CN113604602A - STR molecular marker of nematophagous fungi Arthrobotrya oligospora - Google Patents
STR molecular marker of nematophagous fungi Arthrobotrya oligospora Download PDFInfo
- Publication number
- CN113604602A CN113604602A CN202111039221.6A CN202111039221A CN113604602A CN 113604602 A CN113604602 A CN 113604602A CN 202111039221 A CN202111039221 A CN 202111039221A CN 113604602 A CN113604602 A CN 113604602A
- Authority
- CN
- China
- Prior art keywords
- str
- oligospora
- primers
- polymorphism
- centrifuge tube
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses an STR molecular marker of arthrobotrys oligosporus of nematode-trapping fungi, in particular relates to the technical field of DNA molecular markers, and comprises the following specific steps: the method comprises the steps of firstly, Arthrobotrys oligospora whole genome STR scanning and primer design, secondly, extracting and detecting Arthrobotrys oligospora genome DNA, thirdly, primary screening and product detection of STR primers, and fourthly, genetic diversity analysis based on STR data. On the basis of the obtained Arthrobotrys oligospora genome data, the distribution of STR is detected on the genome level by using a conventional bioinformatics method, primer design is carried out, 20 STR molecular markers with polymorphism are obtained after primary screening and secondary screening are carried out on part of primers by using Arthrobotrys oligospora strain samples separated from different growth environments, and the molecular markers have the advantages of high polymorphism, good repeatability, convenience and quickness in detection, low use cost and the like.
Description
Technical Field
The invention relates to the technical field of DNA molecular markers, in particular to an STR molecular marker for arthrobotrys oligosporus of nematode-trapping fungi.
Background
The molecular marker is a genetic marker based on DNA sequence variation among individuals, can detect variation or polymorphism of specific regions of DNA among individuals, and can directly reflect genetic diversity of DNA level, including multiple types such as Restriction Fragment Length Polymorphism (RFLP), Amplified Fragment Length Polymorphism (AFLP), Single Nucleotide Polymorphism (SNP), Short Tandem Repeat (STR) and the like. These molecular marker techniques have wide applications in the construction of biological genetic maps, map-based cloning, species genetic relationship identification, systematic classification and gene diagnosis. Among the molecular markers, STR has the advantages of simple operation, low requirement on DNA, objective and clear genotyping, good repeatability, high polymorphism, capability of distinguishing homozygous genotypes from heterozygous genotypes and the like, can detect more alleles, and provides richer variation information for DNA sequence polymorphism analysis among individuals.
The nematophagous hyphomycete is a kind of non-sexual fungus which is aquatic and terrestrial and is widely distributed in the world, and the life style of the combination of saprophytic and nematode parasitism makes the nematophagous hyphomycete have extremely strong ecological adaptability, and the nematophagous hyphomycete is an important factor for the natural control of nematode population and is also an important research material for the biological control of plant diseases. Arthrobotrys oligospora (Arthrobotrys oligospora) is a model species for researching interaction of nematode-trapping fungi and nematodes, and has great biocontrol potential and application value in the field of nematode biocontrol. Currently, research on molecular markers of Arthrospora oligospora mainly focuses on two types, AFLP and Multi-site sequence typing (MLST), which are SNP molecular markers. Although two types of molecular markers have application in the research of genetic diversity of Arthrosporium oligospora, the defects are very obvious: (1) the number of detected alleles is limited, and the genetic variation of the DNA level of Arthrosporium oligospora in nature cannot be objectively reflected; (2) the AFLP molecular marker has high requirements on the purity of DNA and the quality of restriction enzyme, and the MLST molecular marker not only has high requirements on the purity of DNA, but also depends on a DNA sequencing technology, and both molecular markers have the problem of high technical cost. Therefore, it is necessary to develop new molecular markers to make up for the above-mentioned shortcomings of the two molecular markers.
Disclosure of Invention
Therefore, the invention provides an STR molecular marker of Arthrobotrys oligospora predatory fungi, which aims to solve the problems in the prior art.
