAATTCCCCCATATGACCATCCAGCAGAACATCTCACTCGTACCAAAGC T G-3', donor ssDNA (opuCA) was obtained by Oligo synthesis.

Obtaining a BS-cpe01 recombinant bacterium:

the recombinant plasmid pKD-cas12a-01 heat shock of mannitol-induced promoter PmtLA-induced cas12a expression is transformed into recombinant BS-pHY300PLK-EctABC bacteria, incubation is carried out for 24-36h at 30 ℃, and after colony PCR and sequencing verification, the BS-cas12a-01-pHY300PLK-EctABC recombinant bacteria are obtained and named as BS-cpe 01.

Electrically converting 100ng of pAC-crRNA (opuCA) and 500ng of donor ssDNA into BS-cpe01 under the conditions: the voltage is 2.1V, the capacitance is 25u, the resistance is 200 omega, after electrotransformation, the mixture is immediately coated in an LB agar plate which is preheated at 30 ℃ and contains corresponding antibiotic and mannitol, incubation is carried out for 24-36h at 30 ℃, and the recombinant strain BS-cpe01opuCA is obtained through colony PCR verification.

Sixthly, losing pAC-crRNA (opuCA) and pKD-cas12-01 in the recombinant strain of BS-cpe01opuCA, placing the recombinant monoclonal in 100ul of nonreactive LB, coating the recombinant monoclonal on an LB agar plate containing corresponding antibiotic and cane sugar, incubating for 24-36h at 30 ℃, picking up transformants, simultaneously scribing on nonreactive LB agar plates containing corresponding antibiotic, and obtaining the clone which only grows on the nonreactive plate, namely the positive clonal bacterium which finally removes the crRNA plasmid. The positive clonal bacteria are cultured at 42 ℃ and LB culture conditions of corresponding sucrose to obtain a recombinant colony losing pKD-cas 12-01.

Seventhly, obtaining the delta opuCA terminated expression strain finally by extracting the PCR amplification and sequencing of the genome and the specific primer.

B. The following are detailed steps of the GRISPR method for knocking out a target gene, and this exemplary method should not be construed as limiting the invention:

determination of PAM recognition motif and design of crRNA:

please see the following table for PAM recognition sites in the five knockout gene sequences, the crRNA sequence was designed as follows:

TABLE 2

② constructing pHT-Cpf1 vector plasmid

Plasmid pHT01 was subjected to double digestion with SacI and BamHI restriction enzymes to obtain 6418bp and 1538bp fragments, which were separated by 1% agarose gel electrophoresis, and the 6418bp fragment was recovered by gel cutting. Gene P43-FnCpf1 was synthesized and Gibson was used

Cloning Kit homologous recombination is carried out on pHT01 linear vector to obtain CRISPR-FnCpf1 vector plasmid pHT-Cpf1 (map is shown in figure 1) suitable for Bacillus subtilis ATCC 6051.

Design of donor DNA

According to the sequence and position of different knockout target genes. The upstream 750bp (RHA)), downstream 750bp (LHA) of each gene sequence were selected, along with crRNA, to construct expressible crRNA and RHA, LHA gene fragments. Taking opuC as an example, the design is as follows: Pveg-Direct repeat-opuC-crRNA-rrnB T1 terminator-opuC-RHA-LHA. This sequence comprises the following genetic elements in order: promoter, direct repeat gene, crRNA in target gene, terminator, target gene donor DNA (RHA-LHA).

Fourthly, constructing pHT-opuC-Cpf1 plasmid:

taking the knockout of opuC as an example, the specific implementation steps are as follows: (1) plasmid pHT-Cpf1 was digested with BamHI restriction enzyme to obtain linearized vector fragments. (2) Synthesizing the gene fragment in the third step. (3) Using Gibson

The Cloning Kit carries out homologous recombination on the synthesized Pveg-Direct repeat-opuC-crRNA-rrnB T1terminator-opuC-RHA-LHA to a pHT-Cpf1 linear vector to obtain a plasmid pHT-opuC-Cpf1 for knocking out the opuC of the Bacillus subtilis ATCC6051 gene (the map is shown in figure 2)

Fifthly, the recombinant plasmid pHT-opuC-Cpf1 for expressing FncPf1 and opuC-crRNA-opuC-RHA-LHA is transformed into recombinant BS-pHT01-EctABC through heat shock, incubation is carried out for 24-36h at 30 ℃, and after colony PCR and sequencing verification, the BS-cas12a-01-opuC crRNA-pHT01-EctABC recombinant bacteria which are named as BS-cpe01opuCA recombinant bacteria are obtained.

Sixthly, PCR amplification and sequencing verification of genome extraction and specific primers are carried out, and finally the delta opuCA knockout strain is obtained.

Seventhly, selecting the BS-cpe01opuCA recombinant bacteria losing the pHT-opuC-Cpf1 plasmid. The recombinant monoclonal is inoculated into an anti-LB-free culture solution, and after the culture solution is cultured for 1-2 hours at 37 ℃, the culture solution is diluted in batches (1000-100-10 times). The dilutions were added to 1000ul of non-resistant LB and incubated at 37 ℃ for 24-36 h. The culture broth was streaked on non-anti LB agar plates to obtain a single clone again. Then, single colonies were picked and streaked on LB agar plates which were not resistant and which contained the corresponding antibiotic (ampicillin), and only colonies which grew on the plates without resistance were positive colonies from which the plasmid of pHT-opuC-Cpf1 was finally removed. And (4) preserving the positive clone bacteria, and performing the next knockout experiment.

Other four target knockout genes are constructed according to the same design method, and are not described in detail herein.

Example 2: method for producing tetrahydropyrimidine by wastewater generated in process of synthesizing nicotinamide mononucleotide by enzyme catalysis method

Combining the fermentation wastewater of synthesizing nicotinamide mononucleotide by an enzyme method with the enzyme reaction purification wastewater, inoculating the recombined bacillus subtilis (inoculating the recombined plasmid of ecto-ABC of a tetrahydropyrimidine synthesis gene cluster to generate tetrahydropyrimidine in a thallus cell) through pasteurization, and fermenting for 36h at the pH of 7.0 and the temperature of 32 ℃ under the condition that dissolved oxygen is controlled at 30% to obtain the fermentation liquor containing tetrahydropyrimidine in the cell. And separating the fermentation liquor by a butterfly-disc centrifuge to obtain thallus slurry and fermentation supernatant, stirring and washing the thallus slurry for 10-30 min by pure water, releasing ectoine in thallus, separating by a secondary butterfly-disc centrifuge, adsorbing ectoine by cation exchange resin in the supernatant, eluting the ectoine by ammonia water, decoloring by active carbon, concentrating, precipitating with ethanol, recrystallizing, drying the finished product and the like to obtain the ectoine product. And (4) drying the bacterium residues obtained by filtering the secondary separated bacterium slurry by using a plate-and-frame filter press to obtain the protein feed. 8.5kg of tetrahydropyrimidine white solid and 23.1kg of mushroom dreg protein feed are obtained from each ton of wastewater. COD, BOD, total phosphorus, ammonia nitrogen and sodium chloride in the discharged wastewater are 4246mg/L, 970.9mg/L, 480.8mg/L, 84.4mg/L and 3.14 percent respectively, which are reduced by 81.9 percent, 92.7 percent, 84.6 percent, 92.8 percent and 10.1 percent compared with the original wastewater.

Example 3: method for producing tetrahydropyrimidine by wastewater generated in process of synthesizing nicotinamide mononucleotide by enzyme catalysis method

Combining the fermentation wastewater of synthesizing nicotinamide mononucleotide by an enzyme method with the enzyme reaction purification wastewater, inoculating the recombined bacillus subtilis (inoculated with a P43 promoter and a recombined plasmid of ectoABC of a tetrahydropyrimidine synthesis gene cluster) through pasteurization, and fermenting for 36 hours under the conditions of pH7.0, 32 ℃ and dissolved oxygen control at 30% to obtain the fermentation liquor containing tetrahydropyrimidine in cells. The fermentation liquor is separated by a butterfly-sheet centrifuge to obtain thallus slurry and fermentation supernatant, the thallus slurry is subjected to wall breaking by a homogenizer and then is filtered by a ceramic membrane to remove thallus fragments, most of protein and part of pigment, the membrane filtrate absorbs tetrahydropyrimidine by using cation exchange resin, then the tetrahydropyrimidine is eluted by ammonia water, and then the tetrahydropyrimidine is subjected to the operation steps of activated carbon decoloration, concentration alcohol precipitation, recrystallization, finished product drying and the like to obtain a tetrahydropyrimidine product. And drying the filtered fungus dregs to obtain the protein feed. 8.1kg of tetrahydropyrimidine white solid and 23.8kg of mushroom dreg protein feed are obtained from each ton of wastewater. COD, BOD, total phosphorus, ammonia nitrogen and sodium chloride in the discharged wastewater are 6381mg/L, 1104mg/L, 599.4mg/L, 94.9mg/L and 3.16 percent respectively, which are reduced by 72.8 percent, 91.7 percent, 80.8 percent, 91.9 percent and 9.5 percent compared with the original wastewater.

