CN113604442B - Sargassum sterol synthetase and preparation method and application thereof - Google Patents

Abstract

The invention relates to the technical field of biology, in particular to a sargasterol synthetase, a preparation method and application thereof. The sargasterol synthetase provided by the invention can be used for efficiently synthesizing sargasterol through one-step enzyme reaction. This approach is completely different from other SHPs synthetic pathways known to be dependent on hydroxylating enzymes, such as the enzymatic meso-or autoxidation in vitro gulfweed sterol synthetic pathway. The method for synthesizing the sargasterol by using the sargasterol synthetase lays a foundation for preparing the side chain hydroxylated phytosterol by using a green enzymology method, a metabolic engineering method and a synthetic biology method, and has important practical significance for treating atherosclerosis, diabetes, alzheimer disease and tumors.

Description

Sargassum sterol synthetase and preparation method and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a gulfweed sterol synthetase, a preparation method and application thereof

Background

Phytosterols can reduce the risk of cardiovascular disease by lowering cholesterol. In addition, phytosterols have good antioxidant properties and can be used as food additives (antioxidants, nutritional additives); can also be used as raw material of animal growth promoter for promoting animal growth and promoting animal health. Therefore, phytosterols are widely used in the fields of food, medicine, cosmetics, animal growth agents, and the like. It is expected that by 2020, global phytosterol related production values will reach billions of dollars.

The sargasterol belongs to side chain hydroxylated phytosterols (SHP), and has a wide range of physiological activities. Can be used for treating diseases related to Liver X Receptors (LXRs), such as atherosclerosis, diabetes, alzheimer disease or tumor (Liu Gongbing, etc., application of sargasterol, grant No. CN102861023B; zhen Chen, etc., 24 (S) -saringosterol from edge margin search adopted by Zhen Chen, etc.)Sargassum fusiforme is a novel selective LXRβ agonist, 2014, Journal of Agricultural and Food Chemistry62 (26), pages 6130-6137). In addition, sarasterol has been shown to bind to tubercle bacillus, mycobacteria (see Gerald A Wachter et al, inhibition of BacillusMycobacterium tuberculosis growth by saringosterol from Lessonia nigrescens，Journal of Natural Products2011, 64 (11), pages 1463-1464), trypanosoma brucei (see Sara Hoet al, antibiotic activity of triptycenes and sterols from the leaves of the sameStrychnos spinosaand related compounds,2007, journal of Natural products,70 (8), pp.1360-1363), obesity (see Jung A Lee et al, anti-obesity activity of saningosisterol isolated fromSargassum muticum (Yendo) fensholt extract in 3T3-L1 Cells，2017，Phytotherapy Research31 (11), pages 1694-1701), depression (see Hongguo Jin et al, anti-pressed-like effects of saringosterol, a sterol fromSargassum fusiforme by performing in vivo behavioral tests，2017，Medicinal Chemistry Research26 (5), pages 909 to 915), osteosarcoma (see Gyuwon Huh et al, polysaccharides from Hizikia fusiformis and the hair promotion activities on osteonosocomcoma-derived cell MG63, 2012,Journal of The Korean Society for Applied Biological Chemistry55 (4), pp 551-555), alzheimer's disease (see Bogie, J., hoeks Dietary et al, sargassum fusiforme improvememoiy and processes amplified plant load in an Alzheimer's disease model,2019,Scientific Reports9 (1), page 4908), etc., have a significant inhibitory effect. Meanwhile, the sargasterol can be used as a precursor compound to synthesize various high-value steroid compounds.

The biosynthesis mechanism of sargasterol and the involved enzyme and enzymatic reaction mechanisms are not fully elucidated, so that the large-scale production of sargasterol by means of biosynthesis is impossible. At present, the production mode of sargasterol is to convert iso-fucoidin or fucosterol derived from algae into sargasterol by an enzymatic oxidation or autooxidation method. However, this method has the disadvantages of poor stability and difficulty in handling. Therefore, a new method for producing sargasterol in a large scale is needed.

Disclosure of Invention

In view of the above, the invention provides a sargasterol synthetase, a preparation method and an application thereof. The sargasterol synthetase can catalyze a specific substrate to be combined with an S-adenosine-L-methionine (AdoMet) methyl group and a hydroxyl group of a water molecule to form the sargasterol in one step, can realize large-scale production of the sargasterol, and has simple and easy operation steps.

The invention provides a sargasterol synthetase, the amino acid sequence of which is shown as SEQ ID NO. 1; or an amino acid sequence obtained by substituting, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO. 1.

In some embodiments, the amino acid sequence of the sargasterol synthase of the present invention is set forth in SEQ ID NO 1.

Sources of sargasterol synthase according to the present invention include, but are not limited to, algae, plants, trypanosomes, and amoeba.

In one embodiment, the invention provides a method for producing a compound of formula (I) by extractionChlamydomonasThe sp, MEM-52 cDNA is taken as a template, the sequences shown in the primers SEQ ID NO. 3 and SEQ ID NO. 4 are taken as primers, PCR amplification is carried out, and the DNA molecule with the sequence shown in SEQ ID NO. 2 and used for encoding the sargasterol synthetase is obtained.

The invention also provides a preparation method of the sargasterol synthetase, which comprises the following steps: constructing a recombinant vector containing a DNA molecule for coding the sargasterol synthetase, transforming the recombinant vector into host bacteria, and obtaining the sargasterol synthetase through induced expression, separation and purification.

In the preparation method of the sargasterol synthetase provided by the invention, the host bacterium is escherichia coli.

The invention also provides a DNA molecule for encoding the sargasterol synthetase, and the nucleotide sequence of the DNA molecule is shown as SEQ ID NO. 2.

The invention also provides a recombinant vector containing the DNA molecule of the sargasterol synthetase.

In some embodiments, the base vector of the recombinant vector is an e. Wherein, the Escherichia coli expression vector is preferably pET series vectors, and is more preferably pET-28a vectors; the yeast expression vector is preferably a pYES vector.

The invention also provides a host bacterium transformed with the recombinant vector.

In a specific embodiment, the host bacterium is E.coli. In one embodiment, the host bacterium is a yeast, preferably saccharomyces cerevisiae.

The invention also provides application of the sargasterol synthetase in preparation of sargasterol.

The invention also provides a preparation method of sargasterol, which comprises an in vitro synthesis method and an in vivo biosynthesis method.

Wherein, the in vivo biosynthesis method comprises the following steps:

constructing a recombinant vector containing a DNA molecule shown in SEQ ID NO. 2, transforming the recombinant vector into host bacteria, carrying out induced expression, centrifugally collecting bacteria, and extracting the sargasterol.

In some embodiments, the host bacterium is a steroid accumulating host bacterium. The steroid compound includes, but is not limited to, steroid compounds having conjugated double bonds in the side chains, and in some embodiments, the steroid compound is 24 (28) -dehydroergosterol. Host bacteria include, but are not limited to, yeast, and in some embodiments, the host bacteria are Saccharomyces cerevisiae. In a specific embodiment, the host bacterium is Saccharomyces cerevisiae that accumulates 24 (28) -dehydroergosterol, i.e., a yeast mutant strain Δ ERGX that accumulates 24 (28) -dehydroergosterol.

In a specific embodiment, the in vivo biosynthesis comprises the steps of:

constructing a recombinant vector containing a DNA molecule shown in SEQ ID NO. 2, converting and accumulating a saccharomyces cerevisiae mutant strain delta ERGX of 24 (28) -dehydroergosterol by the recombinant vector, performing induced expression by an induction culture medium, centrifuging and collecting thalli, and extracting the sargasterol.

Wherein the YPD medium formula is as follows: yeast extract 10g/L, peptone 20 g/L, glucose 20 g/L. If a solid culture is prepared, agar is added to a final concentration of 2% prior to autoclaving.

The formula of the basic culture medium is as follows: 0.67% Yeast Nitrate Base (YNB), 2% glucose, 0.074% Do Supplement (-Ura), autoclaved.

The induction culture medium is as follows: 0.67% Yeast Nitrate Base (YNB), 2% galactose, 1% raffinose, 0.074% Do Supplement (-Ura), autoclaved.