In order to achieve the above object, the embodiments of the present invention provide the following technical solutions: the STR molecular marker for the arthrobotrys oligosporus of the nematode-trapping fungi comprises the following specific steps:
step one, total genome STR scanning and primer design of Arthrobotrys oligospora: according to the sequence information of genome (GenBank: ADOT 000000000000.) of Arthrobotrys oligospora mode strain (ATCC24927) downloaded from the internet, MISA is utilized to carry out whole genome STR scanning, primer3 is utilized to carry out primer design by 100bp flanking sequences on the upstream and downstream of the detected STR, partial primers are selected to carry out primary screening and secondary screening, 20 0.2g with polymorphism are obtained and are placed in a 2.0mL sterile centrifuge tube, and the modified CTAB method is adopted to extract genome DNA: s1, adding sterilized steel balls and 0.5mL of CTAB lysate into the centrifugal tube added with the hyphae, processing for 3 minutes under the condition of a high-flux tissue grinder 50Hz after balancing, repeating for 4 times, adding 0.5mL of CTAB lysate into the centrifugal tube after grinding is finished, and uniformly mixing; s2, fixing the uniformly mixed centrifuge tube on a foam board, then placing the centrifuge tube in a water bath at 65 ℃ for 30 minutes, and turning the centrifuge tube 1 time every 10 minutes; s3, centrifuging for 10 minutes at 12000 rpm under the normal temperature condition, and taking 0.8mL of supernate to a new 2mL sterile centrifuge tube after the centrifugation is finished; s4, adding phenol chloroform isoamyl alcohol with the volume ratio of 25:24:1 and the pH value of more than 7.8, fully and uniformly mixing, centrifuging for 10 minutes at the normal temperature at 12000 rpm, and taking 0.6mL of supernate into a new 2mL sterile centrifuge tube; s5, adding 0.6mL of phenol chloroform isoamyl alcohol with the volume ratio of 25:24:1 and the pH value of more than 7.8, and re-extracting; after fully and uniformly mixing, centrifuging for 10 minutes at the normal temperature by 12000 rpm, and taking 0.4mL of supernatant into a new 1.5mL sterile centrifuge tube; s6, adding 0.4mL of isopropanol and 1/10 volume of 3.0M sodium acetate, and placing the mixture in a refrigerator at the temperature of-20 ℃ for precipitation for more than 30 minutes; s7, centrifuging at 12000 rpm for 10 minutes at normal temperature, removing supernatant, adding 1.0mL of 70% ethanol to wash precipitated DNA, and repeating twice; s8, inverting the centrifuge tube on a dry paper towel, sucking the liquid on the inner wall of the centrifuge tube as much as possible, and then placing the centrifuge tube on a constant-temperature mixer at 55 ℃ for drying; s9, adding 80 mu l of sterile water into the centrifugal tube, and standing overnight at 4 ℃ to fully dissolve the DNA precipitate; s10, taking 3.0 mul of DNA sample to carry out 1.0% agarose gel electrophoresis detection; s11, storing the DNA sample at-20 ℃;
step three, primary screening of STR primers and product detection: in the results of the whole genome STR scanning and primer design, 200 pairs of primers are randomly selected from different scaffolds, the specificity of the primers in the genome is detected through local Blast, the primers are synthesized, 8 Arthrosporium oligospora strains are randomly selected for PCR amplification, and polymorphism of STR amplification products is detected through polyacrylamide gel electrophoresis; after the pre-experiment, selecting 20 pairs of primers with better polymorphism as selected STR primers, adding different fluorescent labels to the forward primers when synthesizing the selected STR primers, and then carrying out PCR amplification on all samples;
step four, analyzing the genetic diversity based on the STR data: analyzing genetic diversity of a 198 Arthrospora oligospora sample isolated from China; and importing the STR data into an R program package ' poppr ' to calculate a Bruvo's distance matrix, and importing the distance matrix result into MEGA6.0 to construct a UPGMA tree.
Further, in step one, the conditions for primer design are as follows: the length of the primer is between 20 and 23 bp; the annealing temperature is 60 ℃; the length of the amplified sequence is between 130bp and 250bp, and the core unit comprises tandem repeat of 2-4 bases.
Further, in step three, the 25 μ L PCR amplification reaction system was: 1 μ L of template at 50 ng/. mu.L; 25mM MgCl22.5 mu L; 1 μ L of 10mM dNTPs; 1 μ L of each 10 μ M forward and reverse primers; DNASTaq enzyme 0.25 μ L at 5U/. mu.L; 10 XPCR reaction buffer 2.5. mu.L; deionized water 15.8. mu.L.
Further, in step three, the PCR amplification reaction procedure is: pre-denaturation at 94 ℃ for 5 min, denaturation at 94 ℃ for 30 sec, annealing at 60 ℃ for 30 sec, extension at 72 ℃ for 30 sec, 30 cycles in total, and final extension at 72 ℃ for 5 min; the amplified product is loaded, electrophoresis detection is carried out in 1.0% agarose gel and 1 xTBE electrophoresis solution, and the PCR product is sent to relevant units for genotyping.
Further, in step four, the typing results of 20 STR loci in all samples showed that the number of alleles per locus was 3 (loci A3) to 21 (loci a191), 9.4 on average, and the Polymorphism Information Content (PIC) ranged from 0.244(A3) to 0.858(a191), according to the STR molecular marker polymorphism information content classification standard: of the 20 pairs of STR loci, 13 pairs have a high level polymorphism (PIC >0.5), 6 pairs have a medium level polymorphism (0.5> PIC >0.25), only 1 pair has a low level polymorphism (PIC >0.25), and the 20 pairs have a high overall polymorphism.
