CN113584149A - Reagents and methods for detecting immune reconstitution status in HIV-infected subjects - Google Patents
Reagents and methods for detecting immune reconstitution status in HIV-infected subjects Download PDFInfo
- Publication number
- CN113584149A CN113584149A CN202110780911.0A CN202110780911A CN113584149A CN 113584149 A CN113584149 A CN 113584149A CN 202110780911 A CN202110780911 A CN 202110780911A CN 113584149 A CN113584149 A CN 113584149A
- Authority
- CN
- China
- Prior art keywords
- gene
- ifi6
- ifi27
- interferon
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The invention provides a primer group, a probe and a kit for expressing Interferon stimulated genes (IFI27 and IFI6) and application thereof in evaluating immune reconstitution conditions of AIDS infected persons.
Description
Technical Field
The invention relates to the field of detection of immune reconstitution status of an acquired immune deficiency syndrome (HIV) infected person, in particular to a primer group, a probe and a kit for expressing an interferon stimulation gene IFI27 and/or IFI6 and application of the primer group, the probe and the kit for detecting the immune reconstitution status of the HIV infected person.
Background
Antiviral treatment of AIDS effectively inhibits viral replication, but still 20-30% of treated infected individuals do not achieve effective reconstitution of immunity, and despite effective control of HIV viral load, CD4+T lymphocytes are always at a low level and these infected persons are called "immunocompromised persons". The incidence and mortality of these "non-AIDS related diseases" is much higher in these infected patients than in immune-responsive patients. At present, the immune reconstitution status of HIV infected people is not performed in early stage at home and abroadMaturation method of evaluation.
In the prior art, viral load and CD4+T cells, two of the conventional indicators used clinically to evaluate therapeutic efficacy, are not suitable for evaluating the immune reconstitution status of HIV-infected individuals. On the one hand, since HIV-infected patients who are involved in clinical therapeutic studies to improve the level of immune reconstitution have undergone long-term antiviral therapy, the viral load of these patients is already low and cannot be used to evaluate the efficacy of the novel therapeutic regimens. On the other hand, clinical evaluation of patient immune reconstitution mainly relies on CD4+T lymphocyte count, but most HIV-infected individuals have CD4 after treatment+The T cell number increases slowly and CD4 is hardly visible for a short time+The significant increase of T cells usually cannot be known after many years of treatment whether the patient is well immunocompromised or not, so that the CD4 is delayed for the patient+The auxiliary treatment of T lymphocyte reconstruction, and long-time observation can obviously increase the cost and seriously restrict the development of clinical experiments. To date, evaluation of CD4 in non-responders+The reconstruction level of T cells has no specific clinical detection index and effective clinical detection tool. Therefore, there is a need to establish a novel means for evaluating the immune reconstitution status.
Disclosure of Invention
The invention aims to provide a new means for detecting immune reconstitution status of AIDS infected persons. The inventor combines a humanized animal model with a clinical queue sample, screens and identifies Interferon Stimulated Genes (ISG) most relevant to the clinical curative effect of HIV through a flow cytometry sorting technology and an RNA-seq technology, uses the ISG as an index for evaluating nonspecific immune activation in HIV infectors, designs a specific primer group and a probe, selects an appropriate internal standard, establishes a clinically applicable real-time fluorescence quantitative PCR detection method, and provides a feasible new means for evaluating immune reconstitution conditions of the HIV infectors, thereby obtaining the invention.
Accordingly, in a first aspect, the present invention provides a primer set for an interferon stimulated gene IFI27, comprising:
IFI27 upstream primer: GGGAATCGCCTCGTCCTC (SEQ ID NO:1), and
IFI27 downstream primer: GTAGAACCTCGCAATGACAGC (SEQ ID NO: 2).
In a second aspect, the present invention provides a probe for the interferon stimulated gene IFI27, comprising:
IFI27 probe: CCCAGTGACTGCAGAGTAGCCACA (SEQ ID NO: 3).
In a third aspect, the present invention provides a primer set for an interferon-stimulated gene IFI6, comprising:
IFI6 upstream primer: TGATGAGCTGGTCTGCGA (SEQ ID NO:4), and
IFI6 downstream primer: ATCAGGGCACCAATATTACCTA (SEQ ID NO: 5).
In a fourth aspect, the present invention provides a probe for the interferon stimulated gene IFI6, comprising:
IFI6 probe: CTGCCACCAGCCCCGAGG (SEQ ID NO: 6).