The in vitro synthesis method comprises the following steps: catalyzing by steroid compound, S-adenosine-L-methionine and water-borne sargasterol synthetase to obtain sargasterol.

In some embodiments, the side chain of the steroid compound has a conjugated double bond.

Compared with the prior art, the invention has the following remarkable characteristics and positive effects:

(1) The invention discovers a synthetic mechanism of sargasterol depending on sargasterol synthetase, which is completely different from other SHPs synthetic routes which are known to depend on hydroxylating enzyme. The explanation of the mechanism provides theoretical support and a technical platform for large-scale preparation of sargasterol by utilizing a green enzymology method, a metabolic engineering method and a synthetic biology means.

(2) The yeast for transforming and accumulating 24 (28) -dehydroergosterol by the sargasterol synthase gene can be used for producing the sargasterol in a large scale, and provides a reference basis for metabolic modification for producing the sargasterol in other species and optimization of production efficiency by adopting a synthetic biology means.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 is a chemical structure of a representative sterol in a species to which the present invention relates for the synthesis of sargasterol; 1. fucosterol; 2. cholesterol; 3.24 (S) -saringosterol, 4.24 (R) -saringosterol, 5 ergosterol; ergosta-5,7,22,24-tetraenol;7. stigmasta-5,7,22-tien-3,24 (S) -diol, and 8 Stigmasta-5,7,22-tien-3,24 (R) -diol;

FIG. 2 is a catalytic mechanism for the synthesis of sargasterol synthase found in the present invention;

FIG. 3 is a schematic diagram of the construction of the present invention using a transformation vector;

FIG. 4 shows the GC-MS detection of metabolites of yeast engineered cells expressing a sargasterol synthase; e-1, ergosta-5,7,22,24 (28) -tetraenol, E-2, stigmasta-5,7,22-tien-3,24 (S) -diol, and E-3, partial mass of Stigmasta-5,7,22-tien-3,24 (R) -diol.

Detailed Description

The invention discloses a sargasterol synthetase, a preparation method and application thereof, and a person skilled in the art can appropriately improve process parameters by referring to the content. It is specifically noted that all such substitutions and modifications will be apparent to those skilled in the art and are intended to be included herein. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The sargasterol synthetase, the preparation method and the raw materials and reagents used in the application of the sargasterol synthetase are all commercially available.

The invention is further illustrated by the following examples:

example 1 analysis of the steroid profile of discovered species of sargasterol synthase according to the present invention

The discovered species of sargasterol synthase, designated as MEM-52, was inoculated into the culture medium and cultured to the logarithmic growth phase. After cell collection, vacuum freeze drying, GC-MS analysis of steroid composition after total lipid extraction. The steroid extraction method is described in Lu et al, regulation of the cholesterol biosynthesis pathway and its integration with a fatty acid biosynthesis in the multiphase microalgaNannochloropsis oceanic, 2014, Biotechnology for Biofuels, 7:81. Detecting by using an Agilent6890N gas chromatograph, using an FFAP column, and performing split ratio: 20: 1; sample inlet temperature: 250. c, ° C; column temperature: 150. temperature programming at 230-230 ℃; detector temperature: 250. c, ° C; temperature of the gasification chamber: 350. c, ° C; tail blowing: 40 mL/min; hydrogen flow rate: 45 mL/min; air flow rate: 450 mL/min; a detector: a hydrogen Flame Ionization Detector (FID); sample injection amount: 1.μ L, which is performed according to the instruction manual of the apparatus (Zhou W et al, cholesterol import failures to predictive analysis inhibition of Cholesterol synthesis and cell promotionTrypanosoma bruceiJ Lipid Res 2007, 48: pages 665-673).

Example 2 in vitro enzymatic reaction and detection of Sargasterol

The following primers SEQ ID NO 3 and SEQ ID NO 4 were designed and synthesized.

