CN101962405A - Humanized breast cancer antigen and antibody thereof - Google Patents
Humanized breast cancer antigen and antibody thereof Download PDFInfo
- Publication number
- CN101962405A CN101962405A CN2010102974185A CN201010297418A CN101962405A CN 101962405 A CN101962405 A CN 101962405A CN 2010102974185 A CN2010102974185 A CN 2010102974185A CN 201010297418 A CN201010297418 A CN 201010297418A CN 101962405 A CN101962405 A CN 101962405A
- Authority
- CN
- China
- Prior art keywords
- antibody
- breast cancer
- antigen
- cancer antigen
- people
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a humanized breast cancer antigen and an antibody thereof. The amino acid residue sequence of the antigen is shown in a sequence list 1. The antigen is a natural antigen or a recombinant protein antigen, which is mainly expressed in cancer cells of the human breast cancer, but is not expressed in human normal cells; and the antigen can be used as a target point of human breast cancer active immunotherapy or prevention and as a target point of various targeted immunological therapies. The invention also provides an antibody resistant to the humanized breast cancer antigen. The antibody is a polyclonal antibody, a mouse monoclonal antibody or antibody segment, and derivates of the antibodies, wherein the derivates comprise the antibody crosslinked with nuclide, the antibody crosslinked with chemical medicaments, the antibody crosslinked with liposome, the antibody fused with a medicament preemzyme, the antibody fused with other effector molecules and the like. The invention also provides application of the antibody and derivates resistant to the humanized breast cancer antigen Hv1 in the preparation of medicaments for diagnosing, treating and preventing human breast cancer.
Description
[technical field]
The present invention relates to a kind of new valtage-gated proton channel Hv1 of people source breast cancer antigen and antibody thereof.Hv1 does not express in normal galactophore tissue, great expression in breast cancer tissue.The invention provides the corresponding polyclone/monoclonal antibody of this people source breast cancer antigen Hv1, antibody fragment and derivative etc., can in diagnosis, prevention and the treatment of mammary cancer, be widely used.
[background technology]
Mammary cancer is one of a kind of women's of having a strong impact on physical and mental health even life-threatening modal malignant tumour.According to statistics, in the women, the sickness rate of mammary cancer is only second to uterus carcinoma, accounts for the 7-10% of the various malignant tumours of whole body.Between 40-60 year, the women's sickness rate before and after climacteric is higher.Only the mammary gland patient of about 1-2% is the male sex.
Mammary cancer be the breast glandular epithelium under multiple carcinogen effect, transgenation has taken place, cause hyperplasia out of control.Because change has taken place in the biological behavior of cancer cells, and causes cell to present unordered, unconfined neoplasm.Its histology take the form of the cancer cells infinite multiplication of a large amount of primitivizations and unordered shape ground crowd agglomerating, the NBT's structure around extruding and the erosion damage.
Because it is free that breast cancer cell is easy to come off, and sends out whole body with blood or lymph liquid etc., form early stage far-end and shift, cause its clinical cure difficulty.The transfer of whole body important organ such as lung transfer, brain transfer, bone transfer etc. all will directly threaten people's life, so mammary cancer is seriously to jeopardize the malignant disease of human life.
At present, in the treatment of mammary cancer, mainly contain following four big class methods: 1) operative treatment.Operative treatment is divided into different art formulas again, and they respectively have relative merits, is main purpose with radical cure primary carcinoma and regional lymph node metastasis all, under the prerequisite that does not influence radical cure primary carcinoma, reduces operation as far as possible and destroys, and strives for reservation function and profile.But recurrence and complication all take place in mammary cancer each art formula unavoidably.2) radiotherapy.Radiotherapy can reduce local recurrence and regional lymph nodes recurrence.But the x line of the gamma-rays of the too high 60Co of energy or 4～6mV can cause skin surface dosage low excessively, shallow layer tissue's underdosage.Radiotherapy can be divided into again merely clinically, before the art, 3 kinds of postoperatives.But medical circle is had different versions the view difference to radiotherapy at present.3) chemotherapy.Mammary cancer is treatment with chemotherapy one of the most effective tumour in the solid tumor.But chemotherapy is a kind of assisting therapy, but all should at first consider operation to patient with operation.4) endocrinotherapy.Clinically, the endocrinotherapy side effect is little, and effectively the case remission time is long, the life quality height.But its mechanism of action is complicated, not fully aware of as yet at present.
Certainly, except above several big class common methods, also has some other method.For example, new developing technology through ductus arteriosus perfusion chemotherapy medicine, made focal zone gauffer occur at the mammary cancer position in recent years, the lump hardening, and nodi lymphatici axillares dwindles.
But what be that above which kind of mode carries out all is in the treatment, for the mammary cancer early detection effect that takes place frequently at present and not obvious.And these methods are not that breast cancer cell is had the effect that target specially kills, and just healthy tissues and immunocytes that can a large amount of harm peripheries in the process of kill cancer cell cause patient self resistibility to descend.
Some antigenicity substances that breast cancer cell exists are for diagnosing mammary cancer, and especially early diagnosis mammary cancer and judging prognosis have very big help.By preparing these antigenic corresponding antibodies, whether the method detection biopsy or the specimens from pri that are easy to by immunohistochemical methods are mammary cancer; Simultaneously also can set up corresponding enzyme linked immunosorbent detection method and detect existence and the quantity of some antigen in serum and other body fluid, thus early diagnosis mammary cancer or make non-invasive diagnostic.Simultaneously, the antibody by the preparation corresponding antigens can also be used as the immune guiding treatment.So we we can say, the antibody that is prepared by the antigen of mammary cancer all plays an important role at aspects such as the diagnosis of mammary cancer, prevention, treatment, judging prognosis.Certainly, the effect power of these antibody largely depends on the character of its antigenicity substance.If this antigenicity substance is special more the expression of breast cancer tissue or cell surface, the corresponding antibody for preparing is just effective more in the immune guiding therapeutic process, safe more, mammary cancer preventative vaccine for preparing and therapeutic vaccine application prospect are also wide more.
In sum, seek a specific specificity height, in mammary cancer the The positive expression rate height, be positioned at the breast cancer cell surface, the people is had antigenic breast cancer antigen all have crucial meaning for diagnosis, prevention, the treatment of human breast carcinoma.
This patent work has obtained the subsidy of state natural sciences fund (No.30840028 and No.30970579), Tianjin basic science and research in new high-tech project (No.08JCYBJC25800) and center for doctors of the Ministry of Education fund (No.200800551035), in the most hearty gratitude of this expression.
[summary of the invention]
One of purpose of the present invention provides a kind of new people source breast cancer antigen Hv1 (valtage-gated proton channel), and the The positive expression rate height of this antigen in mammary cancer do not expressed at normal cell.Thereby the antigen that is provided not only can be used as the target spot of human breast carcinoma active immunity treatment or prevention, also can become the target spot of various immune guidings treatments.
Two of the object of the invention provides the antibody of the anti-above-mentioned people source breast cancer antigen Hv1 of a class.
At first, the amino acid residue sequence of new people source breast cancer antigen Hv1 (valtage-gated proton channel) provided by the invention is shown in sequence table 1.Described antigen is natural antigen or recombinant protein antigen.This antigen presentation is not expressed in the human normal cell line in the cancer cells of majority's mammary cancer.
This antigen can stimulate the anti-human breast carcinoma immune response of human body, can be used as the antigen of anti-human breast carcinoma immune guiding treatment target.
The gene clone of this new people source breast cancer antigen Hv1 provided by the invention is gone into to have the prokaryotic expression carrier of correct reading frame,, and carry out purifying, obtained the recombinant protein antigen of this people source breast cancer antigen by the IPTG abduction delivering.