Further, in step four, the UPGMA tree results show that: all samples were branched independently on the UPGMA tree, and the polymorphic information in 20 sites has distinguished 198 samples
The invention has the following advantages:
on the basis of the obtained Arthrobotrys oligospora genome data, the distribution of STR is detected on the genome level by using a conventional bioinformatics method, primer design is carried out, and 20 STR molecular markers with polymorphism are obtained after primary screening and secondary screening are carried out on part of primers by using Arthrobotrys oligospora strain samples separated from different growth environments. Provides a powerful research tool for the subsequent genetic diversity of Arthrosporium oligospora, population genetics and screening of biocontrol strains with high environmental adaptability and strong nematode killing activity.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. It should be apparent that the drawings in the following description are merely exemplary, and that other embodiments can be derived from the drawings provided by those of ordinary skill in the art without inventive effort.
The structures, ratios, sizes, and the like shown in the present specification are only used for matching with the contents disclosed in the specification, so as to be understood and read by those skilled in the art, and are not used to limit the conditions that the present invention can be implemented, so that the present invention has no technical significance, and any structural modifications, changes in the ratio relationship, or adjustments of the sizes, without affecting the effects and the achievable by the present invention, should still fall within the range that the technical contents disclosed in the present invention can cover.
FIG. 1 is a graphical representation of the results of all samples provided by the present invention on a UPGMA tree.
Detailed Description
The present invention is described in terms of particular embodiments, other advantages and features of the invention will become apparent to those skilled in the art from the following disclosure, and it is to be understood that the described embodiments are merely exemplary of the invention and that it is not intended to limit the invention to the particular embodiments disclosed. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Referring to the attached figure 1 of the specification, the STR molecular marker of the nematophagous fungus Arthrospora oligospora of the embodiment comprises the following specific steps:
step one, total genome STR scanning and primer design of Arthrobotrys oligospora: based on the sequence information of genome (GenBank: ADOT 000000000000.) of Arthrobotrys oligospora model strain (ATCC24927) downloaded from the Internet, MISA is used for whole genome STR scanning, primer3 is used for primer design by using the detected STR upstream and downstream 100bp flanking sequences, and the conditions of primer design are as follows: the length of the primer is between 20 and 23 bp; the annealing temperature is 60 ℃; the length of the amplified sequence is between 130bp and 250bp, and the core unit comprises tandem repeat of 2 to 4 bases; then, selecting partial primers to carry out primary screening and secondary screening to obtain 20 STR molecular markers with polymorphism; the 20 STR molecular markers are numbered as: a003, a005, a017, a025, a051, a074, a080, a083, a087, a101, a103, a126, a149, a154, a156, a160, a177, a187, a191 and a 192;
the STR molecular markers have nucleotide sequences as follows:
a003(136bp) consisting of the nucleotide sequence shown below:
GGAGTGGAAGTTAGATTGGAGGTGGGGATGTCGAGGAGGAGAGGACGTAGAAGCGCCGAGGAGACGGAAGAGCTTGAAGTGGTGGTGGTGTCGCCTCCCCGCTGTGATCATAAATATGCAAGTAAATTAGTTCCCC；
a005(150bp) consisting of the nucleotide sequence shown below:
CGATGAAGACGTGAGTTAGTTGGTTGGTGGTTGGCAGATAGATGGTTTGGGTGGATGATGGATGGATGGATGGATGATGGGCGGTTGGCTGGTTGGCTGGCTGGCGTTGATGGAACGTGAAAGGGCGATGATTAAAGGTGGTGACAGACA；
a017(146bp) consisting of the nucleotide sequence shown below:
CTCTGCTGAGACGTTAATGATCAATGGTGGTGGTGGTGATGATTATGGTGGTGCATATAGGCCAATCCCAGACTTCACTTTTGCTTCGGACGCCTATCCAGGAAATCGACGATGTCATCCGTGCGAACCTCTTGGGTACGATTTAC；
a025(135bp), consisting of the nucleotide sequence shown below:
GGGCATACCTCTCTTCTCTTAGTAGTAGCAGTAGTAGTAGTAGCGGAGGCTGCAATACAAACACTGCTATTAATACATCCACACCCGTCCTGTCACAATCAGAAAAATATCTCCAAAGACCATACCTAGCAATCC；
a051(151bp), consisting of the nucleotide sequence shown below:
ATTAACAATGGTCCGAAACTTCCGTTACTCTGTGGGAAAGCAAGAAAGCAAGCAAGCAAGCAGGTCTTCTCATCACACAACCATGACCACCACACTCGCCCTCCAAAATGTTGGTTGGCGATGTTTTTGCACTAATGGCTTTCTCCTTGTC；
a074(141bp) consisting of the nucleotide sequence shown below:
GATCGATTCTCGCTTAAAGACGGTCGATGAAGTTGCTGCTGCTGCTGCTGCTGCTGCAGTGCTTGATATGAATGTTGATGCTGATGCTGGGTTTGTGGCTCCTGATGTGGGGTGTGGGAATGAGAGTATAGTGGAGCAGGA；
a080(145bp) consisting of a nucleotide sequence as shown below:
GGGACATCGACAATATGTAAGTATCATACGAATTCTCTTGGGCCGGGTGCGACATTAAAAACGCTGATGCTACTATTTTTGCACCTGCTGCTGCTGCTGCTGTAATATAGGCTAGGAGCTAGTGTTATGTCTCAAAGCAGAGCTC；
a083(144bp), consisting of the nucleotide sequence shown below:
GAATCTTTCGGTTTAATGGTTTTCTTTTTATTAACTTCTAACTATTCATGTGGTGATGATTGCTGCTTGGGGATGACTTTCTTTCTTTCTTTCTTTCTACTTCTGAGCGCTTCTTCTCTGTTTTACTATGATACCACCATTCCC；
a087(152bp), consisting of the nucleotide sequence shown below:
GGAGAAACATCAATCAATCAATCGAGCGAGCAAGCAAGCAAAAAAACGAGGACCAAGAGGCACATTATCTCCTTTCACAGTGGTGGAGGAGAAGGTGGTGGTCGATGAGTGGAAAGACGTGTCTGCCAAGTCGACATCTTGGTTCCTCTCAG；
a101(147bp), consisting of the nucleotide sequence shown below:
ACAACATCAACTACCATCCACACTCCCACTCCCACGCCCACTCTCACTCTCATTCTCGCTCGCTCTCTTCTCACCACCAAGGCGGCCATTCTCCTCCTCCGCCAGCACACGCTCCTCCTCCTCCCTCTTATCCTTCTTCCAATAGCC；
a103(150bp), consisting of the nucleotide sequence shown below:
TCACTGCACTATCTCCAATCTAGGTTTTAGGGAGGTGATGTATTGTATGTATGTATGTAGGAGGGAAACTAAAAAAaCAAAAAAaTGTCTAGACTTGACTTTGCGTCAAAAGTCTGGGGAAAGTATGTGAAGTATGTTTCGATGTCGTGT；
a126(200bp), consisting of the nucleotide sequence shown below:
GCCAGGTGGTTAGGAGTATAAACCAAAACGTAAAAAAAaGAAAGAAAGAAAAGAAAGAAAGTGCCCCGCTAAGCGTAATGGGAAAAAAAATTTCAGATGCATGCCAATGCTGACACGGGTCGCGGCACGAGAGAGAAGCCGACCGCCGAGGGCAAGATAACTAAAAAGGGATATCGATTGACGTTATGGTGGTTCAAATA；
a149(142bp) consisting of the nucleotide sequence shown below:
AAAGAATGTGTGTCATCGAATACACACAAGCACACACACACACCATCGGTCTTTCGAAGCGGGGGGATAGAAAAGGGAAAGGGAAAAAAGGTGAGGTACTATGTAATGGAGGCTACTAGTATACTGACGGAACTAGGATGAA；
a154(169bp), consisting of the nucleotide sequence shown below:
TAATCTGAATGGTTGGTTGTTTCTGTTGGTTGGTGCTAGCTAGCTAGCTAAGTAACTCCTAAGCTTTTCGTTCTAGATGCTAGTACCGTGACGGTATACACCCTCAGCTTCGAATCGCATTCCGAAGGAGAAAGCCGCCGCCGCGGGAGCTAGTTGACAGTCCTTCATG；
a156(151bp) consisting of the nucleotide sequence shown below:
ATGTTTAATTTCCCTCCAAACTTCAACAAAGAAATGGAGGGAAACTAGTTGGGATGAATGGGGAAGAGGAAAAAGATGACGATGATGGAGTTGATGATGATGATGGAGGGGAGGAATGACAACAGGGCAGGAGAATTGCGAGTTGAGAGAA；
a160(158bp), consisting of the nucleotide sequence shown below:
GAACATGCACGTGTGAGATATATTTTCTGTCCGTATGTCCTGGACATGTATGTAAGTAAGCATGTAGTAAGTTAGTAAGAGAATCAGTAAGAAAGGAAGTCAGTCAGTCAGTCAGTAAATACCTAGGTATGGGGGCCTGTATGGTCTCGTATGGAGTC；
a177(138bp) consisting of the nucleotide sequence shown below:
GTTCGAGGGATAGTAGTGGTTGAGGAGTAGAGAGAGAGAGAGAAGAAAAAACACGCAAGCCCGGAAAAAGGATATGTGATGCACAAGTCGGATGATTGGGTATAAATGATAAAATCGTAGGTAAAAGATATGCGTTGG；
a187(142bp) consisting of the nucleotide sequence shown below:
GTCCAAGTTTGTCCAGTACACCCCTCCTCCTCCTCTGAGCCTTGCTCTTACAATGCAGCTTGTCAGTTCAGTCAGTCTACTGTGTATAGACTAAGTAAGTAAGGAATTACTTAGCTAAGTAATTCGGTATATTCTCCACGAT；
a191(165bp), consisting of the nucleotide sequence shown below:
AACACATCTCATTCATCCATCCACCCATCCATCCATTCATCCATTCCCCACCCCCCCAAATAAGTAGTATCCAACTTATATTTAATTATCGGAACACCACCACCACCACCACCACGAACAAGATTATTTTTATCGTGTCAGAATGTCAACTGTCAAATGTCAGGT；
a192(166bp) consisting of the nucleotide sequence shown below:
CCTAATACCCAACCGAATAACACGCCGAATACAGAGCCAAACGGTCGACCTAATACAAACAACCCACCGAACACTCCTCCTCCTCCTCCTCCTCAAGAGCCTACCGGACCAAACAATCTACCGCAAAGCAGCCCTTCACCGAACGAGAACCCAGTTACACCTGTTT；
the primer sequences of the STR molecular markers are respectively as follows:
A003-F：GGAGTGGAAGTTAGATTGGAG；
A003-R：GGGGAACTAATTTACTTGCAT；
A005-F：CGATGAAGACGTGAGTTAGTT；
A005-R：TGTCTGTCACCACCTTTAATC；
A017-F：CTCTGCTGAGACGTTAATGAT；
A017-R：GTAAATCGTACCCAAGAGGTT；
A025-F：GGGCATACCTCTCTTCTCTTA；
A025-R：GGATTGCTAGGTATGGTCTTT；
A051-F：ATTAACAATGGTCCGAAACTT；
A051-R：GACAAGGAGAAAGCCATTAGT；
A074-F：GATCGATTCTCGCTTAAAGAC；
A074-R：TCCTGCTCCACTATACTCTCA；
A080-F：GGGACATCGACAATATGTAAG；
A080-R：GAGCTCTGCTTTGAGACATAA；
A083-F：GAATCTTTCGGTTTAATGGTT；
A083-R：GGGAATGGTGGTATCATAGTA；
A087-F：GGAGAAACATCAATCAATCAA；
A087-R：CTGAGAGGAACCAAGATGTC；
A101-F：ACAACATCAACTACCATCCAC；
A101-R：GGCTATTGGAAGAAGGATAAG；
A103-F：TCACTGCACTATCTCCAATCT；
A103-R：ACACGACATCGAAACATACTT；
A126-F：GCCAGGTGGTTAGGAGTATAA；
A126-R：TATTTGAACCACCATAACGTC；
A149-F：AAAGAATGTGTGTCATCGAAT；
A149-R：TTCATCCTAGTTCCGTCAGTA；
A154-F：TAATCTGAATGGTTGGTTGTT；
A154-R：CATGAAGGACTGTCAACTAGC；
A156-F：ATGTTTAATTTCCCTCCAAAC；
A156-R：TTCTCTCAACTCGCAATTCT；
A160-F：GAACATGCACGTGTGAGATA；
A160-R：GACTCCATACGAGACCATACA；
A177-F：GTTCGAGGGATAGTAGTGGTT；
A177-R：CCAACGCATATCTTTTACCTA；
A187-F：GTCCAAGTTTGTCCAGTACAC；
A187-R：ATCGTGGAGAATATACCGAAT；
A191-F：AACACATCTCATTCATCCATC；
A191-R：ACCTGACATTTGACAGTTGAC；
A192-F：CCTAATACCCAACCGAATAAC；
A192-R：AAACAGGTGTAACTGGGTT；
step two, extracting and detecting genome DNA of Arthrobotrys oligospora: scraping a proper amount of 0.2g of Arthrospora oligospora hyphae from a PDA (personal digital assistant) plate, placing the Arthrospora oligospora hyphae into a 2.0mL sterile centrifuge tube, and extracting genomic DNA by adopting an improved CTAB (cetyltrimethyl ammonium bromide) method: s1, adding sterilized steel balls and 0.5mL of CTAB lysate into the centrifugal tube added with the hyphae, processing for 3 minutes under the condition of a high-flux tissue grinder 50Hz after balancing, repeating for 4 times, adding 0.5mL of CTAB lysate into the centrifugal tube after grinding is finished, and uniformly mixing; s2, fixing the uniformly mixed centrifuge tube on a foam board, then placing the centrifuge tube in a water bath at 65 ℃ for 30 minutes, and turning the centrifuge tube 1 time every 10 minutes; s3, centrifuging for 10 minutes at 12000 rpm under the normal temperature condition, and taking 0.8mL of supernate to a new 2mL sterile centrifuge tube after the centrifugation is finished; s4, adding phenol chloroform isoamyl alcohol with the volume ratio of 25:24:1 and the pH value of more than 7.8, fully and uniformly mixing, centrifuging for 10 minutes at the normal temperature at 12000 rpm, and taking 0.6mL of supernate into a new 2mL sterile centrifuge tube; s5, adding 0.6mL of phenol chloroform isoamyl alcohol with the volume ratio of 25:24:1 and the pH value of more than 7.8, and re-extracting; after fully and uniformly mixing, centrifuging for 10 minutes at the normal temperature by 12000 rpm, and taking 0.4mL of supernatant into a new 1.5mL sterile centrifuge tube; s6, adding 0.4mL of isopropanol and 1/10 volume of 3.0M sodium acetate, and placing the mixture in a refrigerator