In a fifth aspect, the present invention provides a kit for detecting the expression level of interferon-stimulated genes IFI27 and/or IFI6, the kit comprising:
-a primer set of the first and/or third aspect of the invention; and
-a probe according to the second and/or fourth aspect of the invention.
In a sixth aspect, the present invention provides the use of a detection agent for interferon stimulated genes IFI27 and/or IFI6 in the preparation of a reagent for the assessment of the immune reconstitution status of an HIV infected person.
The invention has the advantages that: the invention establishes a clinical detection technology capable of evaluating the immune activation level and immune reconstitution status of HIV infected persons in early treatment period such as 2-3 years after starting treatment by screening Interferon Stimulating Genes (ISG) most related to immune reconstitution of HIV and using the ISG as an index for evaluating nonspecific immune activation of the HIV infected persons, and is beneficial to finding that the immune reconstitution level is poor in the early antiviral treatment period of immune non-responders, thereby being capable of providing a timely and targeted treatment scheme for the immune non-responders.
Drawings
The technical solutions and benefits of the present invention will become apparent to those skilled in the art upon a reading of the following detailed description and a review of the associated drawings.
FIG. 1 shows the expression of interferon-stimulated genes Siglec1, MX2, IFI6, and IFI27 under interferon-stimulated conditions in a THP-1 cell model.
Fig. 2 shows the expression analysis of several hundred immune responders and immune non-responders by real-time fluorescent quantitative PCR detection of interferon stimulated genes IFI6 and IFI27 (p <0.05, p < 0.01).
FIG. 3 shows the expression analysis of several hundred of interferon-stimulated genes MX2 and Siglec1 of immune responders and immune non-responders by real-time fluorescent quantitative PCR detection method.
Detailed Description
The present invention is described in detail below. It is to be understood that the following description is intended to illustrate the present invention by way of example only and is not intended to limit the scope of the invention, which is defined by the appended claims. Also, it is understood by those skilled in the art that modifications may be made to the technical aspects of the present invention without departing from the spirit and gist of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
As described above, there is a need in the art for a means to assess the level of immune activation and immune reconstitution status of HIV-infected individuals in their early treatment, thereby providing a practical and targeted treatment regimen for immune non-responders.
Recent studies have shown that type I interferon (IFN-1) plays a key role in abnormal immune activation caused by HIV, but the expression level of interferon in peripheral blood of HIV-infected patients is low, and direct detection is difficult. However, interferons induce the expression of a range of interferon-stimulated genes (ISGs), the expression levels of which represent the activation levels of the interferon signaling pathway and have been shown in prior studies to correlate with aberrant immune activation and poor immune reconstitution in HIV-infected individuals. Interferon-treated HIV-infected individuals develop CD4+T lymphocyte depletion, blocking anti-reversalExogenous interferon in HIV-infected patients treated by retrovirus can increase CD4+T lymphocytes. In addition, there is a persistent abnormal expression of ISG in some immunocompromised individuals following antiretroviral therapy, indicating that the level of ISG expression is somewhat correlated with the immune reconstitution status following antiretroviral therapy.
For example, in studies of humanized mouse models of HIV infection, it was found that antiretroviral therapy with simultaneous blockade of type I interferon (IFN-1) can suppress nonspecific immune activation and restore immune cell function. After blocking interferon, CD4 of HIV-infected person+T lymphocytes are not decreased but increased. Thus, interferon levels can affect CD4 in infected subjects+Number of T lymphocytes. In clinical research, the therapeutic effect is positively correlated with the reduction of the activation of an interferon signal pathway when tripterygium wilfordii is used for treating people with poor immune reconstitution.
The research results show that the detection of the expression level of IFN-1 pathway molecules can evaluate the nonspecific immune activation level and the damage condition of immune functions, and further can evaluate the immune reconstitution condition of HIV infected persons in early stage of antiretroviral therapy.
Therefore, the expression level of the interferon stimulating gene in HIV infected persons treated by antiretroviral therapy can become a clinical index for evaluating the immune activation level and immune reconstitution status of the HIV infected persons in early treatment, and a new means is provided for effectively controlling the disease progress of HIV/AIDS infected persons.