Example 4: method for producing tetrahydropyrimidine by wastewater generated in process of synthesizing nicotinamide mononucleotide by enzyme catalysis method

Combining the fermentation wastewater of synthesizing nicotinamide mononucleotide by an enzyme method with the enzyme reaction purification wastewater, inoculating the recombined bacillus subtilis (inoculated with a pHY300PLK promoter and a recombined plasmid of ectoABC of a ectoine synthesis gene cluster) through pasteurization, and fermenting for 36h under the conditions of pH7.0, 32 ℃ and dissolved oxygen control at 30% to obtain the fermentation liquor containing ectoine in cells. The fermentation liquor is filtered by a plate-and-frame filter press to remove partial protein and partial pigment in the fermentation liquor, and the obtained thallus filter residue is subjected to countercurrent swelling and leaching for 3 times by using 1:2 ethanol, so that the tetrahydropyrimidine substance in the cells is released to the maximum extent, and the tetrahydropyrimidine substance with high concentration is obtained. Recovering ethanol from the leaching solution under reduced pressure. And (3) adsorbing the tetrahydropyrimidine by using cation exchange resin in the leaching solution after recovering the ethanol, eluting the tetrahydropyrimidine by using ammonia water, and performing the operation steps of decoloring by using active carbon, concentrating and precipitating by alcohol, recrystallizing, drying a finished product and the like to obtain a tetrahydropyrimidine product. And drying the leached fungus residue to obtain the protein feed. 8.3kg of tetrahydropyrimidine white solid and 23.2kg of mushroom dreg protein feed are obtained from each ton of wastewater. COD, BOD, total phosphorus, ammonia nitrogen and sodium chloride in the discharged wastewater are 5888mg/L, 851.2mg/L, 546.4mg/L, 76.2mg/L and 3.13 percent respectively, which are reduced by 76.9 percent, 93.6 percent, 82.5 percent, 93.5 percent and 10.7 percent compared with the original wastewater.

Example 5: method for producing tetrahydropyrimidine by wastewater generated in process of synthesizing nicotinamide mononucleotide by enzyme catalysis method

Combining the fermentation wastewater of synthesizing nicotinamide mononucleotide by an enzyme method with the enzyme reaction purification wastewater, inoculating recombinant bacillus subtilis (inoculating a P43 promoter and a recombinant plasmid of ectoABC of a tetrahydropyrimidine synthesis gene cluster, knocking out a transport protein OpuC) through pasteurization, and fermenting for 36h under the conditions of pH7.0, 32 ℃ and dissolved oxygen control at 30% to obtain fermentation liquor containing tetrahydropyrimidine. Filtering the fermentation liquor by using a plate-and-frame filter press to remove thalli, most of protein and part of pigments in the fermentation liquor, adsorbing tetrahydropyrimidine by using cation exchange resin, eluting the tetrahydropyrimidine by using ammonia water, and performing the operation steps of decoloring by using activated carbon, concentrating and precipitating by alcohol, recrystallizing, drying a finished product and the like to obtain a tetrahydropyrimidine product. And drying the filtered fungus dregs to obtain the protein feed. 9.3kg of tetrahydropyrimidine white solid and 23.7kg of mushroom dreg protein feed are obtained in each ton of wastewater. The COD, BOD, total phosphorus, ammonia nitrogen and sodium chloride in the discharged wastewater are 6545mg/L, 1383mg/L, 852.3mg/L, 100.8mg/L and 3.17 percent respectively, which are reduced by 72.1 percent, 89.6 percent, 76.7 percent, 91.4 percent and 9.3 percent compared with the original wastewater.

Example 6: method for producing tetrahydropyrimidine by wastewater generated in process of synthesizing nicotinamide mononucleotide by enzyme catalysis method

Combining fermentation wastewater of synthesizing nicotinamide mononucleotide by an enzyme method and enzyme reaction purification wastewater, inoculating recombinant bacillus subtilis (inoculating a P43 promoter and a recombinant plasmid of ectoABC of a tetrahydropyrimidine synthesis gene cluster, introducing a termination code TAA into the middle of each single gene OpuCA, OpuCB, OpuCC and OpuCD in an OpuC gene cluster by a GRISPR method so as to destroy the normal expression of protein) through pasteurization, and fermenting for 36h at the pH value of 7.0 and the temperature of 32 ℃ under the condition that dissolved oxygen is controlled at 30% to obtain fermentation liquor containing tetrahydropyrimidine. Filtering the fermentation liquor by using a plate-and-frame filter press to remove thalli, most of protein and part of pigments in the fermentation liquor, adsorbing tetrahydropyrimidine by using cation exchange resin, eluting the tetrahydropyrimidine by using ammonia water, and performing the operation steps of decoloring by using activated carbon, concentrating and precipitating by alcohol, recrystallizing, drying a finished product and the like to obtain a tetrahydropyrimidine product. And drying the filtered fungus dregs to obtain the protein feed. 20.0kg of tetrahydropyrimidine white solid and 23.4kg of mushroom dreg protein feed are obtained from each ton of wastewater. COD, BOD, total phosphorus, ammonia nitrogen and sodium chloride in the discharged wastewater are 6498mg/L, 824.6mg/L, 565.1mg/L, 114.9mg/L and 3.12 percent respectively, which are reduced by 76.3 percent, 93.8 percent, 81.9 percent, 90.2 percent and 10.8 percent compared with the original wastewater.

Example 7: method for producing tetrahydropyrimidine by wastewater generated in process of synthesizing nicotinamide mononucleotide by enzyme catalysis method

Combining fermentation wastewater of synthesizing nicotinamide mononucleotide by an enzyme method and enzyme reaction purification wastewater, inoculating recombinant bacillus subtilis (inoculating a pHY300PLK promoter and a recombinant plasmid of ectoABC of a tetrahydropyrimidine synthesis gene cluster, introducing a termination code TAA into the middle of each single gene OpuCA, OpuCB, OpuCC and OpuCD in the OpuC gene cluster by a GRISPR method so as to destroy the normal expression of protein), fermenting for 36h at pH7.0, 32 ℃ and dissolved oxygen control under 30%, appropriately supplementing a carbon source when the carbon source is insufficient in the fermentation, and fully utilizing all components to obtain fermentation liquor containing more tetrahydropyrimidine. Filtering the fermentation liquor by using a plate-and-frame filter press to remove thalli, most of protein and part of pigments in the fermentation liquor, adsorbing tetrahydropyrimidine by using cation exchange resin, eluting the tetrahydropyrimidine by using ammonia water, and performing the operation steps of decoloring by using activated carbon, concentrating and precipitating by alcohol, recrystallizing, drying a finished product and the like to obtain a tetrahydropyrimidine product. And drying the filtered fungus dregs to obtain the protein feed. 25.1kg of tetrahydropyrimidine white solid and 26.0kg of mushroom dreg protein feed are obtained from each ton of wastewater. The COD, BOD, total phosphorus, ammonia nitrogen and sodium chloride in the discharged wastewater are 6944mg/L, 1263mg/L, 733.7mg/L, 119.5mg/L and 3.16 percent respectively, which are reduced by 70.4 percent, 90.5 percent, 77.5 percent, 89.8 percent and 9.8 percent compared with the original wastewater.

Example 8: method for producing tetrahydropyrimidine by wastewater generated in process of synthesizing nicotinamide mononucleotide by enzyme catalysis method

Combining fermentation wastewater of synthesizing nicotinamide mononucleotide by an enzyme method and enzyme reaction purification wastewater, inoculating recombinant bacillus subtilis (inoculating a P43 promoter and a recombinant plasmid of ectoABC of a tetrahydropyrimidine synthesis gene cluster, introducing a termination code TAA into the middle of each single gene OpuCA, OpuCB, OpuCC and OpuCD in the OpuC gene cluster by a GRISPR method so as to destroy the normal expression of protein, directly knocking out coding genes of nprE, aprE, amyE and spoIIAC), fermenting for 36h at pH7.0 and 32 ℃ under the condition that dissolved oxygen is controlled at 30%, appropriately supplementing a carbon source when the carbon source is insufficient in fermentation, and fully utilizing each component to obtain fermentation liquor containing more tetrahydropyrimidine. Filtering the fermentation liquor by using a plate-and-frame filter press to remove thalli, most of protein and part of pigments in the fermentation liquor, adsorbing tetrahydropyrimidine by using cation exchange resin, eluting the tetrahydropyrimidine by using ammonia water, and performing the operation steps of decoloring by using activated carbon, concentrating and precipitating by alcohol, recrystallizing, drying a finished product and the like to obtain a tetrahydropyrimidine product. And drying the filtered fungus dregs to obtain the protein feed. 32.7kg of tetrahydropyrimidine white solid and 24.8kg of mushroom dreg protein feed are obtained in each ton of wastewater. COD, BOD, total phosphorus, ammonia nitrogen and sodium chloride in the discharged wastewater are 4035mg/L, 944.3mg/L, 540.1mg/L, 49.2mg/L and 3.09 percent respectively, which are reduced by 82.8 percent, 92.9 percent, 82.7 percent, 95.8 percent and 11.7 percent compared with the original wastewater.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Dardlin biological Co Ltd of the Pearl sea

Application of <120> recombinant bacillus subtilis and method for producing tetrahydropyrimidine by using waste water generated in enzymatic synthesis of nicotinamide mononucleotide