The present invention also provides a kind of recombinant vectors (pGEX6p-1-c-Hv1) that contains the dna sequence dna of the aminoacid sequence shown in the sequence table as mentioned above 1 of encoding out (SEQ NO.1), and the host e. coli that contains this recombinant vectors.
Adopt above-mentioned recombinant protein antigen immunity Balb/c mouse, finally obtained anti-this antigenic antiserum(antisera).
Adopt above-mentioned antiserum(antisera) and immunohistochemical method, detected the human breast carcinoma tissue section preparation, the result shows that breast cancer tissue is positive, and proves that this antigen presentation is on most breast cancer cells; Also detected normal people's mammary tissue section simultaneously, the result does not see positive staining as yet in the 3 cover healthy tissues sections that detect, prove that this antigen is seldom to be expressed in healthy tissues at least.
In sum, people provided by the invention source breast cancer antigen Hv1 be a kind of in human breast carcinoma the The positive expression rate height, and expression specificity is also high, and is positioned at the new human breast carcinoma related antigen of tumor cell surface.
A second aspect of the present invention provides the antibody of the anti-above-mentioned people source breast cancer antigen Hv1 of a class.
This antibody-like not only can be used for the in-vitro diagnosis human breast carcinoma, and itself or derivatives thereof also can be used for immune guiding diagnosis in vivo or treatment human breast carcinoma.This antibody-like is meant polyclonal antibody, mouse monoclonal antibody or the antibody fragment of anti-people source breast cancer antigen, and the derivative of these antibody, described derivative include but not limited to antibody, the coupling liposome of antibody, the coupling chemicals of coupling nucleic antibody, merge the prodrug enzyme antibody, merge the antibody of other effector molecule etc.
According to known person source breast cancer antigen Hv1, be easy to obtain its corresponding various antibody and derivative.Can obtain corresponding various antibody by the following method, but not be only limited to following method:
1, adopts people source breast cancer antigen Hv1 immunizing rabbit, in detecting rabbit anteserum, behind the content of corresponding specific antibody, put to death animal and obtain antiserum(antisera), can obtain the polyclonal antibody of anti-people source breast cancer antigen Hv1 through conventional antibody purification.
2, adopt Hv1 immunity Balb/c mouse, in detecting mice serum, behind the content of corresponding specific antibody, put to death animal and obtain splenocyte,,, can obtain mouse monoclonal antibody again through the antigen-specific experiment sieving through merging with murine myeloma cell SP2/0.
A third aspect of the present invention also provides antibody and the application of derivative in the diagnosis of preparation human breast carcinoma, treatment, prophylactic agent of anti-people source breast cancer antigen Hv1.
The corresponding antibodies of anti-people source breast cancer antigen Hv1 can be used as medicine and is used among the diagnosis of mammary cancer.For example, this medicine can be used for the immunohistochemical staining of tissue sample to be diagnosed, and the detection that can be used for this antigenic content in tissue homogenate and various body fluid, the juice is diagnosed.In addition, independent corresponding antibodies also has the purposes of direct treatment mammary cancer.
The derivative of the corresponding antibodies of anti-people source breast cancer antigen Hv1 can be used as medicine and is used for immune guiding diagnosis or treatment mammary cancer.
As the antibody that is marked with nucleic or chemotherapeutics can take nucleic or chemicals to the breast cancer tissue part, thereby reduces the toxicity of nucleic or chemotherapeutics, increases the effect that they kill and wound breast cancer cell greatly.
The antibody that is marked with nucleic can also show the image of tumour under gamma camera, reach the purpose of immune guiding diagnosis.
Nano magnetic particle link coupled antibody gathers in mammary cancer focus part nano magnetic particle is dense, not only can be under X-ray, CT, nucleus magnetic resonance the video picture tumour, play the effect of diagnosis, can also under the effect of high-frequency alternating magnetic field, generate heat, breast cancer cell around killing and wounding plays the purpose for the treatment of mammary cancer.
This antigen corresponding antibodies and effector molecule are merged, can gather in the mammary cancer focus effector molecule is dense, effector molecule is farthest played a role, play the effect of treatment human breast carcinoma.