The inventors of the present application screened the 4 interferon stimulatory genes most relevant to immune activation, i.e., Siglec1, MX2, IFI6, and IFI27, by flow cell sorting technique and RNA-seq technique using a humanized mouse model infected with HIV. However, without wishing to be bound by theory, the inventors of the present application found that, although the interferon-stimulated genes Siglec1, MX2, IFI6 and IFI27 were experimentally verified to be well expressed under interferon-stimulated conditions, not all of the expression levels of the interferon-stimulated genes could be used to distinguish between good and poor immune reconstitution, i.e. between immune responders and non-responders, in HIV-infected persons. Among the four interferon-stimulated genes, the inventors of the present application found that, after treatment, there were statistical differences in the expression levels and the distribution of the expression levels of the genes IFI6 and IFI27 between immune responders and immune non-responders, and such statistical differences enabled the establishment of clinical detection techniques and evaluation means for early evaluation of the immune activation level and immune reconstitution status of HIV-infected patients, and helped to find immune non-responders early in the treatment of HIV-infected patients, and provided feasible and targeted treatment protocols for the infected patients. In contrast, although the expression levels of the genes Siglec1 and MX were increased after interferon stimulation, there was no statistical difference in the expression distribution between immune responders and immune non-responders.
In this context, the terms "immune responder" and "immune non-responder" are defined as commonly used in the art, specifically "immune responder" refers to a person with good immune reconstitution, specifically an HIV-infected person treated with antiretroviral therapy for 2 years, CD4+T cell number > 350 cells/. mu.l; or HIV infected person is treated with antiretroviral therapy for 3 years, CD4+T cell number > 400 cells/. mu.l; or HIV infected person is treated with antiretroviral for more than 5 years, CD4+T cell number > 500 cells/. mu.l; the term "immunocompromised" refers to persons with poor immune reconstitution, and specifically, HIV-infected persons treated with antiretroviral therapy for 2 years, CD4+T cell number < 350 cells/. mu.l; or HIV infected person is treated with antiretroviral therapy for 3 years, CD4+Number of T cells<400 cells/. mu.l; or HIV infected person is treated with antiretroviral for more than 5 years, CD4+T cell count < 500 cells/. mu.l.
Accordingly, in a first aspect, the present invention provides a primer set for an interferon stimulated gene IFI27, comprising:
IFI27 upstream primer: GGGAATCGCCTCGTCCTC (SEQ ID NO:1), and
IFI27 downstream primer: GTAGAACCTCGCAATGACAGC (SEQ ID NO: 2).
In a second aspect, the present invention provides a probe for the interferon stimulated gene IFI27, comprising:
IFI27 probe: CCCAGTGACTGCAGAGTAGCCACA (SEQ ID NO: 3).
In a third aspect, the present invention provides a primer set for an interferon-stimulated gene IFI6, comprising:
IFI6 upstream primer: TGATGAGCTGGTCTGCGA (SEQ ID NO:4), and
IFI6 downstream primer: ATCAGGGCACCAATATTACCTA (SEQ ID NO: 5).
In a fourth aspect, the present invention provides a probe for the interferon stimulated gene IFI6, comprising:
IFI6 probe: CTGCCACCAGCCCCGAGG (SEQ ID NO: 6).
The primer and probe sequences of the present invention can be synthesized by methods known to those skilled in the art, and are not particularly limited. However, it should be noted that, for the primers and probes listed herein, the inventors found by detection that they had better amplification and detection efficiency than other primers and probes designed.
In a fifth aspect, the present invention provides a kit for detecting an interferon-stimulated gene IFI27 and/or IFI6, the kit comprising:
-a primer set according to the first aspect of the invention and/or according to the third aspect of the invention; and
-a probe according to the second aspect of the invention and/or according to the fourth aspect of the invention.
As known to those skilled in the art, the term "and/or" as used herein is used in a one-to-one relationship, i.e., when only the interferon stimulating gene IFI27 is detected, the primer set of the first aspect of the present invention and the probe of the second aspect of the present invention are used; and when only the interferon stimulating gene IFI6 is detected, the primer set of the third aspect of the present invention and the probe of the fourth aspect of the present invention are used; when the interferon stimulated gene IFI27 and the interferon stimulated gene IFI6 are simultaneously detected, the interferon stimulated gene IFI27 is detected using the primer set of the first aspect of the present invention and the probe of the second aspect of the present invention, and the interferon stimulated gene IFI6 is detected using the primer set of the third aspect of the present invention and the probe of the fourth aspect of the present invention.
In a sixth aspect, the present invention provides the use of a detection agent for interferon stimulated genes IFI27 and/or IFI6 in the preparation of a reagent for the assessment of the immune reconstitution status of an HIV infected person.
In a specific embodiment, the detection agent for the interferon stimulated gene IFI27 may include a primer for the gene. In a preferred embodiment, the primers are the upstream primer shown in SEQ ID NO. 1 and the downstream primer shown in SEQ ID NO. 2.