<130> S21P001368

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 169

<212> PRT

<213> Bacillus alcalophilus DTY1

<400> 1

Met Thr Leu Ala Pro Thr Lys Gln Thr Glu Ser Ile Leu Phe Thr Gln

1 5 10 15

Pro Thr Lys Gln Asp Gly Ala Asp Met Trp Asn Leu Val Asn Glu Thr

20 25 30

Ser Leu Asp Gln Asn Ser Ala Tyr Lys Tyr Ile Met Met Ser Glu Phe

35 40 45

Phe Ala Asp Thr Cys Ile Val Ala Lys Arg Gly His Glu Leu Val Gly

50 55 60

Phe Val Thr Ala Phe Arg Pro Pro Asn Arg Gln Asp Ala Leu Phe Ile

65 70 75 80

Trp Gln Ile Gly Val Lys Pro Ser Glu Gln Gly Asn Gly Ile Ala Ser

85 90 95

Gln Leu Leu Gln Glu Met Leu Lys Arg Asp His Asn Pro Ala Ile Asn

100 105 110

Tyr Val Glu Ala Thr Ile Thr Pro Ser Asn Gly Ala Ser Gln Ala Leu

115 120 125

Phe Lys Lys Leu Ala Arg Asp Leu Asn Thr Glu Cys Val Ser Glu Arg

130 135 140

Phe Phe Thr Glu Glu Leu Phe Pro Gly Asp Thr His Glu Glu Glu Leu

145 150 155 160

Met Phe Arg Ile Gly Pro Leu Ser Ser

165

<210> 2

<211> 428

<212> PRT

<213> Bacillus alcalophilus DTY1

<400> 2

Met Thr Gln Thr Asp Met Ser Ile Phe Glu Gln Met Glu Ser Glu Val

1 5 10 15

Arg Ser Tyr Cys Arg Ser Phe Pro Thr Val Phe Ser Lys Ala Ile Gly

20 25 30

Ser Lys Met Trp Asp Glu Ala Gly Lys Glu Tyr Ile Asp Phe Phe Ser

35 40 45

Gly Ala Gly Ala Leu Asn Tyr Gly His Asn Asp Pro Ala Met Lys Ala

50 55 60

Lys Leu Val Asp Tyr Ile Leu Ser Asp Gly Met Thr His Ser Leu Asp

65 70 75 80

Met Ala Thr Thr Ala Lys Ala Glu Phe Leu Gln Ser Phe Asn Asp Ile

85 90 95

Ile Leu Lys Pro Arg Asn Leu Asp Tyr Lys Val Met Phe Pro Gly Pro

100 105 110

Thr Gly Thr Asn Thr Val Glu Ser Ala Leu Lys Leu Ala Arg Lys Ser

115 120 125

Thr Gly Arg Thr Asp Ile Ile Ser Phe Thr Asn Gly Phe His Gly Met

130 135 140

Thr Ile Gly Ser Leu Ser Val Thr Gly Asn Ser Phe Lys Arg Lys Gly

145 150 155 160

Ala Gly Ile Pro Leu His Asn Val Val Thr Met Pro Tyr Asp Ser Phe

165 170 175

Val Ser Glu Lys Leu Asp Thr Leu Glu Tyr Leu Glu Arg Phe Leu Glu

180 185 190

Asp Arg Gly Ser Gly Val Ala Ile Pro Ala Ala Met Ile Leu Glu Thr

195 200 205

Val Gln Gly Glu Gly Gly Ile Asn Ala Ala Ser Phe Glu Trp Leu Gln

210 215 220

Arg Ile Glu Arg Thr Cys Lys Arg Trp Gly Ile Leu Leu Ile Val Asp

225 230 235 240

Asp Val Gln Ala Gly Val Gly Arg Thr Arg Thr Phe Phe Ser Phe Glu

245 250 255

Lys Ala Gly Ile Lys Pro Asp Ile Val Cys Ile Ser Lys Ser Ile Gly

260 265 270

Gly Tyr Gly Leu Pro Leu Ala Leu Thr Leu Ile Arg Pro Glu Leu Asp

275 280 285

Ile Trp Ala Pro Gly Glu His Asn Gly Thr Phe Arg Gly Asn Asn His

290 295 300

Ala Phe Val Thr Ala Thr Ala Ala Leu Ala Tyr Trp Glu Asn Pro Thr

305 310 315 320

Phe Glu Lys Ser Ile Ala Asp Lys Ser Lys Lys Ile Lys Ser Phe Leu

325 330 335

Glu Lys Ile Val Glu Asp Tyr Pro Glu Ile Lys Gly Glu Val Arg Gly

340 345 350

Arg Gly Phe Met Ile Gly Ile Ala Ser Glu Val Lys Asp Leu Ser Ala

355 360 365

Gln Val Ala Lys Glu Ala Phe Lys Arg Gly Leu Ile Met Glu Thr Ser

370 375 380

Gly Pro Glu Asp Glu Val Phe Lys Leu Phe Pro Ala Leu Thr Ile Asp

385 390 395 400

Asn Glu Thr Leu Glu Lys Gly Phe Asp Val Ile Glu Glu Ser Val Lys

405 410 415

Ala Val Val Gly Ser Lys Glu Pro Met Thr Val Ser

420 425

<210> 3

<211> 132

<212> PRT

<213> Bacillus alcalophilus DTY1

<400> 3

Met Lys Val Val Ala Leu Lys Asp Val Ile Gly Thr Glu His Asp Val

1 5 10 15

Lys Asn Glu Asp Asn Thr Trp Asn Ser Arg Arg Leu Val Leu Lys Lys

20 25 30

Asp Gly Met Gly Tyr Ser Val His Asp Thr Ile Ile Tyr Ala Gly Thr

35 40 45

Glu Thr His Ile Trp Tyr Gln Asn His Leu Glu Ser Val Tyr Cys Ile

50 55 60

Glu Gly Glu Gly Glu Val Glu Thr Ile Ala Asp Gly Lys Val Trp Pro

65 70 75 80

Ile Lys Lys Asp Glu Ile Tyr Val Leu Asp Lys His Asp Glu His Leu

85 90 95

Leu Arg Ala Lys Thr Asp Met Arg Met Val Cys Val Phe Asn Pro Pro

100 105 110

Ile Thr Gly Asn Glu Val His Asp Glu Asn Gly Val Tyr Pro Val Asp

115 120 125

Thr Ser Glu Glu

130

<210> 4

<211> 3856

<212> DNA

<213> Bacillus alcalophilus DTY1

<400> 4

tagatgtatc ttccatgaaa gggggcagct aaatttatgg ccagcaaaaa aaagacagca 60

ccagacgaaa gaagaacttt acggaaagcg caagaagttc aatatcaatc tgaatttcgc 120

gcagctgaca gagccgcacg ttcgcagtca aaaggagttt aaaacattcc cttcactttt 180

acttgctgtc catcttaaag tcacgttagc ttacaactag agctagacta ctttacacct 240

ttaacaagga ggctgttcac tttgggtaaa aaggaaaaac gcatgcaacc taacaagcaa 300

agtacagaaa ccattgatac cgaaatcgct aatgaatatg ctgatgtatc gaaagagcaa 360

ccaacatcta agaagaaaaa gaagaaaaac cattcataat aggattgcca tgagatatag 420

gtataaagcc tatatctctt ttttatgaat aaaattgttt atattatggt caatttgtca 480

aatcgtcagc ttttatgacc tttgttatac gttccatttc cttaaattag ggcttcttta 540

tgtttcaagc tttcaaaatc atcgctttat ttcaatttgt tagaaaagtt aacgatatgg 600

aaggatatac agctatcgtt gctcttattc ccggtcaccg ttgctaagcc tattagaagc 660

cacttaatcc gcgcataact catttgcacc ttttttcgta tccccttaag ataaatatgt 720

ggtttagaaa aatcactgat gggtatgtaa acaattgtga ataacttttg cccagaaagt 780

ctacaaagga ggaaaaaacc attagtaaac aaatgacact agcacctact aagcaaactg 840

aatccatttt attcacgcaa ccaacgaagc aagatggtgc agacatgtgg aatcttgtca 900

atgaaacatc gctcgatcaa aactctgctt ataagtacat tatgatgtca gaattttttg 960

ccgacacatg tatcgtggct aaacgcggtc atgagctcgt cggatttgtt acagcatttc 1020

gtccacctaa tcgccaagat gccctattta tttggcaaat tggtgtcaaa ccttccgaac 1080

aaggtaatgg gattgcctcg cagcttttac aagaaatgct taagcgtgat cacaatccag 1140

cgattaacta tgtagaagca acgataaccc catctaacgg agcatcgcaa gctctattta 1200

aaaagttagc cagagactta aataccgaat gtgtaagtga acgattcttt acagaagaat 1260

tgtttcctgg cgatacccat gaagaagaac tcatgtttcg aattggtcca ttatcgtctt 1320

aacatagtca acccttgagt ttgcacaaca acttaaatac ctatacagag tataagtata 1380

ttattcggga ggagaacgta aacatgacac aaactgatat gagtattttt gaacaaatgg 1440

aatccgaggt tcgtagttat tgtcgcagct ttccaactgt tttttcaaaa gcgattgggt 1500

caaaaatgtg ggatgaagct gggaaggaat atattgattt cttttcaggt gcaggtgctt 1560

taaattatgg ccataatgat cctgcgatga aagccaagct cgttgattat attttgtcag 1620

atgggatgac gcattcactt gatatggcaa caactgccaa ggcagagttt ttgcaatcat 1680

ttaatgatat tattttaaaa ccacgtaatt tagattataa agtaatgttt ccgggaccaa 1740

ctggaacaaa tacggtggaa agtgccctta aattagctcg aaaatcaaca ggtcgtacag 1800

atatcattag cttcacaaac ggctttcatg gaatgacgat cggatcgctt tctgtaacag 1860

gtaattcatt taaacgaaaa ggagctggaa tcccactcca taatgttgtg acaatgcctt 1920

atgatagctt cgttagtgaa aaactcgaca ctctggagta tctcgaacgt ttcttagaag 1980

atcgcggaag cggggtcgcc atcccggctg ccatgatcct cgagacagtc caaggtgaag 2040

gtggtataaa tgccgcaagc ttcgagtggc tacaacgaat tgagcggact tgtaagcgtt 2100

ggggaatttt attaatcgtt gatgatgttc aagcaggtgt tggccgaact cgtactttct 2160

tcagttttga aaaagctggc attaaaccag atatcgtctg tatttcaaaa tcaatcggtg 2220

gctatggtct tccattagct ttaacactca ttcgtcctga gcttgatatt tgggcgcctg 2280

gtgaacataa tggaacattc cgtggaaaca accatgcgtt cgtaacagca accgctgccc 2340

ttgcttattg ggaaaatcca acatttgaaa aaagcatcgc cgataaatca aagaaaatta 2400

aatcattcct cgaaaaaatc gttgaagatt atccagaaat aaaaggagaa gttcgaggac 2460

gcggatttat gatcggcatc gcttctgaag tgaaggacct ttcggctcaa gttgccaaag 2520

aagcttttaa acgtggctta attatggaaa catctggtcc agaagatgaa gtctttaaat 2580

tatttcctgc attaacgatt gacaacgaaa cacttgaaaa aggattcgat gtaattgaag 2640

aaagtgtaaa agcagttgtt ggctcaaaag aacctatgac cgtttcttaa tcatactaca 2700

ctcttctaca cgcgcatccg ttacaccatt attcacaaac tatttggagg ttttataatc 2760

atgaaagtcg ttgccctaaa agatgttatt ggaacagaac atgacgtaaa aaatgaagat 2820

aatacatgga acagtcgtcg tctcgtcttg aaaaaagacg gcatgggcta ttccgtccat 2880

gatacgatta tttatgctgg tacggaaact catatttggt atcaaaacca tcttgagtcg 2940

gtttattgta tcgaaggtga aggtgaagtc gaaacgattg ccgacggaaa agtatggcca 3000

attaaaaaag acgaaatata tgttttagat aaacatgatg agcatctatt acgtgctaaa 3060

actgatatga gaatggtttg cgtctttaat ccgccaatca ctggaaacga agtccatgat 3120

gaaaatggcg tttatcccgt tgatacaagc gaagaataaa cgtagtaaaa catataaacc 3180

gctatcttct cttttcagaa agagaggata gcggttttat tatacgtgtt tacccgattc 3240

cctgctcata agtcgaaata attgcacccc ataaaaaggg gtgttgcgca tgacgaaaag 3300

gataggcttc ggcgatccgc gatcgctccc aaacagacac tccgcgtcct acggggtcct 3360

tgtgagcccc ctcggcacac ctgtggggtc tcactctacg gacttttccc gtgggagtct 3420

ccgtgtctgt ttgtccgctt agttgtgagt tatacttcat ttctcattcc ttttataata 3480

aaagacatta aaatctccaa ccttttttag tagctgcatt ttacctactg agcgggctca 3540

aaactcaatt acagggattc gatataacta tcagcgagct taaatgttat aagaaacgat 3600

tgtaaggcat tgaggtaaaa caaagtggta cattgttttt agtaaccata gatttgaaca 3660

atcaacaact actttgacaa tgacaagcga atatacgact gttttcatta ttttgaaggg 3720

gactacatta taaaataacg ctcaaactct agcgtacaaa accatacgga gactcccgcg 3780

gaaataaacc gaggagcgag accccacagg gataccgagg aggctcgcca ggtttccgca 3840

ggacgcggag tatggt 3856

<210> 5

<211> 380

<212> PRT

<213> ATCC6051

<400> 5

Met Leu Lys Leu Glu Gln Val Ser Lys Val Tyr Lys Gly Gly Lys Lys

1 5 10 15

Ala Val Asn Ser Ile Asp Leu Asp Ile Ala Lys Gly Glu Phe Ile Cys

20 25 30

Phe Ile Gly Pro Ser Gly Cys Gly Lys Thr Thr Thr Met Lys Met Ile

35 40 45

Asn Arg Leu Ile Glu Pro Ser Ser Gly Arg Ile Phe Ile Asp Gly Glu

50 55 60

Asn Ile Met Glu Gln Asp Pro Val Glu Leu Arg Arg Lys Ile Gly Tyr

65 70 75 80

Val Ile Gln Gln Ile Gly Leu Phe Pro His Met Thr Ile Gln Gln Asn

85 90 95

Ile Ser Leu Val Pro Lys Leu Leu Lys Trp Pro Glu Glu Lys Arg Lys

100 105 110

Glu Arg Ala Arg Glu Leu Leu Lys Leu Val Asp Met Gly Pro Glu Tyr

115 120 125

Leu Asp Arg Tyr Pro His Glu Leu Ser Gly Gly Gln Gln Gln Arg Ile

130 135 140

Gly Val Leu Arg Ala Leu Ala Ala Glu Pro Pro Leu Ile Leu Met Asp

145 150 155 160

Glu Pro Phe Gly Ala Leu Asp Pro Ile Thr Arg Asp Ser Leu Gln Glu

165 170 175

Glu Phe Lys Lys Leu Gln Arg Thr Leu Asn Lys Thr Ile Val Phe Val

180 185 190

Thr His Asp Met Asp Glu Ala Ile Lys Leu Ala Asp Arg Ile Val Ile

195 200 205

Leu Lys Ala Gly Glu Ile Val Gln Val Gly Thr Pro Asp Glu Ile Leu

210 215 220

Arg Asn Pro Ala Asn Glu Phe Val Glu Glu Phe Ile Gly Lys Glu Arg

225 230 235 240

Leu Ile Gln Ser Arg Pro Asp Ile Glu Arg Val Glu Gln Met Met Asn

245 250 255

Arg Thr Pro Val Thr Val Ser Ala Asp Lys Thr Leu Ser Gln Ala Ile

260 265 270

Gln Leu Met Arg Glu Lys Arg Val Asp Ser Leu Leu Val Val Asp Arg

275 280 285

Gln Asn Val Leu Lys Asp Tyr Val Asp Val Glu Met Ile Asp Gln Asn

290 295 300

Arg Lys Lys Ala Ser Ile Val Gly Asp Val Tyr Arg Ser Asp Ile Tyr

305 310 315 320

Thr Val Gln Lys Gly Ala Leu Leu Arg Asp Thr Val Arg Lys Ile Leu

325 330 335

Lys Gln Gly Ile Lys Tyr Val Pro Val Val Asp Glu Gln Asn His Leu

340 345 350

Ala Gly Ile Val Thr Arg Ala Ser Leu Val Asp Ile Val Tyr Asp Ser

355 360 365

Ile Trp Gly Asp Glu Glu Asn Gln Leu Met Thr Ile

370 375 380

<210> 6

<211> 1143

<212> DNA

<213> ATCC6051

<400> 6

ttgctgaaat tggaacaagt gtcaaaagta tataaaggcg gcaaaaaagc tgtgaacagc 60

attgatttag atattgccaa aggtgaattt atctgtttta tcggcccgag cggctgtgga 120

aaaacgacga cgatgaagat gatcaacagg ctgatagaac catcgtctgg aaggatcttt 180

atcgacggag aaaatattat ggaacaggac ccggttgagc tgaggagaaa aatcggctat 240

gtaattcagc agattggttt gttcccccat atgaccatcc agcagaacat ctcactcgta 300

ccaaagctgc tgaaatggcc tgaggaaaaa cggaaagaac gggcgcgcga gctgttaaag 360

cttgtggata tgggcccaga gtatttagac cgttatccgc atgagctcag cggcggacag 420

cagcagagaa tcggcgtgct gcgcgcactg gcagcggaac cccctctcat tttaatggat 480

gaaccgttcg gagcgcttga tccgattacg cgtgattccc ttcaggaaga attcaaaaaa 540

ctgcagagaa ccttaaacaa aacgattgtg tttgtaaccc acgatatgga tgaagcgatt 600

aagcttgctg acaggattgt gatattaaaa gcgggagaaa tcgttcaagt cggcacacct 660

gatgagattc ttcgaaaccc ggcaaatgag tttgttgaag aatttatcgg gaaagagcgc 720

ctgattcagt caagaccgga tatcgagcgg gtagagcaaa tgatgaacag aacgccggtg 780

acggtatctg cggacaaaac gctttctcag gcgattcagc tgatgagaga aaaacgtgtt 840

gactcgctgc tcgttgtgga ccggcaaaac gtgctgaagg actatgttga tgtggaaatg 900

attgatcaaa accgcaaaaa agcgagcatc gttggcgacg tataccgttc agatatatat 960

accgttcaaa aaggggcgct tcttcgcgat acagtccgaa aaattttgaa gcaggggatc 1020

aagtatgttc cggtggtcga tgaacagaac catttagcag ggattgtgac aagagcgagc 1080

ctcgttgata tcgtatacga ttccatttgg ggcgacgagg aaaatcagct catgacgatc 1140

tga 1143

<210> 7

<211> 217

<212> PRT

<213> ATCC6051

<400> 7

Met Asn Gln Met Met Thr Phe Leu Gln Thr Asn Gly Gly Glu Leu Leu

1 5 10 15

Tyr Lys Thr Gly Glu His Leu Tyr Ile Ser Leu Ile Ala Val Val Leu

20 25 30

Gly Ile Ile Val Ala Val Pro Leu Gly Val Ala Leu Thr Arg Met Lys

35 40 45

Lys Gly Ala Gly Ala Val Ile Gly Phe Val Asn Ile Val Gln Thr Leu

50 55 60

Pro Ser Leu Ala Ile Leu Ala Phe Phe Ile Pro Leu Leu Gly Val Gly

65 70 75 80

Lys Val Pro Ala Ile Val Ala Leu Phe Phe Tyr Ser Val Leu Pro Ile

85 90 95

Leu Arg Asn Thr Tyr Thr Gly Ile Lys Gly Val Asn Lys Asn Leu Leu

100 105 110

Glu Ser Gly Lys Gly Ile Gly Met Thr Gly Trp Glu Gln Ile Arg Leu

115 120 125

Val Glu Ile Pro Leu Ala Ile Pro Ile Ile Met Ala Gly Ile Arg Thr

130 135 140

Ser Thr Ile Tyr Leu Ile Gly Trp Ala Thr Leu Ala Ser Phe Ile Gly

145 150 155 160

Gly Gly Gly Leu Gly Asp Tyr Ile Phe Ile Gly Leu Asn Leu Tyr Gln

165 170 175

Pro Glu Tyr Ile Ile Gly Gly Ala Val Pro Val Thr Ile Leu Ala Ile

180 185 190

Ile Ile Asp Tyr Val Leu Ala Val Thr Glu Arg Lys Val Thr Pro Lys

195 200 205

Gly Leu Gln Gly Met Lys Glu Val Ser

210 215

<210> 8

<211> 654

<212> DNA

<213> ATCC6051

<400> 8

atgaatcaaa tgatgacttt tttgcaaacg aacggcggag agctgctgta taaaacagga 60

gagcatttat atatttcact catagccgtt gtattgggca ttatcgttgc agtgccgctt 120

ggcgttgctc tcaccagaat gaaaaaaggc gcaggtgcgg ttatcggttt cgtaaacatt 180

gtgcaaaccc tgccgagtct ggcgatttta gcctttttta ttccgcttct cggcgtagga 240

aaagtgcctg cgattgtcgc tttatttttc tattcggtgc tgccgatcct gcgcaatacg 300

tataccggca ttaaaggtgt aaataaaaac ctgctggaat cggggaaagg gattggcatg 360

accggctggg agcagattcg gctcgttgaa atcccgctgg cgattcccat catcatggcg 420

gggatccgca catcaacgat ctacctaatt ggctgggcga cacttgcgtc gtttatcggg 480

ggaggcggcc tcggggacta tatttttatc ggcctgaacc tataccagcc tgaatatatc 540

attggcggtg ccgtgcctgt cacaattctg gcaattatta ttgattatgt cctggccgtg 600

acagaacgaa aggtgacgcc gaaaggcttg caagggatga aggaagtttc gtaa 654

<210> 9

<211> 305

<212> PRT

<213> ATCC6051

<400> 9

Met Lys Met Thr Lys Ile Lys Trp Leu Gly Ala Phe Ala Leu Val Phe

1 5 10 15

Val Met Leu Leu Gly Gly Cys Ser Leu Pro Gly Leu Gly Gly Ala Ser

20 25 30

Asp Asp Thr Ile Lys Ile Gly Ala Gln Ser Met Thr Glu Ser Glu Ile

35 40 45

Val Ala Asn Met Ile Ala Gln Leu Ile Glu His Asp Thr Asp Leu Asn

50 55 60

Thr Ala Leu Val Lys Asn Leu Gly Ser Asn Tyr Val Gln His Gln Ala

65 70 75 80

Met Leu Gly Gly Asp Ile Asp Ile Ser Ala Thr Arg Tyr Ser Gly Thr

85 90 95

Asp Leu Thr Ser Thr Leu Gly Lys Glu Ala Glu Lys Asp Pro Lys Lys

100 105 110

Ala Leu Asn Ile Val Gln Asn Glu Phe Gln Lys Arg Phe Ser Tyr Lys

115 120 125

Trp Phe Asp Ser Tyr Gly Phe Asp Asn Thr Tyr Ala Phe Thr Val Thr

130 135 140

Lys Lys Phe Ala Glu Lys Glu His Ile Asn Thr Val Ser Asp Leu Lys

145 150 155 160

Lys Asn Ala Ser Gln Tyr Lys Leu Gly Val Asp Asn Ala Trp Leu Lys

165 170 175

Arg Lys Gly Asp Gly Tyr Lys Gly Phe Val Ser Thr Tyr Gly Phe Glu

180 185 190

Phe Gly Thr Thr Tyr Pro Met Gln Ile Gly Leu Val Tyr Asp Ala Val

195 200 205

Lys Asn Gly Lys Met Asp Ala Val Leu Ala Tyr Ser Thr Asp Gly Arg

210 215 220

Ile Lys Ala Tyr Asp Leu Lys Ile Leu Lys Asp Asp Lys Arg Phe Phe

225 230 235 240

Pro Pro Tyr Asp Cys Ser Pro Val Ile Pro Glu Lys Val Leu Lys Ala

245 250 255

His Pro Glu Leu Glu Gly Val Ile Asn Lys Leu Ile Gly Gln Ile Asp

260 265 270

Thr Glu Thr Met Gln Glu Leu Asn Tyr Glu Val Asp Gly Lys Leu Lys

275 280 285

Glu Pro Ser Val Val Ala Lys Glu Phe Leu Glu Lys His His Tyr Phe

290 295 300

Asp

305

<210> 10

<211> 918

<212> DNA

<213> ATCC6051

<400> 10

ttgaaaatga caaaaatcaa atggcttggc gcgtttgctc tcgtctttgt catgctgcta 60

ggcggctgct ctctgccggg tctcggcggc gcttctgacg acacgatcaa aatcggggcg 120

cagagcatga cagaatcaga aattgtagcg aatatgatcg cgcagcttat tgaacacgat 180

acagatttga ataccgcttt agtgaaaaac ctcggctcaa actatgttca gcaccaagcg 240

atgctgggcg gtgacattga tatttcagcc acgcgctatt ccggaacaga tttaacaagc 300

accctcggca aggaagcgga gaaagatccg aaaaaagcgc tgaacattgt gcagaatgag 360

tttcaaaagc gcttttctta taaatggttt gattcctacg gctttgataa cacatatgcc 420

ttcaccgtaa caaaaaaatt tgcggaaaag gagcatatta acaccgtgtc cgacctgaaa 480

aaaaatgcct cccaatataa attaggcgtc gacaatgctt ggctgaaacg aaaaggcgac 540

gggtataaag gctttgtcag cacatatggc tttgaattcg gcacaactta tccaatgcag 600

atcgggcttg tctatgacgc agtcaaaaac gggaaaatgg acgccgttct ggcttattca 660

acggatggac ggattaaagc ctatgacttg aaaatcttaa aagatgataa gcgtttcttt 720

ccgccgtatg actgttcacc ggtgattccg gaaaaggtgc ttaaggcgca tccggagctt 780

gagggtgtga tcaataagct gattgggcaa atcgacacgg aaacgatgca ggaacttaat 840

tatgaagtgg atggcaagct gaaggagccg tctgtcgtag caaaggaatt tttagagaaa 900

catcattatt ttgactaa 918

<210> 11

<211> 224

<212> PRT

<213> ATCC6051

<400> 11

Met Glu Val Leu Gln Gln Leu Gly Thr Tyr Tyr Ser Gln Asn Gly Gly

1 5 10 15

Tyr Val Leu Gln Glu Phe Cys Arg His Phe Leu Met Ser Val Tyr Gly

20 25 30

Val Leu Phe Ala Ala Ile Val Gly Ile Pro Leu Gly Ile Leu Ile Ala

35 40 45

Arg Tyr Arg Arg Leu Ser Gly Trp Val Phe Ala Val Thr Asn Val Ile

50 55 60

Gln Thr Ile Pro Ala Leu Ala Met Leu Ala Val Leu Met Leu Val Met

65 70 75 80

Gly Leu Gly Ala Asn Thr Val Ile Leu Ser Leu Phe Leu Tyr Ser Leu

85 90 95

Leu Pro Ile Ile Arg Asn Thr Tyr Thr Gly Ile Ile Ser Ile Glu His

100 105 110

Ala Tyr Leu Glu Ser Gly Lys Ala Met Gly Met Thr Lys Phe Gln Val

115 120 125

Leu Arg Met Val Glu Leu Pro Leu Ala Leu Ser Val Ile Met Ala Gly

130 135 140

Leu Arg Thr Ala Leu Val Ile Ala Ile Gly Ile Thr Ala Ile Gly Thr

145 150 155 160

Phe Val Gly Ala Gly Gly Leu Gly Asp Ile Ile Val Arg Gly Ser Asn

165 170 175

Ala Thr Asn Gly Thr Ala Ile Ile Leu Ala Gly Ala Ile Pro Thr Ala

180 185 190

Leu Met Ala Val Ile Ala Asp Leu Val Met Gly Trp Leu Glu Arg Ala

195 200 205

Leu Ser Pro Ile Lys Lys Arg Lys Lys Lys Asn Leu Ala Gly Ala Ala

210 215 220

<210> 12

<211> 675

<212> DNA

<213> ATCC6051

<400> 12

atggaagtac tacagcagct tggcacatac tattcgcaaa acggcggtta tgtgctgcag 60

gagttttgcc gccattttct gatgtcggtg tacggcgttt tatttgccgc cattgttgga 120

attccgctcg gcatcctgat agccagatac agaagattaa gcggatgggt ttttgcggtc 180

acgaacgtca ttcagaccat cccggctctc gccatgctcg ccgtgctgat gcttgtcatg 240

gggctgggcg ctaatacggt gatattgtca ttatttctgt attctcttct gccgattatc 300

agaaatacgt atactgggat tatcagtatt gagcacgcct atcttgaatc cggaaaagca 360

atggggatga caaaatttca agtgctgcgg atggtcgagc ttccgcttgc gctttcggtc 420

ataatggccg gcctgcgcac cgcgcttgtc attgccatcg gcattacggc catcgggaca 480

tttgtcggtg ctggcggtct cggggatatc atcgtcaggg gatcaaacgc cacaaacgga 540

accgcaatta tattagcggg agcgatcccc acagctctga tggcggtgat tgccgatttg 600

gtcatgggtt ggcttgaacg agcgttaagc ccgattaaaa agagaaagaa gaaaaacttg 660

gcaggtgccg cataa 675

<210> 13

<211> 521

<212> PRT

<213> ATCC6051

<400> 13

Met Gly Leu Gly Lys Lys Leu Ser Val Ala Val Ala Ala Ser Phe Met

1 5 10 15

Ser Leu Ser Ile Ser Leu Pro Gly Val Gln Ala Ala Glu Gly His Gln

20 25 30

Leu Lys Glu Asn Gln Thr Asn Phe Leu Ser Lys Asn Ala Ile Ala Gln

35 40 45

Ser Glu Leu Ser Ala Pro Asn Asp Lys Ala Val Lys Gln Phe Leu Lys

50 55 60

Lys Asn Ser Asn Ile Phe Lys Gly Asp Pro Ser Lys Arg Leu Lys Leu

65 70 75 80

Val Glu Ser Thr Thr Asp Ala Leu Gly Tyr Lys His Phe Arg Tyr Ala

85 90 95

Pro Val Val Asn Gly Val Pro Ile Lys Asp Ser Gln Val Ile Val His

100 105 110

Val Asp Lys Ser Asp Asn Val Tyr Ala Val Asn Gly Glu Leu His Asn

115 120 125

Gln Ser Ala Ala Lys Thr Asp Asn Ser Gln Lys Val Ser Ser Glu Lys

130 135 140

Ala Leu Ala Leu Ala Phe Lys Ala Ile Gly Lys Ser Pro Asp Ala Val

145 150 155 160

Ser Asn Gly Ala Ala Lys Asn Ser Asn Lys Ala Glu Leu Lys Ala Ile

165 170 175

Glu Thr Lys Asp Gly Ser Tyr Arg Leu Ala Tyr Asp Val Thr Ile Arg

180 185 190

Tyr Val Glu Pro Glu Pro Ala Asn Trp Glu Val Leu Val Asp Ala Glu

195 200 205

Thr Gly Ser Ile Leu Lys Gln Gln Asn Lys Val Glu His Ala Ala Ala

210 215 220

Thr Gly Ser Gly Thr Thr Leu Lys Gly Ala Thr Val Pro Leu Asn Ile

225 230 235 240

Ser Tyr Glu Gly Gly Lys Tyr Val Leu Arg Asp Leu Ser Lys Pro Thr

245 250 255

Gly Thr Gln Ile Ile Thr Tyr Asp Leu Gln Asn Arg Gln Ser Arg Leu

260 265 270

Pro Gly Thr Leu Val Ser Ser Thr Thr Lys Thr Phe Thr Ser Ser Ser

275 280 285

Gln Arg Ala Ala Val Asp Ala His Tyr Asn Leu Gly Lys Val Tyr Asp

290 295 300

Tyr Phe Tyr Ser Asn Phe Lys Arg Asn Ser Tyr Asp Asn Lys Gly Ser

305 310 315 320

Lys Ile Val Ser Ser Val His Tyr Gly Thr Gln Tyr Asn Asn Ala Ala

325 330 335

Trp Thr Gly Asp Gln Met Ile Tyr Gly Asp Gly Asp Gly Ser Phe Phe

340 345 350

Ser Pro Leu Ser Gly Ser Leu Asp Val Thr Ala His Glu Met Thr His

355 360 365

Gly Val Thr Gln Glu Thr Ala Asn Leu Ile Tyr Glu Asn Gln Pro Gly

370 375 380

Ala Leu Asn Glu Ser Phe Ser Asp Val Phe Gly Tyr Phe Asn Asp Thr

385 390 395 400

Glu Asp Trp Asp Ile Gly Glu Asp Ile Thr Val Ser Gln Pro Ala Leu

405 410 415

Arg Ser Leu Ser Asn Pro Thr Lys Tyr Asn Gln Pro Asp Asn Tyr Ala

420 425 430

Asn Tyr Arg Asn Leu Pro Asn Thr Asp Glu Gly Asp Tyr Gly Gly Val

435 440 445

His Thr Asn Ser Gly Ile Pro Asn Lys Ala Ala Tyr Asn Thr Ile Thr

450 455 460

Lys Leu Gly Val Ser Lys Ser Gln Gln Ile Tyr Tyr Arg Ala Leu Thr

465 470 475 480

Thr Tyr Leu Thr Pro Ser Ser Thr Phe Lys Asp Ala Lys Ala Ala Leu

485 490 495

Ile Gln Ser Ala Arg Asp Leu Tyr Gly Ser Thr Asp Ala Ala Lys Val

500 505 510

Glu Ala Ala Trp Asn Ala Val Gly Leu

515 520

<210> 14

<211> 381

<212> PRT

<213> ATCC6051

<400> 14

Met Arg Ser Lys Lys Leu Trp Ile Ser Leu Leu Phe Ala Leu Thr Leu

1 5 10 15

Ile Phe Thr Met Ala Phe Ser Asn Met Ser Ala Gln Ala Ala Gly Lys

20 25 30

Ser Ser Thr Glu Lys Lys Tyr Ile Val Gly Phe Lys Gln Thr Met Ser

35 40 45

Ala Met Ser Ser Ala Lys Lys Lys Asp Val Ile Ser Glu Lys Gly Gly

50 55 60

Lys Val Gln Lys Gln Phe Lys Tyr Val Asn Ala Ala Ala Ala Thr Leu

65 70 75 80

Asp Glu Lys Ala Val Lys Glu Leu Lys Lys Asp Pro Ser Val Ala Tyr

85 90 95

Val Glu Glu Asp His Ile Ala His Glu Tyr Ala Gln Ser Val Pro Tyr

100 105 110

Gly Ile Ser Gln Ile Lys Ala Pro Ala Leu His Ser Gln Gly Tyr Thr

115 120 125

Gly Ser Asn Val Lys Val Ala Val Ile Asp Ser Gly Ile Asp Ser Ser

130 135 140

His Pro Asp Leu Asn Val Arg Gly Gly Ala Ser Phe Val Pro Ser Glu

145 150 155 160

Thr Asn Pro Tyr Gln Asp Gly Ser Ser His Gly Thr His Val Ala Gly

165 170 175

Thr Ile Ala Ala Leu Asn Asn Ser Ile Gly Val Leu Gly Val Ala Pro

180 185 190

Ser Ala Ser Leu Tyr Ala Val Lys Val Leu Asp Ser Thr Gly Ser Gly

195 200 205

Gln Tyr Ser Trp Ile Ile Asn Gly Ile Glu Trp Ala Ile Ser Asn Asn

210 215 220

Met Asp Val Ile Asn Met Ser Leu Gly Gly Pro Thr Gly Ser Thr Ala

225 230 235 240

Leu Lys Thr Val Val Asp Lys Ala Val Ser Ser Gly Ile Val Val Ala

245 250 255

Ala Ala Ala Gly Asn Glu Gly Ser Ser Gly Ser Thr Ser Thr Val Gly

260 265 270

Tyr Pro Ala Lys Tyr Pro Ser Thr Ile Ala Val Gly Ala Val Asn Ser

275 280 285

Ser Asn Gln Arg Ala Ser Phe Ser Ser Ala Gly Ser Glu Leu Asp Val

290 295 300

Met Ala Pro Gly Val Ser Ile Gln Ser Thr Leu Pro Gly Gly Thr Tyr

305 310 315 320

Gly Ala Tyr Asn Gly Thr Ser Met Ala Thr Pro His Val Ala Gly Ala

325 330 335

Ala Ala Leu Ile Leu Ser Lys His Pro Thr Trp Thr Asn Ala Gln Val

340 345 350

Arg Asp Arg Leu Glu Ser Thr Ala Thr Tyr Leu Gly Asn Ser Phe Tyr

355 360 365

Tyr Gly Lys Gly Leu Ile Asn Val Gln Ala Ala Ala Gln

370 375 380

<210> 15

<211> 659

<212> PRT

<213> ATCC6051

<400> 15

Met Phe Ala Lys Arg Phe Lys Thr Ser Leu Leu Pro Leu Phe Ala Gly

1 5 10 15

Phe Leu Leu Leu Phe His Leu Val Leu Ala Gly Pro Ala Ala Ala Ser

20 25 30

Ala Glu Thr Ala Asn Lys Ser Asn Glu Leu Thr Ala Pro Ser Ile Lys

35 40 45

Ser Gly Thr Ile Leu His Ala Trp Asn Trp Ser Phe Asn Thr Leu Lys

50 55 60

His Asn Met Lys Asp Ile His Asp Ala Gly Tyr Thr Ala Ile Gln Thr

65 70 75 80

Ser Pro Ile Asn Gln Val Lys Glu Gly Asn Gln Gly Asp Lys Ser Met

85 90 95

Ser Asn Trp Tyr Trp Leu Tyr Gln Pro Thr Ser Tyr Gln Ile Gly Asn

100 105 110

Arg Tyr Leu Gly Thr Glu Gln Glu Phe Lys Glu Met Cys Ala Ala Ala

115 120 125

Glu Glu Tyr Gly Ile Lys Val Ile Val Asp Ala Val Ile Asn His Thr

130 135 140

Thr Ser Asp Tyr Ala Ala Ile Ser Asn Glu Val Lys Ser Ile Pro Asn

145 150 155 160

Trp Thr His Gly Asn Thr Gln Ile Lys Asn Trp Ser Asp Arg Trp Asp

165 170 175

Val Thr Gln Asn Ser Leu Leu Gly Leu Tyr Asp Trp Asn Thr Gln Asn

180 185 190

Thr Gln Val Gln Ser Tyr Leu Lys Arg Phe Leu Asp Arg Ala Leu Asn

195 200 205

Asp Gly Ala Asp Gly Phe Arg Phe Asp Ala Ala Lys His Ile Glu Leu

210 215 220

Pro Asp Asp Gly Ser Tyr Gly Ser Gln Phe Trp Pro Asn Ile Thr Asn

225 230 235 240

Thr Ser Ala Glu Phe Gln Tyr Gly Glu Ile Leu Gln Asp Ser Ala Ser

245 250 255

Arg Asp Ala Ala Tyr Ala Asn Tyr Met Asp Val Thr Ala Ser Asn Tyr

260 265 270

Gly His Ser Ile Arg Ser Ala Leu Lys Asn Arg Asn Leu Gly Val Ser

275 280 285

Asn Ile Ser His Tyr Ala Ser Asp Val Ser Ala Asp Lys Leu Val Thr

290 295 300

Trp Val Glu Ser His Asp Thr Tyr Ala Asn Asp Asp Glu Glu Ser Thr

305 310 315 320

Trp Met Ser Asp Asp Asp Ile Arg Leu Gly Trp Ala Val Ile Ala Ser

325 330 335

Arg Ser Gly Ser Thr Pro Leu Phe Phe Ser Arg Pro Glu Gly Gly Gly

340 345 350

Asn Gly Val Arg Phe Pro Gly Lys Ser Gln Ile Gly Asp Arg Gly Ser

355 360 365

Ala Leu Phe Glu Asp Gln Ala Ile Thr Ala Val Asn Arg Phe His Asn

370 375 380

Val Met Ala Gly Gln Pro Glu Glu Leu Ser Asn Pro Asn Gly Asn Asn

385 390 395 400

Gln Ile Phe Met Asn Gln Arg Gly Ser His Gly Val Val Leu Ala Asn

405 410 415

Ala Gly Ser Ser Ser Val Ser Ile Asn Thr Ala Thr Lys Leu Pro Asp

420 425 430

Gly Arg Tyr Asp Asn Lys Ala Gly Ala Gly Ser Phe Gln Val Asn Asp

435 440 445

Gly Lys Leu Thr Gly Thr Ile Asn Ala Arg Ser Val Ala Val Leu Tyr

450 455 460

Pro Asp Asp Ile Ala Lys Ala Pro His Val Phe Leu Glu Asn Tyr Lys

465 470 475 480

Thr Gly Val Thr His Ser Phe Asn Asp Gln Leu Thr Ile Thr Leu Arg

485 490 495

Ala Asp Ala Asn Thr Thr Lys Ala Val Tyr Gln Ile Asn Asn Gly Pro

500 505 510

Glu Thr Ala Phe Lys Asp Gly Asp Gln Phe Thr Ile Gly Lys Gly Asp

515 520 525

Pro Phe Gly Lys Thr Tyr Thr Ile Met Leu Lys Gly Thr Asn Ser Asp

530 535 540

Gly Val Thr Arg Thr Glu Lys Tyr Ser Phe Val Lys Arg Asp Pro Ala

545 550 555 560

Ser Ala Lys Thr Ile Gly Tyr Gln Asn Pro Asn His Trp Ser Gln Val

565 570 575

Asn Ala Tyr Ile Tyr Lys His Asp Gly Ser Arg Val Ile Glu Leu Thr

580 585 590

Gly Ser Trp Pro Gly Lys Pro Met Thr Lys Asn Ala Asp Gly Ile Tyr

595 600 605

Thr Leu Thr Leu Pro Ala Asp Thr Asp Thr Thr Asn Ala Lys Val Ile

610 615 620

Phe Asn Asn Gly Ser Ala Gln Val Pro Gly Gln Asn Gln Pro Gly Phe

625 630 635 640

Asp Tyr Val Leu Asn Gly Leu Tyr Asn Asp Ser Gly Leu Ser Gly Ser

645 650 655

Leu Pro His

<210> 16

<211> 267

<212> PRT

<213> ATCC6051

<400> 16

Met Glu Lys Ile Lys Val Cys Val Ala Asp Asp Asn Arg Glu Leu Val

1 5 10 15

Ser Leu Leu Ser Glu Tyr Ile Glu Gly Gln Glu Asp Met Glu Val Ile

20 25 30

Gly Val Ala Tyr Asn Gly Gln Glu Cys Leu Ser Leu Phe Lys Glu Lys

35 40 45

Asp Pro Asp Val Leu Val Leu Asp Ile Ile Met Pro His Leu Asp Gly

50 55 60

Leu Ala Val Leu Glu Arg Leu Arg Glu Ser Asp Leu Lys Lys Gln Pro

65 70 75 80

Asn Val Ile Met Leu Thr Ala Phe Gly Gln Glu Asp Val Thr Lys Lys

85 90 95

Ala Val Asp Leu Gly Ala Ser Tyr Phe Ile Leu Lys Pro Phe Asp Met

100 105 110

Glu Asn Leu Val Gly His Ile Arg Gln Val Ser Gly Asn Ala Ser Ser

115 120 125

Val Thr His Arg Ala Pro Ser Ser Gln Ser Ser Ile Ile Arg Ser Ser

130 135 140

Gln Pro Glu Pro Lys Lys Lys Asn Leu Asp Ala Ser Ile Thr Ser Ile

145 150 155 160

Ile His Glu Ile Gly Val Pro Ala His Ile Lys Gly Tyr Leu Tyr Leu

165 170 175

Arg Glu Ala Ile Ser Met Val Tyr Asn Asp Ile Glu Leu Leu Gly Ser

180 185 190

Ile Thr Lys Val Leu Tyr Pro Asp Ile Ala Lys Lys Phe Asn Thr Thr

195 200 205

Ala Ser Arg Val Glu Arg Ala Ile Arg His Ala Ile Glu Val Ala Trp

210 215 220

Ser Arg Gly Asn Ile Asp Ser Ile Ser Ser Leu Phe Gly Tyr Thr Val

225 230 235 240

Ser Met Thr Lys Ala Lys Pro Thr Asn Ser Glu Phe Ile Ala Met Val

245 250 255

Ala Asp Lys Leu Arg Leu Glu His Lys Ala Ser

260 265

Claims

1. The application of the recombinant Bacillus subtilis in producing tetrahydropyrimidine by using waste water generated in synthesizing nicotinamide mononucleotide by an enzymatic method as a raw material can express EctA, EctB and EctC derived from Bacillus alcalophilus DTY 1.

2. The use according to claim 1, wherein the genes encoding EctA, EctB and EctC are those encoding EctABC of the tetrahydropyrimidine synthesis gene cluster, and consist of a promoter + EctA encoding gene + spacer + EctB encoding gene + spacer + EctC encoding sequence + terminator.

3. The use according to claim 2, wherein the promoter is the P43 promoter, the promoter on the pHY300PLK vector or a native promoter from Bacillus alcalophilus DTY 1.

4. The use according to claim 1, wherein the recombinant Bacillus subtilis is incapable of expressing the ectoine transmembrane transporter OpuC.

5. The use of claim 1 or 4, wherein the recombinant Bacillus subtilis is incapable of expressing the neutral protease nprE, the alkaline protease aprE, the amylase amyE and the sporulation transcription factor spo 0A.

6. Use according to claim 4 or 5, wherein the failure to express is disrupted by knocking out the protein-encoding gene or by introducing a stop codon into the protein-encoding gene by means of GRISPR.

7. A method for producing tetrahydropyrimidine by utilizing wastewater generated in enzymatic synthesis of nicotinamide mononucleotide is characterized by comprising the following steps:

step 2, inoculating the recombinant bacillus subtilis in claim 1 into the wastewater for fermentation to obtain a fermentation liquid containing ectoine, and centrifuging or plate-and-frame filter-pressing the fermentation liquid to obtain wet thalli;

8. The method of claim 7, wherein the wastewater from the enzymatic synthesis of nicotinamide mononucleotide is an enzyme solution from the production of D-ribokinase, phosphoribosyl pyrophosphate kinase, and nicotinamide phosphoribosyltransferase by fermentation of microorganisms, and the wastewater from the synthesis of nicotinamide mononucleotide from nicotinamide mononucleotide as raw material is catalyzed, and comprises an enzyme fermentation wastewater and an enzyme reaction purification wastewater.

9. The method according to claim 8, wherein the fermentation wastewater of the enzyme is obtained by:

10. The method according to claim 8, wherein the enzyme reaction purification wastewater is obtained by:

adding enzyme solution of D-ribokinase, nucleic acid phosphopyrophosphorykinase and nicotinamide phosphoribosyltransferase into a nicotinamide mononucleotide synthetic raw material to react to obtain a nicotinamide mononucleotide crude product solution, purifying by membrane separation, ion exchange column chromatography and crystallization processes in sequence to obtain a nicotinamide mononucleotide pure product, and using waste liquid intercepted by membrane separation and ion exchange column chromatography as enzyme reaction purification waste water.