CN113584184B

CN113584184B - Molecular marker system for identifying authenticity of sugarcane hybrid and development method thereof

Info

Publication number: CN113584184B
Application number: CN202110891211.9A
Authority: CN
Inventors: 王凯; 禄小溪; 张会
Original assignee: Nantong University
Current assignee: Nantong University
Priority date: 2021-08-04
Filing date: 2021-08-04
Publication date: 2023-07-28
Anticipated expiration: 2041-08-04
Also published as: CN113584184A

Abstract

The invention relates to the technical field of bioinformatics and molecular genetic breeding, in particular to a molecular marker system for identifying the authenticity of sugarcane hybrids and a development method thereof, wherein homologous sequences of differences between species are selected and molecular marker primers are respectively designed by comparing whole genome DNA sequences of two parents of modern cultivated species of sugarcane, and 8 inter-species polymorphic molecular markers covering different chromosomes are selected after PCR (polymerase chain reaction) amplification and electrophoresis detection are carried out by adopting a plurality of tropical species and seed cutting dense species materials, and the marker system generates hybrid belts in hybrid F1. The polymorphic markers between the tropical seeds and the dense-cut seeds can detect the authenticity of the sugarcane hybrid seeds, and the markers can greatly reduce the true hybrid omission rate because the markers cover all chromosomes, and meanwhile, each marker has high conservation in the seeds, can be used for identifying the authenticity of hybrid offspring among different parent combinations, and has better universal applicability.

Description

Molecular marker system for identifying authenticity of sugarcane hybrid and development method thereof

Technical Field

The invention relates to the technical fields of bioinformatics and molecular genetic breeding, in particular to a molecular marker system for identifying authenticity of sugarcane hybrids and a development method thereof.

Background

Sugarcane is the most important sugar material and energy crop worldwide, and the sucrose yield of the sugarcane accounts for more than 80% of the world sucrose yield. Modern sugarcane cultivars are mainly crossed by tropical species with high sugar content and dense cut-hand species with strong stress resistance. However, both tropical species and cut dense species are polyploid plants, and the genome is complex. Tropical species are an octaploid containing 80 chromosomes (2n=8x=80); the genome of compact cut seed is more complex than that of the tropical seed, and the different materials (clone) often have different chromosome compositions. Currently, it has been found that the genome of cut dense seed material of up to nearly 40 different chromosome number types from 2n=40 to 2n=128 contains multiple ploidy types from tetraploid to dodecaploidy. Meanwhile, as the sugarcane flowers are conical inflorescences, the flower structures are small and more, and the manual emasculation is very difficult, so that the identification of the authenticity of hybrid progeny becomes key to the sugarcane hybrid breeding work. However, a hybrid authenticity identification method which is efficient and has universal applicability is not established so far, and development of sugarcane hybrid seed production work is severely restricted.

In recent years, attempts have been made to conduct screening work for hybrid authenticity by screening parent polymorphic marker methods. The principle is that PCR and electrophoresis detection are carried out between hybrid parents by adopting the existing molecular markers, so as to obtain the markers with polymorphism and detect the authenticity of the hybrid of the filial generation. This approach has three main problems: first, the number of available tags is very limited. The sugarcane genome is quite complex, the development of molecular markers is slow, and the markers used at present mainly come from molecular markers of materials such as sorghum and the like of closely related species, so that it is difficult to obtain enough numbers of polymorphic markers among parents. Secondly, the screening leakage is serious in the hybrid authenticity identification process. Because of the small number of markers, and in particular the uneven distribution of the markers, i.e. the markers obtained may originate from only a few chromosomal intervals, serious screening-missing situations may result during the hybrid authenticity identification process. For example, the crossing offspring will not carry the chromosome covered by the detection marker due to recombination, and will be considered as a false hybrid and eliminated, resulting in missed detection. Thirdly, the existing markers are poor in applicability and cannot be used as universal markers for hybrid authenticity utilization. For example, a marker may have polymorphisms between certain hybrid parental combinations, but not differences between other parental combinations, etc. This is mainly due to the fact that the markers are not screened intraspecies and do not have intraspecies conservation. These problems severely restrict the development of sugarcane hybrid seed production, so that the development of markers for two parent species of modern cultivated species of sugarcane is needed, and an inter-species polymorphic marker system which is conserved in the species and covers different chromosomes is established. The development of the polymorphic marker plays a great promotion role in identifying the authenticity of the sugarcane hybrid, and provides an important reference for developing sugarcane genetic breeding work.

Disclosure of Invention

The invention aims to solve the defects in the prior art, and provides a molecular marker system for identifying the authenticity of sugarcane hybrids and a development method thereof, which are characterized in that biological information analysis is adopted to carry out comparative analysis on genome sequences of two species to obtain differential DNA sequences, molecular marker primers are designed, and markers which are conserved in the species, polymorphic among the species and cover different chromosomes are screened after electrophoresis detection; the marker can greatly reduce the omission ratio, has higher applicability, and provides a reliable and efficient new method for identifying the authenticity of the sugarcane hybrid.

In order to achieve the above purpose, the present invention adopts the following technical scheme:

a molecular marker system for identifying the authenticity of sugarcane hybrids, which consists of 8 molecular markers which are from different chromosomes and have polymorphism between cut-hand dense species and tropical species, and are named SsCh1, ssCh2, ssCh3, ssCh4, ssCh5, ssCh6, ssCh7 and SsCh8 respectively; the nucleotide sequences of the amplification primers are respectively shown as SEQ ID NO. 1-16.

The invention also provides a development method of the molecular marker system for identifying the authenticity of the sugarcane hybrid, which comprises the following steps:

firstly, comparing tropical seed genome and cut dense seed genome by adopting a biological information analysis method to obtain homologous DNA sequences with difference;

step 2, designing primers according to the DNA sequences of the differences;

step 3, respectively adopting a plurality of tropical seed materials and cut-hand dense seed materials to carry out PCR amplification and polypropylene gel electrophoresis detection to obtain a mark with polymorphism among seeds and conservation in the seeds;

step 4, selecting 8 marks meeting the following standards: the markers are in different band types between two species, the markers have highly conserved band types between intraspecies materials, the markers come from different chromosomes, namely 1 marker is selected from each chromosome, and 8 markers in total are used as a hybrid authenticity identification marker system.

Preferably, in the step (3), the conditions for PCR amplification are: pre-denaturation at 95℃for 3min; denaturation at 95℃for 30s, annealing at 61℃for 30s, elongation at 72℃for 60s,28 cycles, and final elongation at 72℃for 10min.

Preferably, in the step (3), the PCR amplification reaction system is: the upstream and downstream primers were each 0.25. Mu.L, the DNA template 2. Mu.L, PCRMix 5. Mu.L, and finally ddH2O was added to make up the total volume to 10. Mu.L.

Preferably, in the step (3), the conditions for detecting polypropylene gel electrophoresis are as follows: the sample loading amount is 1ul, electrophoresis is carried out for 1h 40min by adopting a constant voltage of 180v, silver nitrate is adopted for dyeing for 15min after electrophoresis, and sodium hydroxide/formaldehyde is adopted for color development after ultrapure water cleaning.

Compared with the prior art, the invention has the following beneficial effects:

1. the developed mark is developed by comparing genome of tropical seed and dense seed of sugarcane, has stable amplification effect and clear band, and has better applicability to sugarcane materials.

2. The markers developed by the invention are distributed on different chromosomes, so that the genome coverage is good, and the true hybrid omission ratio can be greatly reduced.

3. The markers of the invention are detected to have a stable band type in the seeds, so that the markers are applicable to identifying the authenticity of the filial generation hybrids hybridized among different parent combinations, have high universality and are beneficial to popularization and application.

Drawings

FIG. 1 is a graph showing the results of electrophoresis of 8 markers developed by the present invention. M is molecular weight marker, lanes 1-19 are 19 cut-hand dense materials, lanes 20-26 are 7 tropical seed materials, and lane 27 is one cut-hand dense and tropical seed hybrid F1 material. Eight markers SsCh1-SsCh8 are marked in the upper left corner of the picture, respectively.

Detailed Description

The following technical solutions in the embodiments of the present invention will be clearly and completely described with reference to the accompanying drawings, so that those skilled in the art can better understand the advantages and features of the present invention, and thus the protection scope of the present invention is more clearly defined. The described embodiments of the present invention are intended to be only a few, but not all embodiments of the present invention, and all other embodiments that may be made by one of ordinary skill in the art without inventive faculty are intended to be within the scope of the present invention.

Example 1: homologous differential DNA sequence acquisition of tropical species and cut dense species

Repeated sequences in the tropical and cemetery seed genomes were filtered using the repeat mask software, then the genomes were broken into 50bp DNA sequences at 5 base intervals, and these short sequences were posted back to the genome, further verifying the genomic origin of the sequences. The two short sequences of genomic origin are aligned to each other by BLAST sequence alignment, thereby obtaining homologous and differential DNA sequences.

The invention uses whole genome sequence information, adopts repeat mask software to filter repeated sequences, and obtains differential DNA sequence information of two sugarcane whole genome levels through mutual comparison.

It should be noted that, the method of filtering the repetitive sequence and BLAST sequence alignment by using the repeater mask software is prior art, and is not a technical solution for the important protection of the present invention, so specific steps of the alignment are not described in detail herein.

Example 2: primer design and PCR amplification of differential DNA sequences

Primer design software Primer Premier 5.0 is used for carrying out Primer design on the differential DNA sequences, the Primer design requires the Primer length of 20+/-5 bp, and the Primer should be designed in the conserved regions at the two ends of the differential sequences.

The PCR reaction system is as follows: the primers were 0.25. Mu.L each, 2. Mu.L of DNA template, 5. Mu.L of PCRMix, and finally ddH2O was added to make up the total volume to 10. Mu.L.

The conditions for PCR amplification were: pre-denaturation at 95℃for 3min; denaturation at 95℃for 30s, annealing at 61℃for 30s, elongation at 72℃for 60s,28 cycles, and final elongation at 72℃for 10min.

Example 3: electrophoretic detection of PCR products

The electrophoresis adopted by the invention is polyacrylamide electrophoresis, and the flow is as follows:

1. and after the glue groove is installed, preparing polyacrylamide gel working solution (8% polyacrylamide, 300ul10%AP,60ul TEMED), and filling the working solution into the glue groove.

2. After gel fixation, 1 XTBE running buffer (10.8 g Tris,5.5g boric acid, 4mL EDTA (0.5M, pH 8.0), 80mL ultra pure water, and volume was set to 100 mL) was added.

3. The PCR product was added to 2ul of loading buffer and 1ul was spotted into the prepared gel spot wells.

4. Electrophoresis was performed for 100 minutes with a constant voltage of 180 v.

5. After the electrophoresis, the gel is discharged and put into a dyeing liquid (1L of pure water is added with 1g of silver nitrate for dissolution), and the gel is dyed for 15min by horizontal rotation on a shaking table.

6. The gel was rinsed twice with ultrapure water for 30s each.

7. Pouring the color development liquid (15 g sodium hydroxide, 3ml formaldehyde solution, using ultrapure water to fix volume to 1L), rotating the horizontal shaking table to develop color, pouring the color development liquid after the strip is clearly visible, and cleaning twice with the ultrapure water.

Referring to fig. 1, 8 markers of the present invention can be used to detect tropical species and cut dense species hybrid authenticity. Eight markers present distinct polymorphic bands between the two species and are highly conserved among different materials within the species (lanes 1-19 for the dense hand species; lanes 20-26 for the tropical species), while the F1 material (lane 27) presents a hybrid band.

The 8 marks have obvious different band patterns between the close species of the cut hand and the tropical species, and meanwhile, the band patterns of different materials in the respective species are basically consistent, so that the 8 marks have higher conservation. Also, a hybrid tape type can be detected in the hybrid F1, and a proof can be used to detect the authenticity of the hybrid.

The description and practice of the invention disclosed herein will be readily apparent to those skilled in the art, and may be modified and adapted in several ways without departing from the principles of the invention. Accordingly, modifications or improvements may be made without departing from the spirit of the invention and are also to be considered within the scope of the invention.

Claims

1. A molecular marker for identifying the authenticity of sugarcane hybrids, which is characterized by comprising 8 molecular markers which are from different chromosomes and have polymorphism between a cut-hand compact seed and a tropical seed, wherein the molecular markers are respectively named SsCh1, ssCh2, ssCh3, ssCh4, ssCh5, ssCh6, ssCh7 and SsCh8; the molecular marker is amplified by the following primer pairs, and the nucleotide sequences of the amplified primer pairs are respectively shown as follows:

SsCh1，SEQ ID NO. 1：AGCCAAGCCCAGAAATGA

SEQ ID NO. 2：AGGATGCGGTCGAGTGAA

SsCh2，SEQ ID NO. 3：GGGAAACAGCAATAAAAG

SEQ ID NO. 4：CAGAGCACTAATGACAAT

SsCh3，SEQ ID NO. 5：GCTGTGGTTAGGCTCCGT

SEQ ID NO. 6：AACTACTTAAGGTTTTGCT

SsCh4，SEQ ID NO. 7：GAACCAAGACCCAACCCTACAC

SEQ ID NO. 8：TGACCGTCACATCCTTGTCTCC

SsCh5，SEQ ID NO. 9：TAGTCCTATCAGCCGAGA

SEQ ID NO.10：GACCGCTTATTTGACCTC

SsCh6，SEQ ID NO. 11：CACGTGAAAACGAAACCTGC

SEQ ID NO. 12：TCGGATTACCCAGCGAATAA

SsCh7，SEQ ID NO. 13：CGTTGGCCTCTTGTGTCCTT

SEQ ID NO. 14：ACCCGTTCATTACTTCTTCG

SsCh8，SEQ ID NO. 15：ATGCACAATTATAGACATAGC

SEQ ID NO. 16：AAAGAGATATAGATGAAGCTG。