In yet another specific embodiment, the detection agent for the interferon stimulated gene IFI27 further comprises a probe for the gene. In yet a further preferred embodiment, the probe for the interferon stimulated gene IFI27 is the probe shown in SEQ ID NO. 3.
In yet another specific embodiment, the detection agent for the interferon stimulated gene IFI6 comprises a primer for the gene. In a preferred embodiment, the primers are the upstream primer shown in SEQ ID NO. 4 and the downstream primer shown in SEQ ID NO. 5.
In yet another specific embodiment, the detection agent for the interferon stimulated gene IFI6 further comprises a probe for the gene. In yet a further preferred embodiment, the probe for the interferon stimulated gene IFI6 is the probe shown in SEQ ID NO. 6.
In yet another specific embodiment, the assessment is performed by detecting the expression level of the IFI27 gene and/or IFI6 gene and analyzing the distribution of the expression level. In a preferred embodiment, the evaluation is performed by real-time fluorescent quantitative PCR.
In a further preferred embodiment, the real-time fluorescent quantitative PCR is a single real-time fluorescent quantitative PCR or a double real-time fluorescent quantitative PCR. In yet a further preferred embodiment, the real-time fluorescent quantitative PCR simultaneously performs the detection of the expression of IFI27 gene and IFI6 gene. On the basis of successfully establishing a single-time fluorescent quantitative PCR detection method of a single interferon stimulated gene, the double-time fluorescent quantitative PCR detection method is established by optimizing the concentrations of primers and probes, a reaction system and reaction conditions. The dual real-time fluorescent quantitative PCR detection realizes the simultaneous quantitative detection of the expression of the two interferon stimulated genes in a single-tube reaction, not only improves the detection efficiency, but also saves the detection cost, reduces the sample consumption and provides a practical and available technical means for the early evaluation of the immune reconstitution level in clinical treatment. Is more practical to use in future clinical applications.
In yet another specific embodiment, said assessing the immune reconstitution status of an HIV-infected person comprises detecting the expression level of the IFI27 gene and/or IFI6 gene and analyzing the distribution of the expression level and comparing the expression level with the expression level of the IFI27 gene and/or IFI6 gene and the distribution thereof known as immune responders to determine the risk of poor immune reconstitution.
In a further specific embodiment, the risk of determining poor immune reconstitution is, for example: if the relative expression quantity of the IFI27 gene and/OR the IFI6 gene falls into the relative expression quantity range corresponding to the OR value <1, judging that the risk of poor immune reconstitution is low; if the relative expression quantity of the IFI27 and/OR IFI6 gene falls into the relative expression quantity range corresponding to 1< OR value <2, judging that the risk of poor immune reconstitution is moderate; if the relative expression level of the IFI27 and/OR IFI6 gene falls within the relative expression level range corresponding to the OR value >2, the risk of the occurrence of poor immune reconstitution is determined to be high.
For example, according to the expression amount data of clinical specimens given in the examples section hereinafter, for the IFI27 gene, when the relative expression amount thereof is between 0 and 40000, the OR value <1 indicates that the risk of the occurrence of immune reconstitution failure is low, when the relative expression amount thereof is between 40000 and 80000, the OR value <2 indicates that the risk of the occurrence of immune reconstitution failure is moderate, and when the expression amount thereof is > 80000, the OR value >2 indicates that the risk of the occurrence of immune reconstitution failure is high; similarly, for the IFI6 gene, when the relative expression level is between 0 and 2000, the OR value <1 indicates that the risk of the occurrence of poor immune reconstitution is low, when the relative expression level is between 2000 and 4000, the OR value <2 indicates that the risk of the occurrence of poor immune reconstitution is moderate, and when the relative expression level is > 4000, the OR value >2 indicates that the risk of the occurrence of poor immune reconstitution is high.
The "OR (odds ratio)" value, also known as the ratio of ratio and odds ratio, is a common indicator in case control studies in epidemiological studies, mainly referring to the ratio of the number of exposed to non-exposed persons in case groups divided by the ratio of the number of exposed to non-exposed persons in control groups. The OR value represents an index of the strength of the association between disease and exposure, and, like Relative Risk (RR), refers to how many times the disease risk is for an exposer as for a non-exposer.
When the risk of poor immune reconstitution is moderate or high, the probability of immune non-response of the HIV infected person during the anti-retrovirus treatment is considered to be high, and a more feasible and targeted treatment scheme can be provided for the infected person at the early treatment stage.