at the temperature of-20 ℃ for precipitation for more than 30 minutes; s7, centrifuging at 12000 rpm for 10 minutes at normal temperature, removing supernatant, adding 1.0mL of 70% ethanol to wash precipitated DNA, and repeating twice; s8, inverting the centrifuge tube on a dry paper towel, sucking the liquid on the inner wall of the centrifuge tube as much as possible, and then placing the centrifuge tube on a constant-temperature mixer at 55 ℃ for drying; s9, adding 80 mu l of sterile water into the centrifugal tube, and standing overnight at 4 ℃ to fully dissolve the DNA precipitate; s10, taking 3.0 mul of DNA sample to carry out 1.0% agarose gel electrophoresis detection; s11, storing the DNA sample at-20 ℃;
step three, primary screening of STR primers and product detection: in the results of the whole genome STR scanning and primer design, 200 pairs of primers are randomly selected from different scaffolds, the specificity of the primers in the genome is detected through local Blast, the primers are synthesized, 8 Arthrosporium oligospora strains are randomly selected for PCR amplification, and polymorphism of STR amplification products is detected through polyacrylamide gel electrophoresis; after the pre-experiment, selecting 20 pairs of primers with better polymorphism as selected STR primers, adding different fluorescent labels to the forward primers when synthesizing the selected STR primers, and then carrying out PCR amplification on all samples;
the 25. mu.L PCR amplification reaction system was: 1 μ L of template at 50 ng/. mu.L; 25mM MgCl22.5 mu L; 1 μ L of 10mM dNTPs; 1 μ L of each 10 μ M forward and reverse primers; DNASTaq enzyme 0.25 μ L at 5U/. mu.L; 10 XPCR reaction buffer 2.5. mu.L; 15.8 mu L of deionized water;
the PCR amplification reaction program is as follows: pre-denaturation at 94 ℃ for 5 min, denaturation at 94 ℃ for 30 sec, annealing at 60 ℃ for 30 sec, extension at 72 ℃ for 30 sec, 30 cycles in total, and final extension at 72 ℃ for 5 min; loading the amplified product, detecting by electrophoresis in 1.0% agarose gel and 1 × TBE electrophoresis solution, and sending the PCR product to relevant units for genotyping; the PCR product can be sent to Beijing Optimalaceae biotechnology limited for genotyping;
step four, analyzing the genetic diversity based on the STR data: analyzing genetic diversity of a 198 Arthrospora oligospora sample isolated from China; importing STR data into an R program package ' poppr ' to calculate a Bruvo's distance matrix, and importing a distance matrix result into MEGA6.0 to construct a UPGMA tree;
the typing results of 20 STR loci in all samples show that the number of alleles per locus is 3 (locus A3) to 21 (locus A191), the average number is 9.4, the polymorphism information content (polymorphism information PIC) ranges from 0.244(A3) to 0.858(A191), and the STR molecular marker polymorphism information content division standard is as follows: of the 20 pairs of STR loci, 13 pairs have high level polymorphism (PIC >0.5), 6 pairs have medium level polymorphism (0.5> PIC >0.25), only 1 pair has low level polymorphism (PIC >0.25), and the 20 pairs of STR loci have high overall polymorphism;
the UPGMA tree result shows that all samples are independent branches on the UPGMA tree as shown in figure 1, and the polymorphism information in 20 sites can distinguish 198 samples, which shows that the primers can provide enough diversity in detection population and provide powerful research tools for subsequent genetic diversity, population genetics and screening of biocontrol strains with high environmental adaptability and strong nematode killing activity.
Although the invention has been described in detail above with reference to a general description and specific examples, it will be apparent to one skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Claims (6)
1. STR molecular marker of arthrobotrys oligosporus of nematode-trapping fungi, which is characterized in that: the method comprises the following specific steps:
step one, total genome STR scanning and primer design of Arthrobotrys oligospora: according to sequence information of genome (GenBank: ADOT 000000000000.) of Arthrosporia oligospora model strain (ATCC24927) downloaded from the Internet, MISA is utilized to carry out whole genome STR scanning, primer3 is utilized to carry out primer design by 100bp flanking sequences on the upstream and downstream of the detected STR, and 20 STR molecular markers with polymorphism are obtained after primary screening and secondary screening are carried out on partial primers;
step two, extracting and detecting genome DNA of Arthrobotrys oligospora: scraping a proper amount of 0.2g of Arthrospora oligospora hyphae from a PDA (personal digital assistant) plate, placing the Arthrospora oligospora hyphae into a 2.0mL sterile centrifuge tube, and extracting genomic DNA by adopting an improved CTAB (cetyltrimethyl ammonium bromide) method: s1, adding sterilized steel balls and 0.5mL of CTAB lysate into the centrifugal tube added with the hyphae, processing for 3 minutes under the condition of a high-flux tissue grinder 50Hz after balancing, repeating for 4 times, adding 0.5mL of the CTAB lysate into the centrifugal tube after grinding, and uniformly mixing; s2, fixing the uniformly mixed centrifuge tube on a foam board, then placing the centrifuge tube in a water bath at 65 ℃ for 30 minutes, and turning the centrifuge tube 1 time every 10 minutes; s3, centrifuging for 10 minutes at 12000 rpm under the normal temperature condition, and taking 0.8mL of supernate to a new 2mL sterile centrifuge tube after the centrifugation is finished; s4, adding phenol chloroform isoamyl alcohol with the volume ratio of 25:24:1 and the pH value of more than 7.8, fully and uniformly mixing, centrifuging for 10 minutes at the normal temperature at 12000 rpm, and taking 0.6mL of supernate into a new 2mL sterile centrifuge tube; s5, adding 0.6mL of phenol chloroform isoamyl alcohol with the volume ratio of 25:24:1 and the pH value of more than 7.8, and re-extracting; after fully and uniformly mixing, centrifuging for 10 minutes at the normal temperature by 12000 rpm, and taking 0.4mL of supernatant into a new 1.5mL sterile centrifuge tube; s6, adding 0.4mL of isopropanol and 1/10 volume of 3.0M sodium acetate, and placing the mixture in a refrigerator at the temperature of-20 ℃ for precipitation for more than 30 minutes; s7, centrifuging at 12000 rpm for 10 minutes at normal temperature, removing supernatant, adding 1.0mL of 70% ethanol to wash precipitated DNA, and repeating twice; s8, inverting the centrifuge tube on a dry paper towel, sucking the liquid on the inner wall of the centrifuge tube as much as possible, and then placing the centrifuge tube on a constant-temperature mixer at 55 ℃ for drying; s9, adding 80 mu l of sterile water into the centrifugal tube, and standing overnight at 4 ℃ to fully dissolve the DNA precipitate; s10, taking 3.0 mu l of DNA sample to carry out 1.0% agarose gel electrophoresis detection; s11, storing the DNA sample at-20 ℃;
step three, primary screening of STR primers and product detection: in the results of the whole genome STR scanning and primer design, 200 pairs of primers are randomly selected from different scaffolds, the specificity of the primers in the genome is detected through local Blast, the primers are synthesized, 8 Arthrosporium oligospora strains are randomly selected for PCR amplification, and polymorphism of STR amplification products is detected through polyacrylamide gel electrophoresis; after the pre-experiment, selecting 20 pairs of primers with better polymorphism as selected STR primers, adding different fluorescent labels to the forward primers when synthesizing the selected STR primers, and then carrying out PCR amplification on all samples;
step four, analyzing the genetic diversity based on the STR data: analyzing genetic diversity of a 198 Arthrospora oligospora sample isolated from China; and importing the STR data into an R program package ' poppr ' to calculate a Bruvo's distance matrix, and importing the distance matrix result into MEGA6.0 to construct a UPGMA tree.
2. The STR molecular marker for Arthrobotrys oligospora predatory fungi of claim 1, which is characterized in that: in step one, the conditions for primer design are as follows: the length of the primer is between 20 and 23 bp; the annealing temperature is 60 ℃; the length of the amplified sequence is between 130bp and 250bp, and the core unit comprises tandem repeat of 2-4 bases.
3. The STR molecular marker for Arthrobotrys oligospora predatory fungi of claim 1, which is characterized in that: in step three, 25 μ L of PCR amplification reaction system was: 1 μ L of template at 50 ng/. mu.L; 25mM MgCl22.5 mu L; 1 μ L of 10mM dNTPs; 1 μ L of each 10 μ M forward and reverse primers; DNASTaq enzyme 0.25 μ L at 5U/. mu.L; 10 XPCR reaction buffer 2.5. mu.L; deionized water 15.8. mu.L.
4. The STR molecular marker for Arthrobotrys oligospora predatory fungi of claim 1, which is characterized in that: in step three, the PCR amplification reaction procedure is as follows: pre-denaturation at 94 ℃ for 5 min, denaturation at 94 ℃ for 30 sec, annealing at 60 ℃ for 30 sec, extension at 72 ℃ for 30 sec, 30 cycles in total, and final extension at 72 ℃ for 5 min; the amplified product is loaded, electrophoresis detection is carried out in 1.0% agarose gel and 1 xTBE electrophoresis solution, and the PCR product is sent to relevant units for genotyping.
5. The STR molecular marker for Arthrobotrys oligospora predatory fungi of claim 1, which is characterized in that: in step four, the typing results of 20 STR sites in all samples showed that the number of alleles per site was 3 (site A3) to 21 (site a191), 9.4 on average, and the polymorphism information content (polymorphism information content pic) ranged from 0.244(A3) to 0.858(a191), according to the STR molecular marker polymorphism information content partition criteria: of the 20 pairs of STR loci, 13 pairs have a high level polymorphism (PIC >0.5), 6 pairs have a medium level polymorphism (0.5> PIC >0.25), only 1 pair has a low level polymorphism (PIC >0.25), and the 20 pairs have a high overall polymorphism.
6. The STR molecular marker for Arthrobotrys oligospora predatory fungi of claim 1, which is characterized in that: in step four, the UPGMA tree results show that: all samples were branched independently on the UPGMA tree, and the polymorphic information in 20 sites has distinguished 198 samples.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111039221.6A CN113604602B (en) | 2021-09-06 | 2021-09-06 | STR molecular marker of nematophagous fungi Arthrobotrya oligospora |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111039221.6A CN113604602B (en) | 2021-09-06 | 2021-09-06 | STR molecular marker of nematophagous fungi Arthrobotrya oligospora |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113604602A true CN113604602A (en) | 2021-11-05 |
| CN113604602B CN113604602B (en) | 2023-03-24 |
Family
ID=78310134
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111039221.6A Active CN113604602B (en) | 2021-09-06 | 2021-09-06 | STR molecular marker of nematophagous fungi Arthrobotrya oligospora |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113604602B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063761A (en) * | 2015-09-02 | 2015-11-18 | 云南大学 | Method for identifying predator nematophagous hyphomycete arthrobotrys through DNA bar codes |
-
2021
- 2021-09-06 CN CN202111039221.6A patent/CN113604602B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063761A (en) * | 2015-09-02 | 2015-11-18 | 云南大学 | Method for identifying predator nematophagous hyphomycete arthrobotrys through DNA bar codes |
Non-Patent Citations (2)
| Title |
|---|
| DUANYONG ZHOU等: "Historical Differentiation and Recent Hybridization in Natural Populations of the Nematode-Trapping Fungus Arthrobotrys oligospora in China", 《MICROORGANISMS》 * |
| 李娟等: "丝状真菌遗传转化系统研究进展", 《江西农业大学学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113604602B (en) | 2023-03-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hartmann et al. | Validation of microarray‐based resequencing of 93 worldwide mitochondrial genomes | |
| JP2818486B2 (en) | Method for distinguishing nucleic acids based on nucleotide differences | |
| CN105695572B (en) | Method for developing molecular markers in large scale and efficiently based on Indel and SSR site technology | |
| CN107988353B (en) | A kind of mankind MTHFR and/or MTRR genetic polymorphism detection kit | |
| EP2341151A1 (en) | Methods for determining sequence variants using ultra-deep sequencing | |
| WO2014116729A2 (en) | Haplotying of hla loci with ultra-deep shotgun sequencing | |
| US20150379195A1 (en) | Software haplotying of hla loci | |
| CN104328182A (en) | Primer, probe, locked nucleic acid probe, kit and detection method for detecting PDGFRA gene hotspot mutation | |
| CN117730163A (en) | Dilated cardiomyopathy gene detection marker and application thereof | |
| CN107988385B (en) | Method for detecting marker of PLAG1 gene Indel of beef cattle and special kit thereof | |
| CN110846408A (en) | Primer combination for detecting TTN gene mutation and application thereof | |
| WO2012099397A2 (en) | Method for determining the single nucleotide polymorphism of target genes using a real-time polymerase chain reaction, and kit for determining the single nucleotide polymorphism of target genes using same | |
| CN113502335A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN107937493B (en) | Hairpin modified primer for allele PCR | |
| CN114438233B (en) | Synchronous typing detection system of X chromosome Multi-DIP for genetic relationship identification | |
| CN106191253A (en) | Beijing duck based on GBS technology simplifies gene order surveying method | |
| CN113604602B (en) | STR molecular marker of nematophagous fungi Arthrobotrya oligospora | |
| CN113373241B (en) | Microsatellite marker of fishes in loach, and amplification primer and application thereof | |
| CN106755422B (en) | Detection method of MEG3 gene SNP related to cattle growth traits and application thereof | |
| CN112430675B (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288474.1-322717 | |
| CN108624686A (en) | A kind of probe library, detection method and the kit of detection BRCA1/2 mutation | |
| Faria et al. | Molecular tools for species discrimination and detection of hybridization between two closely related Clupeid fishes Alosa alosa and A. fallax | |
| CN112210607B (en) | Molecular marker related to buffalo white hair phenotype and application thereof | |
| CN112410441A (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288479.1-95621 | |
| CN108486274B (en) | Molecular marker related to content of feruloyl arabinoxylan in wheat grains |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |