CN113621025A

CN113621025A - Breast cancer target antigen, CTL cell cultured by breast cancer target antigen stimulation and application thereof

Info

Publication number: CN113621025A
Application number: CN202110909045.0A
Authority: CN
Inventors: 焦顺昌; 张嵘; 王海燕
Original assignee: Beijing Dingcheng Taiyuan Biotechnology Co ltd
Current assignee: Beijing Dingcheng Taiyuan Biotechnology Co ltd
Priority date: 2020-03-18
Filing date: 2020-03-18
Publication date: 2021-11-09
Also published as: CN113621024A; CN113621023A; CN111333698A; CN113388006A; CN113444149A; CN111333698B

Abstract

The invention provides a breast cancer target antigen, a CTL cell cultured by stimulating the breast cancer target antigen and application thereof, belonging to the technical field of tumor treatment. The amino acid sequence of the breast cancer target antigen is shown as SEQ ID No. 17; the breast cancer target antigen is an effective tumor antigen obtained by prediction analysis and screening based on the detection result of the whole exon of the tumor tissue of a patient, and CTL cells obtained by culturing the breast cancer target antigen have a specific killing effect on tumors; the breast cancer target antigen provided by the invention can be applied to the treatment of breast cancer.

Description

Breast cancer target antigen, CTL cell cultured by breast cancer target antigen stimulation and application thereof

The application is a divisional application with the application date of 2020, 03 and 18, the application number of 202010190790.X, and the name of CTL cell cultured by breast cancer target antigen combination and breast cancer target antigen combination stimulation, and the application thereof.

Technical Field

The invention belongs to the technical field of tumor treatment, and particularly relates to a breast cancer target antigen combination, CTL cells cultured by breast cancer target antigen combination stimulation and application thereof.

Background

The female breast is composed of skin, fibrous tissue, breast glands and fat, and breast cancer is a malignant tumor that occurs in the mammary gland epithelial tissue. Breast cancer occurs in 99% of women and only 1% in men.

With the continuous deep understanding of the biological behavior of breast cancer and the transformation and updating of the treatment concept, the treatment of breast cancer enters the comprehensive treatment era, and a treatment mode that the local treatment and the whole-body treatment of breast cancer are combined is formed. Doctors can adopt various means such as surgery, radiotherapy, chemotherapy, endocrine therapy, biological targeted therapy, traditional Chinese medicine adjuvant therapy and the like according to the stage of the tumor and the physical condition of patients.

With the popularization of precise treatment, the individuation and the variability of tumors cannot be met by conventional chemotherapy, radiotherapy and targeting, so that the search for the individualized tumor neoantigen and the culture and identification of CTL (cytotoxic T lymphocyte) of the individualized tumor neoantigen are effective methods for thoroughly eliminating the tumors.

Disclosure of Invention

In view of the above, the present invention aims to provide a breast cancer target antigen combination, a CTL cell cultured by breast cancer target antigen combination stimulation, and applications thereof; the breast cancer target antigen combination provided by the invention is based on the whole exon detection result of the tumor tissue of a patient, effective tumor antigens are obtained through predictive analysis and screening, and CTL cells obtained by culturing the breast cancer target antigen combination have a specific killing effect on tumors; the breast cancer target antigen specificity provided by the invention aims at the breast cancer of the same HLA type, and personalized treatment is realized.

The invention provides a breast cancer target antigen combination, which comprises one or more antigens of which the amino acid sequences are shown as SEQ ID No.1, SEQ ID No.6, SEQ ID No.8, SEQ ID No.9 and SEQ ID No. 17.

The invention provides application of the breast cancer target antigen combination in preparing a medicament for treating breast cancer.

The invention provides application of the breast cancer target antigen combination in preparing CTL cells for treating breast cancer.

The invention provides a CTL cell, which is a CTL cell cultured by the breast cancer target antigen combination stimulation.

The invention provides a preparation method of the CTL cell, which comprises the following steps:

1) adjusting the concentration of CTL cells to 2-3X 10⁵cells/mL；

2) Mixing the CTL cell after adjusting the cell concentration, IL-2 and the breast cancer target antigen combination to obtain a culture system;

3) and culturing the culture system to obtain the CTL cells cultured by breast cancer target antigen combination stimulation.

Preferably, the final concentration of the IL-2 in the culture system is 150-250U/mL.

Preferably, the final concentration of each breast cancer target antigen in the breast cancer target antigen combination in a culture system is 40-60 ng/mL.

Preferably, the temperature of the culture in the step 3) is 36-38 ℃, and the time of the culture is 22-26 h.

Preferably, the CTL cells described in step 1) are obtained by co-culturing PBMC cells and APC cells.

The invention provides application of the CTL cell in preparation of a medicine for treating breast cancer.

The invention has the beneficial effects that: the breast cancer target antigen combination provided by the invention is based on the sequencing result of the whole exon of the tumor tissue of a patient, and has specific killing effect on tumors by using effective tumor antigens obtained by prediction analysis and screening and CTL cells obtained by stimulating and culturing the breast cancer target antigen combination; after culturing the CTL cells, the cell phenotype was analyzed by flow analysis, and the result showed NKT (CD 56)⁺CD3⁺) Ratio of25.7%, CD8⁺The proportion of T cells was 93.7%.

Drawings

FIG. 1 shows the screening results of breast cancer target antigens;

FIG. 2 is a graph showing the comparison of the killing efficiency of CTLs cultured with combination of breast cancer target antigens No.6 and No.8 against target cells loaded with antigen polypeptides and target cells loaded with HLA alone;

FIG. 3 is a graph showing the comparison of the killing efficiency of CTLs cultured by stimulation of breast cancer target antigen combinations Nos. 1, 9 and 17 against target cells loaded with antigen polypeptides and target cells loaded with HLA alone;

FIG. 4 shows the results of CTL flow analysis of breast cancer target antigen combination stimulation cultures for cell phenotype.

Detailed Description

The invention provides a breast cancer target antigen combination, which comprises one or more antigens of which the amino acid sequences are shown as SEQ ID No.1, SEQ ID No.6, SEQ ID No.8, SEQ ID No.9 and SEQ ID No. 17; the details are as follows:

polypeptide numbering	MT Epitope Seq
		1	LLLTKTDI(SEQ ID No.1)
6	YLLLTKTD(SEQ ID No.6)
		8	EITLTWQW(SEQ ID No.8)
9	ITLTWQWD(SEQ ID No.9)
		17	AAVDTVCRHNY(SEQ ID No.17)

In the present invention, the breast cancer target antigen combination is preferably an effective tumor antigen obtained by sequencing the whole exon of the tumor tissue of a patient, analyzing the sequencing result and screening. The exon sequencing method is not particularly limited in the invention, and a conventional exon sequencing method in the field can be adopted. According to the invention, after the exon sequencing result is obtained, the exon sequencing result is preferably analyzed by adopting a tumor neoantigen analysis technology, in the invention, the analysis is preferably carried out by adopting Immunoming tumor individualized neoantigen analysis prediction software, and the copyright of the software has the registration number of 2019SR 0130720.

The invention provides application of the breast cancer target antigen combination in preparing a medicament for treating breast cancer. In the invention, the breast cancer target antigen combination realizes the treatment of breast cancer by stimulating and culturing CTL cells.

The invention also provides application of the breast cancer target antigen combination in preparing CTL cells for treating breast cancer. In the invention, the breast cancer target antigen combination is utilized to stimulate and culture CTL cells, so that the obtained CTL cells have specific killing effect on the cells loaded with the breast cancer target antigen combination.

The invention also provides a preparation method of the CTL cell, which comprises the following steps: 1) adjusting the concentration of CTL cells to 2-3X 10⁵cells/mL; 2) mixing the CTL cell after adjusting the cell concentration, IL-2 and the breast cancer target antigen combination to obtain a culture system; 3) and culturing the culture system to obtain the CTL cells cultured by breast cancer target antigen combination stimulation.

In the present invention, the CTL cells are preferably obtained by co-culturing PBMC cells with APC cells. In the present invention, the culturing step of the APC cell is preferably as follows: after the PBMC cells are subjected to resuscitation culture, the PBMC cells are obtained by resuspension culture of a breast cancer target antigen solution. In the present invention, the culture medium for the resuscitation culture is preferably 1640+ 10% (v/v) FBS; the recovery culture time is preferably 22-26 h, and more preferably 24 h; the temperature of the recovery culture is preferably 37 ℃, and the environmental carbon dioxide concentration of the recovery culture is preferably 5%; the concentration of PBMC cells before resuscitation culture is preferably 1 × 10⁶cells/mL; the concentration of PBMC cells before the resuscitation culture is preferably adjusted by dilution with resuscitation medium. According to the invention, after the recovery culture, cells are preferably collected by centrifugation, the rotation speed of the centrifugation is preferably 1400-1600 rpm, more preferably 1500rpm, and the time of the centrifugation is preferably 4-6 min, more preferably 5 min.

In the present invention, the breast cancer target antigen solution preferably includes the following components: 1640+ 10% FBS + 150-250U/mL IL-2+ 1500-1700U/mL GM-CSF + 40-60 ng/mL breast cancer target antigen (concentration of each breast cancer target antigen), more preferably 1640+ 10% FBS +200U/mL IL-2+1600U/mL GM-CSF +50ng/mL breast cancer target antigen. In the invention, the IL-2 is a cell growth factor, which can enable T cells to survive for a long time and stimulate the T cells to enter a human cell division cycle; the GM-CSF stimulates the colony formation of neutrophils and macrophages in vitro; the source of the IL-2 and GM-CSF in the present invention is not particularly limited, and IL-2 and GM-CSF conventionally used in the art may be used.

In the invention, the breast cancer target antigen solution is used for resuspending and culturing the cells centrifugally collected. In the present invention, the cell density after resuspension is preferably 1X 10⁶cells/mL, wherein the time for heavy suspension culture is preferably 22-26 h, and more preferably 24 h; the temperature of the resuspension culture is preferably 37 ℃, and the ambient carbon dioxide concentration of the resuscitation culture is preferably 5%. The present invention obtains APC cells after the resuspension culture.

In the present invention, CTL cells are obtained by co-culturing the APC cells and PBMC cells obtained by the above-mentioned culture. In the invention, the number ratio of the APC cells to the PBMC cells is preferably 1 (90-110), and more preferably 1: 100. In the present invention, the co-cultivation time is preferably 20 to 22 days, and more preferably 21 days. In the invention, after the co-culture is carried out for 48 hours, the IL-2 is added into the co-culture system every day, so that the final concentration of the IL-2 is 400-600U/mL, and more preferably 500U/mL.

After the CTL cells are obtained, the concentration of the CTL cells is adjusted to 2-3 multiplied by 10⁵cells/mL, more preferably 2.5X 10⁵cells/mL。

In the invention, the CTL cells after adjusting the cell concentration, IL-2 and the breast cancer target antigen are combined to obtain a culture system. In the invention, the final concentration of the IL-2 in the culture system is preferably 150-250U/mL, and more preferably 200U/mL; the final concentration of each breast cancer target antigen in the breast cancer target antigen combination in a culture system is preferably 40-60 ng/mL, and more preferably 50 ng/mL.

In the invention, the culture system is cultured to obtain breast cancer target antigen combination stimulating cultured CTL cells. In the invention, the temperature of the culture is preferably 36-38 ℃, more preferably 37 ℃, and the time of the culture is preferably 22-26 h, more preferably 24 h. After the culturing, the breast cancer target antigen combination is preferably collected to stimulate cultured CTL cells; the collection is preferably performed by a centrifugation method, the rotation speed of the centrifugation is preferably 1000-1500 rpm, and the time of the centrifugation is preferably 5-10 min.

The invention provides application of the CTL cell in preparation of a medicine for treating breast cancer. In the invention, the CTL cell can kill tumor cells specifically, and the lethality of the CTL cell to the tumor cells loaded with the breast cancer target antigen combination is far greater than that of the tumor cells not loaded with the breast cancer target antigen. The dosage form of the medicament is not particularly limited, and the cell medicament dosage form which is conventional in the field can be adopted.

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

The sequencing result of the whole exon of the tumor tissue adopts Immunoming tumor individualized new antigen analysis prediction software to analyze the tumor new antigen, and the copyright of the software has the registration number of 2019SR 0130720. Obtaining 17 prediction antigens by ancient cooking vessel peptide source biological information technology limited company; the predicted 17 antigens were synthesized (synthesized by Nanjing Kinsley polypeptide Synthesis part).

TABLE 1 polypeptide sequences and corresponding numbering

Polypeptide numbering	MT Epitope Seq
		1	LLLTKTDI(SEQ ID No.1)
2	TKTDIENLT(SEQ ID No.2)
		3	LLTKTDIEN(SEQ ID No.3)
4	LTKTDIENL(SEQ ID No.4)
		5	TDIENLTIS(SEQ ID No.5)
6	YLLLTKTD(SEQ ID No.6)
		7	WDGEDQTQD(SEQ ID No.7)
8	EITLTWQW(SEQ ID No.8)
		9	ITLTWQWD(SEQ ID No.9)
10	WQWDGEDQT(SEQ ID No.10)
		11	QWDGEDQTQ(SEQ ID No.11)
12	TVCRHNYE(SEQ ID No.12)
		13	ERAAVDTVC(SEQ ID No.13)
14	TVCRHNYEA(SEQ ID No.14)
		15	EQERAAVDT(SEQ ID No.15)
16	VDTVCRHNY(SEQ ID No.16)
		17	AAVDTVCRHNY(SEQ ID No.17)

1. Co-culture for APC preparation:

1) resuscitating cryopreserved PBMC (2.5X 10)⁷cells) toThe frozen stock solution was diluted with 1640+ 10% FBS, centrifuged at 1500rpm for 5min, resuspended in 10mL of 1640+ 10% FBS, and resuspended at 1X 10⁶cells/mL，37℃、5％CO₂Resuscitating and culturing for 24 h;

2) respectively preparing antigen polypeptide solutions, namely 1640+ 10% FBS +200U/mL IL-2+1600U/mL GM-CSF, wherein the final concentration of each antigen polypeptide is 50ng/mL, and uniformly mixing for later use;

3) centrifuging at 1500rpm for 5min, collecting cells, resuspending the cells with polypeptide solution, and adjusting the density to 1 × 10⁶cells/mL；

4)37℃、5％CO₂After 24h of culture, the cells are APC, and the cells are lightly blown and uniformly mixed for later use.

2. Co-cultivation

1) PBMC were collected by centrifugation, resuspended in 1640+ 10% FBS, and count adjusted to 1X 10⁶cells/mL；

2) According to PBMC: adding APC in the proportion of 100:1, and mixing uniformly, and recording as Day 0;

3)37℃、5％CO₂after culturing for 48h, supplementing IL-2 according to the total volume every day, and ensuring that the final concentration of IL-2 is 200U/mL;

4) when the cells are cultured to Day21, collecting the cells as CTL;

3. screening of tumor neoantigens:

1) CTL cells obtained by the above culture were collected, resuspended in 1640+ 10% FBS, and the count was adjusted to 2X 10⁶cells/mL；

2)10mL CTL cells +10mL 1640+ 10% FBS cells were adjusted to 1X 10⁶cells/mL, then adding 8 μ L of 500U/μ L IL-2, the final concentration of IL-2 is 200U/mL, and then dividing into 96-well plates (flat bottom) with 200 μ L/well;

5) adding different antigens, namely the antigens No. 1-17, into each hole, wherein the volume is 5 mu L, and the concentration is 2 mu g/mL of polypeptide; setting positive control OKT3167ng/mL, medium control and CTL;

6)37℃5％CO₂after 24h of culture, centrifugation is carried out at 1500rpm for 10min, and 170 mu L of supernatant is transferred to a new 96-well plate;

7) in order to avoid sucking cells, the new 96-well plate in the step 6) is centrifuged at 1500rpm for 10min, and 110 μ L of supernatant is transferred to the new 96-well plate;

8) and (3) detecting the release amount of IFN-gamma in the cell supernatant by using an R & D ELISA kit so as to screen the antigen.

The screening results are shown in figure 1, the IFN-gamma releases water levels exceeding those of the control, and is considered to be effective new antigen, wherein the polypeptides No.1, No.6, No.8, No.9 and No.17 are effective new breast cancer specific antigen obtained by screening.

4. Construction of target cells

1) HLA-A2402 gene synthesis (consignment of Jinweizhi biotechnology, Inc.) is carried out by artificial synthesis method, and the synthesized gene is constructed between Nhe I and BamH I enzyme cutting sites on pCDH expression vector.

HLA-A2402(SEQIDNo.18)：

atggccgtcatggcgccccgaaccctcgtcctgctactctcgggggccctggccctgacccagacctgggcaggctcccactccatgaggtatttctccacatccgtgtcccggcccggccgcggggagccccgcttcatcgccgtgggctacgtggacgacacgcagttcgtgcggttcgacagcgacgccgcgagccagaggatggagccgcgggcgccgtggatagagcaggaggggccggagtattgggacgaggagacagggaaagtgaaggcccactcacagactgaccgagagaacctgcggatcgcgctccgctactacaaccagagcgaggccggttctcacaccctccagatgatgtttggctgcgacgtggggtcggacgggcgcttcctccgcgggtaccaccagtacgcctacgacggcaaggattacatcgccctgaaagaggacctgcgctcttggaccgcggcggacatggcggctcagatcaccaagcgcaagtgggaggcggcccatgtggcggagcagcagagagcctacctggagggcacgtgcgtggacgggctccgcagatacctggagaacgggaaggagacgctgcagcgcacggacccccccaagacacatatgacccaccaccccatctctgaccatgaggccactctgagatgctgggccctgggcttctaccctgcggagatcacactgacctggcagcgggatggggaggaccagacccaggacacggagcttgtggagaccaggcctgcaggggatggaaccttccagaagtgggcagctgtggtggtaccttctggagaggagcagagatacacctgccatgtgcagcatgagggtctgcccaagcccctcaccctgagatgggagccatcttcccagcccaccgtccccatcgtgggcatcattgctggcctggttctccttggagctgtgatcactggagctgtggtcgctgctgtgatgtggaggaggaacagctcagatagaaaaggagggagctactctcaggctgcaagcagtgacagtgcccagggctctgatgtgtctctcacagcttgtaaagtgtga。

Transforming the obtained recombinant plasmid into competent cells, selecting a monoclonal antibody for sequencing, selecting the clone with the correct sequencing result, and carrying out subsequent experiments;

2) the plasmid extraction was carried out with Tiangen plasmid extraction kit (purchased from Tiangen Biochemical technology, Beijing) Ltd.) according to the manufacturer's instructions.

3) And (3) slow virus packaging: recovering 293T cells, and packaging the cells for lentiviruses after two generations; cell transfection: (T175 flask) cell density 2X 10⁷One/bottle; a15 mL centrifuge tube (labeled A) was taken, and packaged plasmids 4K (17. mu.g), 6K (34. mu.g) and the desired plasmid (51. mu.g) were added to a Buffer containing 1mL jetPRIME, and gently mixed. Slowly dripping jetPRIME (marked as B) into the centrifuge tube A, adding while shaking the centrifuge tube A at a constant speed to obtain solution C, and standing for 10 min; old medium in T175 was decanted, 18ml of DMDMMEM (without antibiotics and serum) was added to C, added to a T175 flask, and placed at 37 ℃ in 5% CO₂Culturing in an incubator. After 4-6 h of transfection, the medium containing the transfection complex was aspirated off and replaced with fresh medium preheated at 37 ℃. Cultured for 48h and 72h and collected.

4) Lentivirus transfection of 3T3 cells: DMEM was used to prepare whole cell culture medium containing 7% FBS, designated DMEM. DMEM was used to adjust the 3T3 cell concentration to 5X 10⁵Perml, add 6 well plates, 1mL per well, incubate at 37 ℃ overnight. DMEM medium in 6-well plates was discarded, and 1ml of virus-V-P mixture was added to each well. Transferring the culture medium into a T75 culture bottle after 3 days of culture, and adding puromycin for screening; after screening for 6 days, 3T3 cells which stably express HLA-A2402 are obtained and are marked as 3T 3-HLA;

5. killing experiment-LDH method

1) Collecting target cells 3T3 and 3T3-HLA, and centrifuging at 1000rpm for 5 min;

2) washing with PBS, and centrifuging at 1000rpm for 5 min;

3) adding antigen solution, and taking the No.1, No.9 and No.17 antigens as a group; the No.6 and the No.8 are a group, the concentration of each antigen in each group is 50ng/mL, the volume is 3mL, the effective new antigen combination is loaded, and the loading is carried out for 4 hours at 37 ℃;

4) centrifuging at 1000rpm for 5min, removing excess solution, and washing with PBS for 2 times;

5) after resuspension in 1640+ 2% FBS, the counts were adjusted to 8X 10⁴cells/mL, divided into 96-well plates (U-shaped bottom), 50 μ L/well for use;

6) collecting CTL cells, and centrifuging at 1000rpm for 5 min;

7) washing with PBS, and centrifuging at 1000rpm for 5 min;

8) after counting the resuspended cells in 1640+ 2% FBS, they were dispensed into 96-well plates (U-bottom), 50 μ L/well, and the effective target ratio (CTL: 3T3-HLA or CTL: 3T 3-HLA-loaded polypeptide) is 40:1, 20:1, 10:1, 5:1, 2.5:1 and 1.25: 1; 5% CO at 37 ℃₂After the incubation for 20h, performing LDH detection, wherein the kit for LDH detection is cytotoxin LDH Assay

The manufacturer: dojindo has a product number CK 12.

As shown in FIGS. 2 and 3, the antigen-stimulated cultured CTLs showed higher killing efficiency against target cells loaded with antigenic polypeptides than target cells loaded with HLA alone, indicating that the cultured CTLs recognize the antigen and have specific killing effect, and thus can be used as the first choice antigens for breast cancer therapy.

6. Flow-type typing

1) Collecting CTL, centrifuging at 1000rpm for 5 min;

2)1×10⁶cells/tube, adding CD3, CD4, CD8 and CD56 antibody, and keeping away from light for 30min at room temperature;

3) washing twice with PBS, and centrifuging at 1000rpm for 5 min;

4) and (5) resuspending by PBS and detecting on a machine.

The screened potent neoantigens were cultured and analyzed for cell phenotype by flow cytometry, and the results are shown in FIG. 4, NKT (CD 56)⁺CD3⁺) The ratio was 25.7%, 93.7% in T cells was CD8⁺A T cell; NK can generate nonspecific killing, the low NK proportion indicates that the nonspecific killing is small, and the specific killing effect is obvious.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Beijing ancient cooking peptide source Biotechnology Ltd

<120> breast cancer target antigen, CTL cell cultured by breast cancer target antigen stimulation and application thereof

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 8

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Leu Leu Leu Thr Lys Thr Asp Ile

1 5

<210> 2

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Thr Lys Thr Asp Ile Glu Asn Leu Thr

1 5

<210> 3

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Leu Leu Thr Lys Thr Asp Ile Glu Asn

1 5

<210> 4

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Leu Thr Lys Thr Asp Ile Glu Asn Leu

1 5

<210> 5

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Thr Asp Ile Glu Asn Leu Thr Ile Ser

1 5

<210> 6

<211> 8

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Tyr Leu Leu Leu Thr Lys Thr Asp

1 5

<210> 7

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Trp Asp Gly Glu Asp Gln Thr Gln Asp

1 5

<210> 8

<211> 8

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Glu Ile Thr Leu Thr Trp Gln Trp

1 5

<210> 9

<211> 8

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 9

Ile Thr Leu Thr Trp Gln Trp Asp

1 5

<210> 10

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 10

Trp Gln Trp Asp Gly Glu Asp Gln Thr

1 5

<210> 11

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 11

Gln Trp Asp Gly Glu Asp Gln Thr Gln

1 5

<210> 12

<211> 8

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 12

Thr Val Cys Arg His Asn Tyr Glu

1 5

<210> 13

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 13

Glu Arg Ala Ala Val Asp Thr Val Cys

1 5

<210> 14

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 14

Thr Val Cys Arg His Asn Tyr Glu Ala

1 5

<210> 15

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 15

Glu Gln Glu Arg Ala Ala Val Asp Thr

1 5

<210> 16

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 16

Val Asp Thr Val Cys Arg His Asn Tyr

1 5

<210> 17

<211> 11

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 17

Ala Ala Val Asp Thr Val Cys Arg His Asn Tyr

1 5 10

<210> 18

<211> 1098

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

atggccgtca tggcgccccg aaccctcgtc ctgctactct cgggggccct ggccctgacc 60

cagacctggg caggctccca ctccatgagg tatttctcca catccgtgtc ccggcccggc 120

cgcggggagc cccgcttcat cgccgtgggc tacgtggacg acacgcagtt cgtgcggttc 180

gacagcgacg ccgcgagcca gaggatggag ccgcgggcgc cgtggataga gcaggagggg 240

ccggagtatt gggacgagga gacagggaaa gtgaaggccc actcacagac tgaccgagag 300

aacctgcgga tcgcgctccg ctactacaac cagagcgagg ccggttctca caccctccag 360

atgatgtttg gctgcgacgt ggggtcggac gggcgcttcc tccgcgggta ccaccagtac 420

gcctacgacg gcaaggatta catcgccctg aaagaggacc tgcgctcttg gaccgcggcg 480

gacatggcgg ctcagatcac caagcgcaag tgggaggcgg cccatgtggc ggagcagcag 540

agagcctacc tggagggcac gtgcgtggac gggctccgca gatacctgga gaacgggaag 600

gagacgctgc agcgcacgga cccccccaag acacatatga cccaccaccc catctctgac 660

catgaggcca ctctgagatg ctgggccctg ggcttctacc ctgcggagat cacactgacc 720

tggcagcggg atggggagga ccagacccag gacacggagc ttgtggagac caggcctgca 780

ggggatggaa ccttccagaa gtgggcagct gtggtggtac cttctggaga ggagcagaga 840

tacacctgcc atgtgcagca tgagggtctg cccaagcccc tcaccctgag atgggagcca 900

tcttcccagc ccaccgtccc catcgtgggc atcattgctg gcctggttct ccttggagct 960

gtgatcactg gagctgtggt cgctgctgtg atgtggagga ggaacagctc agatagaaaa 1020

ggagggagct actctcaggc tgcaagcagt gacagtgccc agggctctga tgtgtctctc 1080

acagcttgta aagtgtga 1098

Claims

1. A breast cancer target antigen is characterized in that the amino acid sequence of the breast cancer target antigen is shown as SEQ ID No. 17.

2. Use of the breast cancer target antigen of claim 1 in the preparation of a medicament for the treatment of breast cancer.

3. Use of the breast cancer target antigen of claim 1 for preparing breast cancer CTL cells.

4. A CTL cell, wherein the CTL cell is a CTL cell cultured in the presence of the breast cancer target antigen of claim 1.

5. The method for producing CTL cells according to claim 4, comprising the steps of:

1) adjusting the concentration of CTL cells to 2-3X 10⁵cells/mL；

2) Mixing the CTL cells after adjusting the cell concentration, IL-2 and the breast cancer target antigen described in claim 1 to obtain a culture system;

3) and culturing the culture system to obtain the CTL cells cultured by the breast cancer target antigen stimulation.

6. The method according to claim 5, wherein the final concentration of IL-2 in the culture system is 150 to 250U/mL.

7. The method according to claim 5 or 6, wherein the final concentration of the breast cancer target antigen in the culture system is 40-60 ng/mL.

8. The method according to claim 5, wherein the temperature of the culture in step 3) is 36 to 38 ℃ and the time of the culture is 22 to 26 hours.

9. The method according to claim 5, wherein the CTL cells in step 1) are obtained by co-culturing the PBMC cells and the APC cells.

10. Use of the CTL cell according to claim 4 or the CTL cell obtained by the method according to any one of claims 5 to 9 for the preparation of a medicament for treating breast cancer.