As described above, after treatment, the expression levels and the distribution of IFI6 and IFI27 of immune responders and immune non-responders have statistical difference, and the statistical difference enables the establishment of clinical detection technology and evaluation means for early evaluation of the immune activation level and immune reconstitution status of HIV infected persons, helps to find immune non-responders in the early treatment of HIV infected persons, and provides feasible and targeted treatment schemes for infected persons. Therefore, a comprehensive evaluation system of the immune reconstitution status is established by using a large number of paired samples of immune responders and immune non-responders, and the immune reconstitution status is evaluated according to the expression level of interferon stimulating genes in bodies of HIV infected persons in early treatment period.
Examples
Hereinafter, the present invention is described in more detail with reference to exemplary embodiments. However, the exemplary embodiments disclosed herein are for illustrative purposes only and should not be construed to limit the scope of the present invention. The reagents used in the present invention, for example, conventional reagents such as buffers, enzymes, etc. used for real-time fluorescent quantitative PCR detection can be commercially available.
Example 1: primer design
The inventors of the present application designed and screened a set of specific PCR primers and probes to express the interferon-stimulated genes Siglec1, MX2, IFI6, and IFI27, respectively, with the following sequences:
IFI27 upstream primer: GGGAATCGCCTCGTCCTC (SEQ ID NO: 1);
IFI27 downstream primer: GTAGAACCTCGCAATGACAGC (SEQ ID NO: 2);
IFI27 probe: CCCAGTGACTGCAGAGTAGCCACA (SEQ ID NO: 3);
IFI6 upstream primer: TGATGAGCTGGTCTGCGA (SEQ ID NO: 4).
IFI6 downstream primer: ATCAGGGCACCAATATTACCTA (SEQ ID NO: 5);
IFI6 probe: CTGCCACCAGCCCCGAGG (SEQ ID NO: 6).
MX2 upstream primer: GGCAGAAAGACTTACCACT (SEQ ID NO: 7).
MX2 downstream primer: AACATCTTGTCGGCCTC (SEQ ID NO: 8).
MX2 probes: CTGGTGGCTCTCCCTTATTTGTCCT (SEQ ID NO: 9).
Siglec1 upstream primer: GGCCATTGCACCATCACAC (SEQ ID NO: 10).
Siglec1 downstream primer: TTCGGAACCAGGAGAAGTTAGCA (SEQ ID NO: 11.
Siglec1 probe: CCAGCAGCTTCCCGGCTCACGTT (SEQ ID NO: 12).
Example 2: detection of interferon-stimulated Gene expression levels
In this example, the expression levels of the four interferon-stimulated genes, Siglec1, MX2, IFI6, and IFI27, referred to in the present application were verified using the THP-1 cell model. THP-1 is a monocyte cell line of human peripheral blood, and is widely applied to research on lymphocyte-related mechanisms, signal pathways, nutrition, drug transportation and the like.
In vitro, THP-1 cell is stimulated to simulate high-level interferon response of organism by using recombinant human interferon beta (IFN-beta, purchased from PeproTech, with the product number of 300-02BC), THP-1 without interferon stimulation is used as a control, after the THP-1 cell is recovered, IFN in vitro stimulation experiment is carried out after the growth state is stable, 1.44 x 10 is added6THP-1 cells were cultured in six-well plates at a final volume of 2ml per well and a final concentration of 4000pg/ml interferon was added to a volume of 2ml per well, and a control group was added with an equal volume of cell culture medium and interferon-stimulated and control groups were extracted using a Total RNA extraction kit (DP419) for Tiangen (TIANGEN) cells 6 hours after stimulationTotal RNA from the cells of the group was extracted strictly according to the manufacturer's instructions. And using glyceraldehyde phosphate dehydrogenase (GAPDH) as an internal reference gene, the expression results of interferon-stimulating genes Siglec1, MX2, IFI6 and IFI27 in THP-1 cells are shown in FIG. 1.
As can be seen from FIG. 1, in the THP-1 cell model, compared with the THP-1 cell which is not stimulated by the recombinant human interferon beta, the expression of interferon-stimulated genes Siglec1, MX2, IFI6 and IFI27 in the THP-1 cell which is stimulated by the recombinant human interferon beta is up-regulated, and the genes Siglec1, MX2, IFI6 and IFI27 are proved to be really used as biological indicators reflecting the activation level of the interferon of organisms.