SEQ ID NO:3 ：ATGGCAGTTGCTTTGCCCGC；

SEQ ID NO:4 ：TTTTTTTTTATCAGCACCTGG。

MEM-52 is cultured to logarithmic growth phase, RNA is extracted, cDNA is obtained by reverse transcription, PCR amplification is carried out by primers SEQ ID NO. 1 and SEQ ID NO. 2, and the reaction program is as follows: 94 ^o Pre-denaturation for 5 min; 94 ^o C 30 sec，58 ^o C 30 sec，72 ^o C1 min, 30 cycles; 72 ^o C7 min extension. The PCR amplification product is sargasterol synthetase gene (Saringosterol synthsase, SS), and the PCR product is purified and connected with pET-28a vector to obtain pET-28a-SS. The above-mentioned ligation products were transferred to competent cells E.coli BL21 by heat shock transformation, plated on LB screening plates (containing 50. Mu.g/mL kanamycin), and cultured overnight at 37 ℃. The monoclonal was picked from the plate and verified with primers SEQ ID NO 3 and SEQ ID NO 4 to obtain a positive clone, named E.coli-SS engineered cell.

coli-SS clones positive were plated on plates (containing 50. Mu.g/mL kanamycin) for activation. A single colony was inoculated into 50mL of LB medium (tryptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L, pH 7.0) in a 250mL Erlenmeyer flask, and fermented at 28 ℃ with shaking at 200 rpm. After culturing to a logarithmic phase, the cells were collected by centrifugation, the supernatant was removed, and the cells were washed 3 times with a sodium phosphate buffer (50 mM, pH 8.0). Resuspending in sodium phosphate buffer, and ultrasonically disrupting cells to obtainCell homogenate, 4 ^o And C, storing for later use.

Preparation of 24 (28) -dehydroergosterol Compound the 24 (28) -dehydroergosterol compound was dissolved with DMSO to 1 mg/mL.

To 100. Mu.L of the cell homogenate prepared above, a 1 mM 24 (28) -dehydroergosterol solution was added. Meanwhile, a reaction solution in which DMSO was added to the cell homogenate was set as a control. 25 ^o C, reacting overnight.

After the reaction is finished, vortex shaking is carried out, after standing for 20 minutes at room temperature, butanone is added for extraction, and then standing and layering are carried out. And after the butanone extraction liquid is separated from the water phase, sucking the supernatant extraction liquid, evaporating butanone by using a rotary evaporator, dissolving residues in methanol to form a sample, and performing gas chromatography-mass spectrometry (GC-MS) detection.

Steroid extraction and determination methods reference Lu et al, regulation of the cholesterol biochemical pathway and its integration with a fatty acid biochemical in the multiphase microbial gaNannochloropsis oceanic, 2014, Biotechnology for Biofuels, 7:81. As shown in FIG. 2, the compound produced by the wild type bacterium was 24 (28) -dehydroergosterol. colii-SS engineered cells produce sargasterol.

Example 3 construction of engineered Yeast for synthesizing Sargasterol and metabolite detection

Preparation of a reagent:

10 XTE solution: 100 mM Tris,10 mM EDTA, pH 7.5.1.21 Dissolving Tris base and 0.37 g EDTA in 90 mL deionized water, adjusting pH to 7.5 with HCl, diluting to 100 mL, filtering, sterilizing, and storing at room temperature.

10 × LiAc solution: 10.2 Dissolving lithium acetate in 90 mL deionized water, adjusting pH to 7.5 with glacial acetic acid, diluting to 100 mL, filtering, sterilizing, and storing at room temperature.

Salmon sperm DNA (10 mg/mL,100 ×): salmon sperm DNA 30 mg, dissolved in 12 mL TE,4 ℃ overnight; ultrasonic crushing, 30 s X3/4 power, 2 times; electrophoresis detection, size about 7 Kb; subpackaging into 2 EP tubes of 50mL, each tube of 6 mL, adding 6 mL saturated phenol, centrifuging at 10,000 g and 4 ℃ for 5 min, and transferring the supernatant to a new EP tube; adding an equal volume of phenol/chloroform/isoamyl alcohol (25; adding equal volume of chloroform, 10,000 g,4 ℃, centrifuging for 5 min, collecting supernatant in the same EP, adding 1/10 volume of 3M NaAc and 2.5 times volume of absolute ethyl alcohol, and adding 30 min at-20 ℃; centrifuging at 12,000 rpm,4 ℃ for 15 min; washing with 70% ethanol, drying to half dry, and dissolving with 2.5 mL TE; measuring OD, and adjusting to 10 mg/mL; boiling for 20 min, immediately freezing, subpackaging, and storing at-20 deg.C for use.

Wild type Saccharomyces cerevisiae (A)Saccharomyces cerevisiae) Spread on YPD medium (yeast extract 10g/L, peptone 20 g/L, glucose 20 g/L. If solid cultures are prepared, agar is added to a final concentration of 2%) plates for activation before autoclaving. Constructing and obtaining a mutant strain delta ERGX accumulating 24 (28) -dehydroergosterol by a homologous recombination mode. The sargasterol Synthase gene (Saringosterol synthsase, SS) was ligated into an expression cassette driven by GAL1 promoter to obtain yeast expression vector pYES-SS (fig. 3). The monoclonal yeast mutant strain Δ ERGX was picked up in 10 mL YPD medium at 30 ℃ and 250 rpm overnight. OD600 was measured and transferred to 50mL YPD medium to give initial OD600=0.4 and about 5X 10 cell number ⁶ . Further culturing for 2-4 hr to make OD600 to 1.3-1.5 and cell count about 2X 10 ⁷ . The cells were centrifuged at 2,500 rpm for 5 min in a large centrifuge tube, collected and suspended in 40 mL of TE (10 XTE solution was diluted 10-fold with deionized water). 2,500 rpm, centrifuged for 5 min, the supernatant removed, and the resuspension in 2 mL of 1 × LiAc/0.5 TE. Standing at room temperature for 10 min, boiling ssDNA for 5 min, rapidly cooling by ice, sequentially adding 1 mug pYES-SS plasmid, 100 mug pre-denatured salmon sperm DNA,100 mug delta ERGX yeast suspension, 700 mug L1 xLiAc/40% PE3350/1 xTE, and violently oscillating for about 1 min. 30. 30 min,88 μ L DMSO,42 ℃ 7 min (or longer 20-25 min). Centrifuge at 2,500 rpm for 5 min, remove supernatant, resuspend in 200 μ L1 × TE. Plates were plated on selection plates SC-Ura and incubated at 30 ℃ for 2-3 days until transformants grew.

5 mL of YPD medium was inoculated with a yeast single strain containing a plasmid carrying the objective gene30 ℃ at 250 rpm,12 to 16 h, and not more than 16 h. Centrifuge at 2,000 rpm for 3 min, decant the supernatant, and add 0.5 mL of 1.2M sorbitol buffer (0.1M sodium phosphate buffer 1.2M sorbitol). Adding snailase 40 μ L10 mg/mL, lyticase in water bath 2 h or 50U at 37 ℃, mixing, shaking at 220 rpm,30 ℃,1 h. Centrifuging at 5,000 rpm for 10 min, removing supernatant to obtain protoplast, and extracting DNA with plasmid extraction kit. The detection of the positive clone of the engineering yeast strain can also adopt a boiling and freezing method: centrifuging to collect yeast, and adding 500 mu L PBS to resuspend and precipitate; centrifuging, collecting, and adding 100 muL TE; boiling in boiling water for 10 min, freezing at-80 deg.C for 30 min, and boiling in boiling water for 10 min; centrifuging, and taking 1-2 muL of water phase as a template for PCR detection. Taking 1 mu L plasmid as a template, and carrying out PCR detection by using primers SEQ ID NO:1 and SEQ ID NO: 2. Obtaining positive clonesS. cerevisiae-SS。

Picking monoclonal delta ERGX andS. cerevisiae-SS to SC-Ura liquid medium, and shake overnight at 30 ℃. OD600 was measured and transferred to 50mL induction medium with initial OD600= 0.4. 30. Culturing at 15 deg.C when the density of yeast reaches 5 × 106 cells/mL, culturing at 48 h, centrifuging, collecting thallus, and washing with deionized water several times until it is clean. The thallus is freeze-dried in vacuum, ground into powder under the condition of liquid nitrogen, and frozen for storage. The steroid compound extraction method is described in Lu et al, regulation of the cholesterol biosynthesis pathway and its integration with the fatty acid biosynthesis in the oleic microalgaNannochloropsis oceanic, 2014, Biotechnology for Biofuels, 7:81. Detecting by using an Agilent6890N gas chromatograph, using an FFAP column, and performing split ratio: 20: 1; sample inlet temperature: 250. c DEG; column temperature: 150. temperature programming at 230-230 ℃; detector temperature: 250. c, ° C; temperature of the gasification chamber: 350. c, ° C; tail blowing: 40 mL/min; hydrogen flow rate: 45 mL/min; air flow rate: 450 mL/min; a detector: a hydrogen Flame Ionization Detector (FID); sample introduction amount: 1. mu.L, the specific operation is performed according to the instruction of the apparatus (Zhou W et al, cholesterol import failures to predictive analysis inhibition of Cholesterol synthesis and cell promotion ofTrypanosoma bruceiJ Lipid Res 2007, 48: pages 665-673). The results are shown in figure 4 of the drawings,S. cerevisiae-SS produces compounds E2 and E3 containing sargasterol.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and amendments can be made without departing from the principle of the present invention, and these modifications and amendments should also be considered as the protection scope of the present invention.

Sequence listing

<110> university of Hainan

<120> sargasterol synthetase, preparation method and application thereof

<130> MP2026959

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 387

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Ala Val Ala Leu Pro Ala Ala Val Thr Ser Ala Tyr Glu Arg Leu

1 5 10 15

Ala Gly Glu Phe Asp Lys Leu Ser Thr Thr Gln Lys Tyr Ala Val Gly

20 25 30

Ile Ala Gly Gly Val Thr Ser Leu Tyr Leu Leu Ala Lys Val Leu Lys

35 40 45

Gly Ser Asp Arg Asp Lys Pro Thr Thr Leu Gln Leu Ser Gly Gly Ser

50 55 60

Ile Asp Ser Ser Lys Val Lys Asp Glu Phe Thr Ala Tyr Ala Asp Ser

65 70 75 80

Tyr Gly Lys Asn Ala Gly Glu Gly Ile Thr Asp Arg Ser Lys Thr Val

85 90 95

His Leu Val Asp Val Phe Tyr Ser Leu Val Thr Asp Ile Tyr Glu Trp

100 105 110

Gly Trp Gly Gln Ser Phe His Phe Ser Pro Lys Leu Pro Asn Lys Asp

115 120 125

Leu Lys Ala Ser Glu Ala Ala His Glu Ala Arg Ile Ala Ala Leu Leu

130 135 140

Arg Leu Gln Pro Gly Gln Lys Ala Leu Asp Cys Gly Cys Gly Val Gly

145 150 155 160

Gly Pro Met Arg Thr Val Ala Ala Val Ser Gly Ala His Ile Thr Gly

165 170 175

Ile Thr Ile Asn Gln Tyr Gln Val Asp Arg Ala Lys Thr His Asn Ala

180 185 190

Arg Gln Gly Leu Ala Pro Leu Thr Asp Val Val Arg Gly Asp Phe Thr

195 200 205

Asn Met Pro Phe Lys Glu Asn Thr Phe Asp Gly Ala Tyr Ala Ile Glu

210 215 220

Ala Thr Cys His Ala Pro Lys Leu Glu Gln Val Tyr Gly Glu Ile Tyr

225 230 235 240

Arg Val Leu Lys Pro Gly Ser Tyr Phe Val Ser Tyr Glu Trp Val Ser

245 250 255

Thr Gln Lys Phe Asp Val Asn Asn Ala Glu His Val Lys Ile Met Asp

260 265 270

Glu Ile Asn Phe Gly Asn Gly Leu Pro Glu Met Arg Thr Trp Lys Glu

275 280 285

Ala Glu Asp Ala Gly Lys Asn Val Gly Phe Glu Leu Val Met Ser Leu

290 295 300

Asp Leu Ala Thr Ala Ser Val Val Ala Gly Pro Trp Tyr Glu Arg Leu

305 310 315 320

Arg Met Gly Lys Tyr Thr His Ala Ile Asn His Gly Ile Val Ser Thr

325 330 335

Val Asp Ala Leu Gly Leu Ala Pro Lys Gly Leu Lys Glu Val His His

340 345 350

Met Leu Val Glu Val Ala Lys Ser Leu Ile Gln Gly Gly Glu Ser Gly

355 360 365

Ile Phe Thr Pro Met His Leu Leu Leu Phe Arg Lys Pro Gly Ala Asp

370 375 380

Lys Lys Lys

385

<210> 2

<211> 1161

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggcagttg ctttgcccgc tgctgttact tcggcttatg aaagattggc tggtgagttt 60

gacaagttga gcaccactca aaaatacgct gttggtatcg ctggtggtgt tacttccttg 120

tatttgttgg ctaaagtttt gaagggatct gatagagata aacctactac tttgcagttg 180

agtggtggat ctatagatag ctctaaagtt aaagatgagt tcactgctta cgctgattct 240

tatggtaaaa atgctggtga aggtattact gataggtcaa aaactgttca tctagtggat 300

gtgttttata gcttggttac tgacatttat gagtggggtt ggggtcagag ttttcatttt 360

tctccaaaat tgccaaacaa ggacttgaag gcttcagaag ctgctcatga agctaggatt 420

gctgctttgt tgaggttgca gcccggtcaa aaagctcttg attgtggttg tggtgttggt 480

ggtccaatga gaacggtcgc tgctgtttct ggtgctcata ttactggtat tacgattaat 540

caataccagg ttgatagagc taaaactcat aatgctaggc aaggtttggc tcctttgact 600

gatgttgtta ggggtgattt tactaatatg ccatttaagg agaacacttt tgatggagct 660

tatgcaattg aagcaacttg tcacgctcca aaattggaac aagtttatgg tgagatttac 720

agggtgttga agccaggttc ttattttgtt agttacgaat gggtttctac gcaaaaattt 780

gatgttaata acgccgaaca tgttaaaata atggatgaaa ttaacttcgg caacggattg 840

cctgaaatga gaacttggaa agaggctgaa gatgctggaa aaaatgttgg ttttgaattg 900

gttatgtctt tggatttggc tactgcttct gttgttgctg gtccatggta tgaaagattg 960

agaatgggta aatatactca tgctattaat catggtattg tttctactgt tgatgctttg 1020

ggtttggctc caaaaggttt gaaagaagtt catcatatgt tggttgaagt tgctaaatct 1080

ttgattcaag gtggtgaatc tggtattttt actccaatgc atttgttgtt gtttagaaaa 1140

ccaggtgctg ataaaaaaaa a 1161

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggcagttg ctttgcccgc 20

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttttttttta tcagcacctg g 21

Claims (9)

1. A sargasterol synthetase has an amino acid sequence shown in SEQ ID NO. 1.

2. The method for preparing a sargasterol synthase according to claim 1, wherein a recombinant vector containing a DNA molecule encoding said sargasterol synthase is constructed, said recombinant vector is transformed into a host bacterium, and said host bacterium is induced, expressed, separated and purified to obtain the sargasterol synthase.

3. A DNA molecule encoding the sargasterol synthase of claim 1, having a nucleotide sequence shown in SEQ ID NO. 2.

4. A recombinant vector comprising the DNA molecule of claim 3.

5. A host bacterium transformed with the recombinant vector of claim 4.

6. The host bacterium according to claim 5, wherein the host bacterium is Escherichia coli or yeast.

7. The use of a steroid compound having a conjugated double bond in the side chain, S-adenosyl-L-methionine as a substrate for the preparation of a sargasterol according to claim 1;

the steroid compound is 24 (28) -dehydroergosterol.

8. The preparation method of sargasterol is characterized in that a recombinant vector containing a DNA molecule shown in SEQ ID NO. 2 is constructed, the recombinant vector is transformed into host bacteria, induced expression is carried out, thalli are collected by centrifugation, and the sargasterol is extracted;

the host bacteria are host bacteria for accumulating steroid compounds; the steroid compound is 24 (28) -dehydroergosterol.

9. A process for producing sargasterol, which comprises subjecting a steroid compound having a conjugated double bond in its side chain, S-adenosyl-L-methionine and water to the catalytic action of the sargasterol synthase according to claim 1 to obtain sargasterol;

the steroid compound is 24 (28) -dehydroergosterol.

Images