In a word, utilize the corresponding antibodies of aforementioned people provided by the invention source breast cancer antigen Hv1, can prepare the medicine of human breast carcinoma diagnosis, treatment, prevention, be used for diagnosis, the treatment of mammary cancer, prospect is very wide.
Advantage of the present invention and positively effect:
The The positive expression rate height of antigen provided by the invention in mammary cancer do not expressed at normal cell, thereby the antigen that is provided not only can be used as the target spot of human breast carcinoma active immunity treatment or prevention, can become the target spot of various immune guidings treatments yet.
This people source breast cancer antigen itself or its fusion rotein, recombinant protein promptly can be used as the breast cancer diagnosis medicine.Adopt this antigen can utilize methods such as protein hybridization or enzyme linked immunosorbent assay to detect the content of corresponding antibodies in patient's serum or other body fluid, juice, the organ washing lotion, can carry out preliminary diagnosis to mammary cancer according to the height of its corresponding antibodies content.This people source breast cancer antigen itself or its fusion rotein, recombinant protein not only can be used as medicine and are used for diagnosis, also can be used for the treatment of, the medicine of prophylaxis of tumours.According to this antigenic amino acid residue sequence, can make up the recombinant protein or the antigen peptide that contain aforementioned sequence, the identical or fairly similar of immune response that human immunity reaction and this people source breast cancer antigen that these recombinant proteins or antigen peptide evoke evoked.Thereby this people source breast cancer antigen itself or its corresponding recombinant protein and antigen peptide all can be used as tumor vaccine, evokes the immune response of human body anti-breast cancer, strengthens the lethal effect to breast cancer cell, thereby reach the purpose of prevention or treatment mammary cancer.
[description of drawings]
Fig. 1 is the gene sequencing figure of people source mammary cancer recombinant protein antigen;
Fig. 2 is the immunohistochemical methods figure that detects Hv1 distribution situation in the breast cancer cell, and wherein A B figure demonstration breast cancer cell is dyed brown, and C figure shows that the normal breast cell is not colored.
[embodiment]
Below in conjunction with various embodiments theme involved in the present invention is described, and the embodiment of the concrete application of new person source breast cancer antigen, corresponding antibodies and various derivatives among the present invention.
Embodiment 1: the preparation of new people source mammary cancer recombinant protein antigen
At first design the c end primer of the people source breast cancer antigen Hv1 that makes new advances, sequence is as follows:
C-Hv1BamH?I-F：5’CGCGGATCC?AAGACACGTTCAGAACGGC(SEQ?NO.2)
EcoR?I-R：5’CGGAATTCCTAGTTCACTTCACCAAGAAG(SEQ?NO.3)
By pcr amplification, double digestion PCR product and carrier pGEX6p-1 also reclaim, and connect, and obtain recombinant plasmid, and sequencing result is seen Fig. 1.This clone is exactly the clone who contains the recombinant expression plasmid of inventor source breast cancer antigen dna sequence dna, its called after pGEX6p-1-c-Hv1.PGEX6p-1-c-Hv1 is transformed into competence E.coli BL21 (DE3) intestinal bacteria, uses 0.5mM IPTG inductor, carry out protein expression.Obtain recombinant protein antigen by the ion-exchange column purification, aminoacid sequence is shown in sequence table SEQ NO.1.
Embodiment 2: the preparation of anti-people source breast cancer antigen Hv1 antibody
(1) mouse polyclonal antibody
Adopt the recombinant protein antigen of 50ug/ every people source breast cancer antigen Hv1 to mix the subcutaneous immune Balb/c mouse of complete freund adjuvant multiple spot, adopt the recombinant protein antigen of 50ug/ every people source breast cancer antigen Hv1 to mix the subcutaneous immunity second time of incomplete freund adjuvant multiple spot Balb/c mouse after 10 days.After the immunity for the second time, carry out immunity for the third time at interval a week.Blood sampling in immune for the third time back 10 days is surveyed and to be tired, when tire＞1: 10
6, put to death the animal blood sampling, adopt coagulation to collect serum, low-speed centrifugal goes precipitation.With physiological saline dilution in 1: 2, last Protein A affinity chromatography column purification, the 0.1M glycine buffer wash-out of pH2.8, among the 1M Tris and back is detected OD280 and is decided anti-body contg PBS dialysis 3 times, obtains the mouse polyclonal antibody of anti-people source breast cancer antigen Hv1.
If tire＜1: 10
6, then continue immunity to tire＞1: 10
6
(2) mouse monoclonal antibody
Adopt the only new people source mammary cancer recombinant protein antigen of 100ug/ to mix the subcutaneous immune Balb/c mouse of complete freund adjuvant, every recombinant protein antigen of 4 week back employing 50ug/ mixes complete freund adjuvant abdominal cavity booster immunization, adopt every recombinant protein antigen of 50ug/ to mix complete freund adjuvant abdominal cavity booster immunization after 4 weeks once more, 3 booster immunizations altogether, blood sampling is surveyed and to be tired after 10 days, when tire＞1: 10
6, put to death animal, collect the spleen tissue, make it be separated into unicellular by 100 purpose screen clothes.Adopt 50% PEG to urge fusion method, merge the back and adopt the HAT substratum to carry out screening and culturing 5,000,000 splenocytes and 1,000,000 SP2/0 cytogamy.The ELISA that cultivates 1 week back employing people source mammary cancer recombinant protein antigen bag quilt screens, and positive colony carries out subclone continuously, screens the clone of stably excreting specific antibody, obtains the mouse monoclonal antibody of anti-people source breast cancer antigen Hv1.
Embodiment 3:
The preparation of anti-people source breast cancer antigen Hv1 corresponding antibodies derivative
(1) nucleic-antibody coupling matter
(1)
188The corresponding mouse monoclonal antibody of the anti-people of Re mark source breast cancer antigen Hv1
SnCl
2The direct-reduction process traget antibody, instant thin-layer chromatography (ITLC) is measured the labeling effciency and the putting degree of antibody immediately.Behind the mark, the ITLC experiment shows:
188Re-antibody labeling rate is 90%, and radiochemicsl purity is greater than 95%.
188Re-antibody is 356MBq/mg than living.ELISA records
188Re-antibody mediated immunity activity is 65%.The experiment of the vitro stability of traget antibody shows that antibody was hatched 24 hours at 37 ℃, no matter is in physiological saline or human serum albumin, and radioactivity comes off all less than 5%, shows that it is external stable.
(2)
131The corresponding mouse monoclonal antibody of the anti-people of I mark source breast cancer antigen Hv1
The chloramine-t method traget antibody, instant thin-layer chromatography (ITLC) is measured the labeling effciency and the radiochemicsl purity of antibody immediately.Behind the mark, the ITLC experiment shows
131I-antibody labeling rate is 90%, and radiochemicsl purity is greater than 95%.
131I-antibody is 74MBq/mg than living, and ELISA records
131I-antibody mediated immunity activity 67.3%.
(2) nano magnetic particle-antibody coupling matter
With the ferriferous oxide magnetic-particle ultra-sonic dispersion of pure water, form colloidal with the about 20-50nm of diameter.The ratio that adds 16mg antibody in the 0.2g nano magnetic particle adds the antibody that is dissolved in pure water, mixes rapidly, adds final concentration behind the 5min and be 1% BSA, and is centrifugal and adopt 1% BSA washing back standby.
Embodiment 4:
The antibody that adopts valtage-gated proton channel Hv1 is as pharmacodiagnosis mammary cancer
Adopt routine immunization group method, paraffin section, with the lowlenthal serum sealing, an anti-mouse anti human breast cancer antigen Hv1 polyclonal antibody that adopts, the two anti-goat anti-mouse IgG-HRP that adopt, the DAB colour developing, phenodin dyes.
The result as shown in Figure 2, and is painted intensive in breast cancer tissue, is not colored in normal mammary tissue simultaneously.This difference just can be used for the detection of mammary cancer.
Claims (9)
1. a people source breast cancer antigen is characterized in that this antigenic amino acid residue sequence is shown in sequence table 1.
2. the gene clone of the described people of claim 1 source breast cancer antigen is gone into to have the prokaryotic expression carrier of correct reading frame,, and carry out purifying, can obtain this people source mammary cancer recombinant protein antigen by the IPTG abduction delivering.
3. recombinant vectors that contains the described coded amino acid residue sequence of claim 1.
4. host e. coli that contains the described recombinant vectors of claim 3.
5. the antibody of the described people of the anti-claim 1 of class source breast cancer antigen.
6. antibody according to claim 5, it is characterized in that described antibody is polyclonal antibody, mouse monoclonal antibody or the antibody fragment of anti-people source breast cancer antigen, and the derivative of these antibody, described derivative comprises the antibody of coupling nucleic, the antibody of coupling chemicals, the antibody of coupling liposome, the antibody that merges the prodrug enzyme and the antibody that merges other effector molecule.
7. method that obtains the polyclonal antibody of the described anti-people of claim 6 source breast cancer antigen, it is characterized in that adopting the described people of claim 1 source breast cancer antigen immunizing rabbit, in detecting rabbit anteserum behind the content of corresponding specific antibody, put to death animal and obtain antiserum(antisera), can obtain the polyclonal antibody of anti-people source breast cancer antigen through conventional antibody purification.
8. method that obtains the mouse monoclonal antibody of the described anti-people of claim 6 source breast cancer antigen, it is characterized in that adopting the described people of claim 1 source breast cancer antigen immunity Balb/c mouse, in detecting mice serum behind the content of corresponding specific antibody, put to death animal and obtain splenocyte, through merging with murine myeloma cell SP2/0, through the antigen-specific experiment sieving, can obtain mouse monoclonal antibody again.
9. the antibody of the described anti-people of claim 5 a source breast cancer antigen and derivative thereof the application in the diagnosis of preparation human breast carcinoma, treatment, prophylactic agent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102974185A CN101962405A (en) | 2010-09-30 | 2010-09-30 | Humanized breast cancer antigen and antibody thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102974185A CN101962405A (en) | 2010-09-30 | 2010-09-30 | Humanized breast cancer antigen and antibody thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101962405A true CN101962405A (en) | 2011-02-02 |
Family
ID=43515467
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102974185A Pending CN101962405A (en) | 2010-09-30 | 2010-09-30 | Humanized breast cancer antigen and antibody thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101962405A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101979549A (en) * | 2010-09-30 | 2011-02-23 | 南开大学 | Gene medicament taking voltage-gated proton channel Hv1 as targeted locus for treatment of breast cancer |
| CN102584978A (en) * | 2012-03-16 | 2012-07-18 | 李树杰 | Marker for diagnosis and prognosis of colorectal cancer, breast cancer and pancreatic cancer |
| CN111333698A (en) * | 2020-03-18 | 2020-06-26 | 北京鼎成肽源生物技术有限公司 | Breast cancer target antigen combination, CTL cell cultured by breast cancer target antigen combination stimulation and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1076489A (en) * | 1992-02-17 | 1993-09-22 | 马普科技促进协会 | The genetic sequence of 90K tumor associated antigen IR-95 |
| CN1443239A (en) * | 2000-05-24 | 2003-09-17 | 科里克萨有限公司 | Compositions and methods for therapy and diagnosis of breast cancer |
-
2010
- 2010-09-30 CN CN2010102974185A patent/CN101962405A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1076489A (en) * | 1992-02-17 | 1993-09-22 | 马普科技促进协会 | The genetic sequence of 90K tumor associated antigen IR-95 |
| CN1443239A (en) * | 2000-05-24 | 2003-09-17 | 科里克萨有限公司 | Compositions and methods for therapy and diagnosis of breast cancer |
Non-Patent Citations (1)
| Title |
|---|
| GENBANK: "ADA61023", 《GENBANK》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101979549A (en) * | 2010-09-30 | 2011-02-23 | 南开大学 | Gene medicament taking voltage-gated proton channel Hv1 as targeted locus for treatment of breast cancer |
| CN101979549B (en) * | 2010-09-30 | 2012-08-29 | 南开大学 | Gene medicament taking voltage-gated proton channel Hv1 as targeted locus for treatment of breast cancer |
| CN102584978A (en) * | 2012-03-16 | 2012-07-18 | 李树杰 | Marker for diagnosis and prognosis of colorectal cancer, breast cancer and pancreatic cancer |
| CN111333698A (en) * | 2020-03-18 | 2020-06-26 | 北京鼎成肽源生物技术有限公司 | Breast cancer target antigen combination, CTL cell cultured by breast cancer target antigen combination stimulation and application thereof |
| CN111333698B (en) * | 2020-03-18 | 2021-11-23 | 北京鼎成肽源生物技术有限公司 | Breast cancer target antigen combination, CTL cell cultured by breast cancer target antigen combination stimulation and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104662044B (en) | For treating ROR1 cancers and inhibiting the antibody and vaccine that shift | |
| CN105209489B (en) | For the specific detection tool for the circulating tumor cell that interstitial and epithelial-mesenchymal convert | |
| CN103421113B (en) | Anti- BLyS antibody | |
| JP4287147B2 (en) | Monoclonal antibodies and cell surface antigens for the detection and treatment of small cell lung cancer (SCLC) | |
| CN100497386C (en) | Antibodies of non-functional P2X7 receptor and its uses | |
| JP7522918B2 (en) | Anti-HMMW antibodies, compositions containing same, and nucleic acid molecules encoding same, and uses thereof | |
| CN105126128A (en) | Novel tumor VEGFR-3 molecular photographic developer and application thereof | |
| CN103923212A (en) | EHD2 antibody and application of EHD2 antibody to preparation of immunohistochemical detection reagent for breast cancer | |
| CN101962405A (en) | Humanized breast cancer antigen and antibody thereof | |
| CN107298697B (en) | Human PD-L1 protein Y123Site phosphorylation antibody and preparation method and application thereof | |
| CN102219854A (en) | Monoclonal antibody of anti-human PIGF (placental growth factor) protein as well as preparation method and application thereof | |
| CN110300761A (en) | Anti- PCNA monoclonal antibody and application thereof | |
| CN105873950A (en) | Anti-s100a7 antibodies for the treatment and diagnosis of cancer | |
| CN102574925A (en) | Oncofetal antigen/immature laminin receptor antibodies for diagnostic and clinical applications | |
| CN112661812B (en) | KK-LC-1 antigen targeted binding peptide, derivative, probe and application thereof | |
| CN1951962B (en) | Polypeptide for preparing antineoplastic antibody and its uses | |
| CN103130896B (en) | Monoclonal antibody for resisting cell surface ectopic expression, and preparation method and application thereof | |
| CN108129564B (en) | Fully human anti-VEGF single-chain antibody and application thereof | |
| JP6753955B2 (en) | A method for diagnosing and treating cancer using an antibody that binds to a C1 inactivating substance, a C-reactive protein and / or complement component C4. | |
| CN101469019B (en) | Cellular membrane protein DERLIN-1, preparation and use thereof | |
| CN104592386B (en) | Ets domain transcription factor FEV protein monoclonal antibodies and its application | |
| CN1933851A (en) | Use of anti-alpha5beta1 antibodies to inhibit cancer cell proliferation | |
| CN1254485C (en) | Human lung cancer antigen and its antibody | |
| RU2737996C1 (en) | Method for evaluating neoadjuvant systemic therapy of breast cancer with her2/neu overexpression | |
| CN117624368A (en) | Monoclonal antibody for binding serine peptidase inhibitor Kazal1 type protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20110202 |