Example 3: dual real-time fluorescent quantitative PCR detection of interferon stimulated gene expression
In this example, in order to shorten the experimental time of clinical examination and reduce the number of operation steps, a one-step RT-PCR amplification method is designed and used. The method does not need to carry out reverse transcription alone to detect the gene expression amount after RNA is extracted. The amplification reagent and the instrument select the Qiagen QuantiNova Probe RT-PCR Kit #208352 Kit and the Bio-rad CFX96 real-time fluorescence quantitative PCR instrument which are widely applied at present, and optimize the reaction conditions to finally obtain the optimal detection reaction system and detection conditions on the basis of referring to the manufacturer instruction manual, which are specifically shown in the table 1 and the table 2.
Table 1: one-step real-time fluorescent quantitative PCR reaction system with RNA as template
Table 2: real-time fluorescent quantitative PCR program
Example 4: analysis of results of PCR detection of expression of Interferon-stimulated Gene
The relative expression quantity of the target gene is obtained by quantitatively detecting four interferon stimulating genes (IFI6, IFI27, Siglec1 and MX2) of a plurality of clinical samples (including clinical samples from immune responders and immune non-responders), converting the absolute copy number of the target gene and an internal reference gene by using a standard curve, and calculating the copy number of the target gene/the copy number of the internal reference gene. Because the expression level of the target gene is lower than that of the reference gene, the relative expression value obtained by conversion is smaller, so that the relative expression level is uniformly expanded (for example, expanded by 10000 times) in the data analysis process, and the subsequent data analysis is facilitated.
The inventors analyzed the experimental data using the Mann-Whitney rank sum test, with the following results:
first, CD4 before treatment+Among those infected with T baseline less than 200/μ L, immune responders (post-treatment CD 4)+T>500/μ L) and immune non-responders (post-treatment CD 4)+T<200/μ L), the expression levels of IFI6 and IFI27 were statistically different, and the expression levels of IFI27 and IFI6 molecules in immunocompromised persons were significantly higher than those in immune responders, as shown in fig. 2 (in the figure, p represents p)<0.05, represents p<0.01)。
The expression levels of IFI27 and IFI6 genes were stratified and the distribution ratio of different expression levels of IFI27 and IFI6 between immune responders and immune non-responders was further analyzed, and the results are shown in tables 3 and 4 below. From these two tables, it can be found that the distribution of IFI27 and IFI6 genes in the two groups of infectors is greatly different at different expression levels and there is a statistical difference, which indicates that IFI27 and IFI6 genes can be used as biological markers for evaluating immune reconstitution status.
Table 3: expression of IFI27 in different groups of infected persons
Table 4: expression of IFI6 in different groups of infected persons
Secondly, for the same can be as the reactor body interferenceSiglec1 and MX2 as biological indicators of level of activation of hormone, CD4 before treatment+No immune responders were found in HIV-infected patients with a T-baseline of less than 200/μ L (post-treatment CD 4)+T>500/μ L) and immune non-responders (post-treatment CD 4)+T<200/μ L) were statistically different from MX2, and the results are shown in fig. 3. From this, it was found that the OR value could not be obtained for Siglec1 and MX2 in the immune responder and the immune non-responder<1、1<OR value<2 and OR value>2, and therefore, Siglec1 and MX2 cannot be used for evaluating the immune activation level and immune reconstitution status of HIV-infected persons.
The technical scheme of the invention screens two interferon stimulating genes (IFI27 and IFI6) which are closely related to the immune reconstitution status of an HIV infected person, and is used for evaluating the immune activation level and the immune reconstitution status of the HIV infected person. Without wishing to be bound by theory, other methods of detecting the expression levels of the two interferon-stimulated genes to evaluate the level of immune activation and immune reconstitution status of HIV-infected individuals are within the scope of this patent.
In the present specification, whenever reference is made to "an exemplary embodiment", "a preferred embodiment", "one embodiment", or the like, it is intended that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. The appearances of such phrases in various places in the specification are not necessarily all referring to the same embodiment. Further, when a particular feature, structure, or characteristic is described in connection with any embodiment, it is submitted that it is within the purview of one skilled in the art to effect such feature, structure, or characteristic in other ones of all the embodiments described.
The embodiments of the present invention have been described above in detail. However, aspects of the present invention are not limited to the above-described embodiments. Various modifications and substitutions may be made to the above-described embodiments without departing from the scope of the invention.
Sequence listing
<110> prevention and control center of Chinese diseases for preventing and controlling venereal disease and AIDS
<120> reagents and methods for detecting immune reconstitution status of HIV-infected person
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gggaatcgcc tcgtcctc 18
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gtagaacctc gcaatgacag c 21
<210> 3
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cccagtgact gcagagtagc caca 24
<210> 4
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tgatgagctg gtctgcga 18
<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
atcagggcac caatattacc ta 22
<210> 6
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ctgccaccag ccccgagg 18
<210> 7
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ggcagaaaga cttaccact 19
<210> 8
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
aacatcttgt cggcctc 17
<210> 9
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
ctggtggctc tcccttattt gtcct 25
<210> 10
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ggccattgca ccatcacac 19
<210> 11
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ttcggaacca ggagaagtta gca 23
<210> 12
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
ccagcagctt cccggctcac gtt 23
Claims (10)
1. A primer set for interferon stimulation gene IFI27 comprising:
IFI27 upstream primer: GGGAATCGCCTCGTCCTC (SEQ ID NO:1), and
IFI27 downstream primer: GTAGAACCTCGCAATGACAGC (SEQ ID NO: 2).
2. A probe directed to the interferon-stimulated gene IFI27, comprising:
IFI27 probe: CCCAGTGACTGCAGAGTAGCCACA (SEQ ID NO: 3).
3. A primer set for interferon stimulation gene IFI6 comprising:
IFI6 upstream primer: TGATGAGCTGGTCTGCGA (SEQ ID NO:4), and
IFI6 downstream primer: ATCAGGGCACCAATATTACCTA (SEQ ID NO: 5).
4. A probe directed to the interferon-stimulated gene IFI6, comprising:
IFI6 probe: CTGCCACCAGCCCCGAGG (SEQ ID NO: 6).
5. A kit for detecting expression of interferon-stimulated genes IFI27 and/or IFI6, the kit comprising:
-a primer set according to claim 1 and/or 3; and
-the probe of claim 2 and/or 4.
6. Use of a detection agent for interferon stimulatory genes IFI27 and/or IFI6 in the preparation of a reagent for evaluating the immune reconstitution status of an HIV-infected person.
7. The use of claim 6, wherein the detector of the interferon stimulated gene IFI27 comprises a primer for the gene; preferably, the primer is an upstream primer shown as SEQ ID NO. 1 and a downstream primer shown as SEQ ID NO. 2; more preferably, the detector of the interferon stimulated gene IFI27 further comprises a probe for the gene; preferably, the probe is a probe shown as SEQ ID NO. 3.
8. The use according to claim 6 or 7, wherein the detection agent for the interferon stimulated gene IFI6 comprises a primer for the gene; preferably, the primer is an upstream primer shown as SEQ ID NO. 4 and a downstream primer shown as SEQ ID NO. 5; more preferably, the detector of the interferon stimulated gene IFI6 further comprises a probe for the gene; preferably, the probe is a probe shown as SEQ ID NO. 6.
9. The use according to any one of claims 6-8, wherein the assessment is performed by detecting the expression level of the IFI27 gene and/or IFI6 gene and analyzing the distribution of this expression level, preferably by real-time fluorescent quantitative PCR; for example, the real-time fluorescent quantitative PCR is a single real-time fluorescent quantitative PCR or a double real-time fluorescent quantitative PCR.
10. The use according to any one of claims 6 to 8, wherein the evaluation of the immune reconstitution status of an HIV-infected person comprises detecting the expression level of the IFI27 gene and/or IFI6 gene and analyzing the distribution of the expression level, and comparing the expression level with the expression level of the IFI27 gene and/or IFI6 gene and the distribution thereof known as an immune responder to determine the risk of poor immune reconstitution;
for example, if the relative expression level of the IFI27 gene and/OR the IFI6 gene falls within the relative expression level range corresponding to the OR value <1, it is determined that the risk of poor immune reconstitution is low; if the relative expression quantity of the IFI27 and/OR IFI6 gene falls into the relative expression quantity range corresponding to 1< OR value <2, judging that the risk of poor immune reconstitution is moderate; if the relative expression level of the IFI27 and/OR IFI6 gene falls within the relative expression level range corresponding to the OR value >2, the risk of the occurrence of poor immune reconstitution is determined to be high.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110780911.0A CN113584149A (en) | 2021-07-09 | 2021-07-09 | Reagents and methods for detecting immune reconstitution status in HIV-infected subjects |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110780911.0A CN113584149A (en) | 2021-07-09 | 2021-07-09 | Reagents and methods for detecting immune reconstitution status in HIV-infected subjects |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113584149A true CN113584149A (en) | 2021-11-02 |
Family
ID=78246970
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110780911.0A Pending CN113584149A (en) | 2021-07-09 | 2021-07-09 | Reagents and methods for detecting immune reconstitution status in HIV-infected subjects |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113584149A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150211063A1 (en) * | 2012-09-11 | 2015-07-30 | The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. | Methods of Screening for Susceptibility to Virus Infection |
| US20170039343A1 (en) * | 2014-04-10 | 2017-02-09 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Methods and kits for determining a personalized treatment regimen for a subject suffering from a pathologic disorder |
| CN106573053A (en) * | 2014-06-23 | 2017-04-19 | 詹森生物科技公司 | Interferon alpha and omega antibody antagonists |
| US20190194760A1 (en) * | 2016-05-25 | 2019-06-27 | Curevac Ag | Novel biomarkers |
| WO2020243371A1 (en) * | 2019-05-28 | 2020-12-03 | Massachusetts Institute Of Technology | Methods and compositions for modulating immune responses |
-
2021
- 2021-07-09 CN CN202110780911.0A patent/CN113584149A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150211063A1 (en) * | 2012-09-11 | 2015-07-30 | The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. | Methods of Screening for Susceptibility to Virus Infection |
| US20170039343A1 (en) * | 2014-04-10 | 2017-02-09 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Methods and kits for determining a personalized treatment regimen for a subject suffering from a pathologic disorder |
| CN106573053A (en) * | 2014-06-23 | 2017-04-19 | 詹森生物科技公司 | Interferon alpha and omega antibody antagonists |
| US20190194760A1 (en) * | 2016-05-25 | 2019-06-27 | Curevac Ag | Novel biomarkers |
| WO2020243371A1 (en) * | 2019-05-28 | 2020-12-03 | Massachusetts Institute Of Technology | Methods and compositions for modulating immune responses |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111440884B (en) | Intestinal flora for diagnosing sarcopenia and application thereof | |
| Raju et al. | Gene expression profiles of bronchoalveolar cells in pulmonary TB | |
| CN112442535A (en) | Molecular typing and survival risk gene group of primary lung adenocarcinoma, diagnostic product and application | |
| JP2013526845A (en) | Genes and combinations of genes that predict an initial response or non-response of a subject suffering from an inflammatory disease to a cytokine targeted drug (CyTD) | |
| CN111826466B (en) | Hepatitis B infected patient or carrier exosome miRNA molecular marker combination and screening kit | |
| CN110205378B (en) | Vertebral column tuberculosis plasma miRNA combined diagnosis marker and application thereof | |
| Petzke et al. | Global transcriptome analysis identifies a diagnostic signature for early disseminated Lyme disease and its resolution | |
| CN108866187B (en) | Long-chain non-coding RNA marker related to lung cancer auxiliary diagnosis and application thereof | |
| CN112779329B (en) | Molecular marker for auxiliary diagnosis of viral meningitis and application and kit thereof | |
| KR20180007291A (en) | Method of detecting a risk of cancer | |
| WO2013055811A1 (en) | Ex vivo methods of predicting responsiveness of a subject to interferon therapy | |
| WO2006113833A2 (en) | Metallothionein as an early biomarker for death secondary to septic shock and as a novel therapeutic target for septic shock | |
| CN113584149A (en) | Reagents and methods for detecting immune reconstitution status in HIV-infected subjects | |
| US20220381791A1 (en) | Method for determining an individual ability to respond to a stimulus | |
| WO2017148951A1 (en) | Gene signature for the prognosis of dry eye disease | |
| CN112266955A (en) | Ankylosing spondylitis diagnosis marker and application thereof | |
| Cox et al. | Gene expression profiles in whole blood and associations with metabolic dysregulation in obesity | |
| CN107058474B (en) | Diagnostic kit for diagnosing acute mountain sickness through plasma microRNA-3591-3p | |
| CN112608995B (en) | Specific marker for pulmonary tuberculosis, application and kit | |
| CN107058473B (en) | Kit for diagnosing acute mountain sickness by combining miR-676, miR-181b and miR-3591 | |
| CN112575078B (en) | Application of lncRNAs as specific markers of active tuberculosis | |
| CN111518894B (en) | Reagent for detecting rs9273471 locus polymorphism and application thereof | |
| CN107058475B (en) | Kit for diagnosing acute mountain sickness by combining miR-676, miR-181b and miR-193b | |
| CN110527721B (en) | Old tuberculosis marker and application thereof | |
| Cheng et al. | Acute atopic dermatitis and urticaria imprints peripheral monocytes with proinflammatory-prone signature |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |