CN113584140A - Method for identifying whether body fluid to be detected is peripheral blood, menstrual blood or non-blood - Google Patents

Method for identifying whether body fluid to be detected is peripheral blood, menstrual blood or non-blood Download PDF

Info

Publication number
CN113584140A
CN113584140A CN202110947748.2A CN202110947748A CN113584140A CN 113584140 A CN113584140 A CN 113584140A CN 202110947748 A CN202110947748 A CN 202110947748A CN 113584140 A CN113584140 A CN 113584140A
Authority
CN
China
Prior art keywords
blood
mir
hsa
detected
body fluid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202110947748.2A
Other languages
Chinese (zh)
Other versions
CN113584140B (en
Inventor
孙启凡
季安全
王国力
王哲
赵一霞
胡胜
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Forensic Science Ministry of Public Security PRC
Original Assignee
Institute of Forensic Science Ministry of Public Security PRC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Forensic Science Ministry of Public Security PRC filed Critical Institute of Forensic Science Ministry of Public Security PRC
Priority to CN202110947748.2A priority Critical patent/CN113584140B/en
Publication of CN113584140A publication Critical patent/CN113584140A/en
Application granted granted Critical
Publication of CN113584140B publication Critical patent/CN113584140B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Abstract

The invention discloses a method for identifying whether body fluid to be detected is peripheral blood, menstrual blood or non-blood. The method comprises the steps of detecting the copy numbers of hsa-miR-451a and hsa-miR-21-5p in body fluid to be detected, judging whether the body fluid to be detected is peripheral blood, menstrual blood or non-blood according to the copy number ratio of hsa-miR-451a and hsa-miR-21-5p, and enabling the accuracy to reach 100%. The invention provides accurate scientific basis for determining case property, determining criminal suspects, deciding crime and measuring criminals and the like, and has important application value.

Description

Method for identifying whether body fluid to be detected is peripheral blood, menstrual blood or non-blood
Technical Field
The invention belongs to the technical field of forensic science, and particularly relates to a method for identifying whether body fluid to be detected is peripheral blood, menstrual blood or non-blood.
Background
Body fluid spots left behind in case sites are analyzed and the tissue attribute sources of the body fluid spots are determined, so that important information can be provided for case investigation, and strong evidence is provided for court science. In general, common body fluid samples include peripheral blood, menstrual blood, saliva, semen, vaginal secretion, and the like. Blood is one of the most common and important test materials in the field, and the most important difference between blood and non-blood samples is that blood contains a large amount of blood cells, and peripheral blood and menstrual blood both contain a large amount of red blood cells, but menstrual blood also contains a large amount of a mixture of endometrial debris, cervical mucus and vaginal secretions compared with peripheral blood. Whether the on-site blood type test material belongs to peripheral blood or menstrual blood is a very important forensic science problem, and the on-site blood type test material has very important significance for case qualification, case site reconstruction and case evidence provision; particularly for sexual assault, female missing and certain injuries, where a female victim is said to have hematuria resulting from a violent attack, it is necessary to determine whether there is menstrual blood contamination of the source of blood cells in the urine. However, due to the specificity of the in situ test material, many conventional identification methods are considered to have great limitations, which also underscores the necessity of using molecular quantification methods with high sensitivity, good specificity and good stability.
microRNA (miRNA) is a single-stranded non-coding RNA with the length of about 22nt, and plays a role in regulating the posttranscriptional level by combining with a 3 'untranslated region (3' -UTR) of target mRNA. Due to the biological characteristics of high stability, strong conservation, good tissue specificity and the like, the compound has great potential to be a powerful tool for identifying the source of body fluid of the forensic medicine considered by domestic and foreign forensic doctors. At present, a great deal of research on the identification of body fluid tissue sources by using miRNA is available, however, the research on the identification of body fluid tissue sources by using miRNA in forensic science still has problems and difficulties, such as difficulty in identifying peripheral blood and menstrual blood, which are influenced by various factors.
Disclosure of Invention
The object of the invention is to identify the tissue origin of the body fluid to be tested.
The invention firstly protects a method for identifying whether body fluid to be detected is peripheral blood, menstrual blood or non-blood, which comprises the following steps:
(a1) obtaining 451/21Ratio in a number of blood samples and a number of non-blood samples; the 451/21Ratio is the copy number Ratio of hsa-miR-451a and hsa-miR-21-5 p;
the blood is menstrual blood or peripheral blood;
the non-blood is saliva, semen or vaginal secretion;
(a2) performing statistical analysis on the 451/21Ratio obtained in the step (a1) to obtain a jotans index cutoff value 1 for identifying blood and non-blood and a jotans index cutoff value 2 for identifying peripheral blood and menstrual blood; then, the following judgment is made:
if 0< 451/21Ratio of the body fluid to be detected < jodon index cutoff value 1, the body fluid to be detected is non-blood;
if the john index cutoff value 1< 451/21Ratio of the body fluid to be detected < john index cutoff value 2, the body fluid to be detected is menstrual blood;
if the 451/21Ratio of the body fluid to be detected is greater than the approximate exponential cutoff value 2, the body fluid to be detected is peripheral blood;
the method is useful for diagnosis and treatment of non-diseases.
The invention also provides a method for identifying whether the body fluid to be detected is blood or non-blood, which comprises the following steps:
(b1) obtaining 451/21Ratio in a number of blood samples and a number of non-blood samples; the 451/21Ratio is the copy number Ratio of hsa-miR-451a and hsa-miR-21-5 p;
the blood is menstrual blood or peripheral blood;
the non-blood is saliva, semen or vaginal secretion;
(b2) performing statistical analysis on the 451/21Ratio obtained in step (b1) to obtain a john's index cutoff of 1 for identifying blood and non-blood; then, the following judgment is made:
if 0< 451/21Ratio of the body fluid to be detected < jodon index cutoff value 1, the body fluid to be detected is non-blood;
if the 451/21Ratio of the body fluid to be detected is greater than the approximate exponential cutoff value 1, the body fluid to be detected is blood;
the method is useful for diagnosis and treatment of non-diseases.
In any of the above methods, the method of obtaining 451/21Ratio in a plurality of blood samples and a plurality of non-blood samples may be as follows:
(1) respectively taking Total RNA of a sample as a template, and carrying out reverse transcription by using a stem-loop specific reverse transcription primer of a target miRNA (hsa-miR-451a or hsa-miR-21-5p) to obtain cDNA of the sample;
the nucleotide sequence of the stem-loop specific reverse transcription primer of hsa-miR-451a is shown in SEQ ID NO:3 is shown in the specification;
the nucleotide sequence of the stem-loop specific reverse transcription primer of the hsa-miR-21-5p is shown in SEQ ID NO:4 is shown in the specification;
(2) respectively taking cDNA of a sample as a template, and carrying out real-time fluorescence quantitative PCR by adopting a primer pair consisting of a general forward amplification primer and a specific reverse amplification primer of target miRNA to obtain a Cq value of the sample;
the nucleotide sequence of the universal forward amplification primer is shown as SEQ ID NO:5 is shown in the specification;
the nucleotide sequence of the specific reverse amplification primer of hsa-miR-451a is shown in SEQ ID NO:6 is shown in the specification;
the nucleotide sequence of the specific reverse amplification primer of hsa-miR-21-5p is shown in SEQ ID NO:7 is shown in the specification;
(3) respectively obtaining the target miRNA copy number of the sample according to the Cq value of the sample;
(4) obtaining 451/21Ratio for each sample;
451/21Ratio ═ hsa-miR-451a copy number/hsa-miR-21-5 p copy number.
The invention also provides a method for identifying whether blood to be detected is menstrual blood or peripheral blood, which comprises the following steps:
(c1) obtaining 451/21Ratio of a plurality of menstrual blood samples and a plurality of peripheral blood samples; the 451/21Ratio is the copy number Ratio of hsa-miR-451a and hsa-miR-21-5 p;
(c2) performing statistical analysis on the 451/21Ratio obtained in the step (c1) to obtain a joden index cutoff value 2 for identifying peripheral blood and menstrual blood; then, the following judgment is made:
if the 451/21Ratio of the blood to be detected is less than the Johnson index cutoff value 2, the blood to be detected is menstrual blood;
if the 451/21Ratio of the blood to be detected is greater than the approximate exponential cutoff value 2, the blood to be detected is peripheral blood;
the blood to be detected is menstrual blood or peripheral blood;
the method is useful for diagnosis and treatment of non-diseases.
Among the above methods, the method of obtaining 451/21Ratio for several menstrual blood samples and several peripheral blood samples may be as follows:
(1) respectively taking Total RNA of a sample as a template, and carrying out reverse transcription by using a stem-loop specific reverse transcription primer of a target miRNA (hsa-miR-451a or hsa-miR-21-5p) to obtain cDNA of the sample;
the nucleotide sequence of the stem-loop specific reverse transcription primer of hsa-miR-451a is shown in SEQ ID NO:3 is shown in the specification;
the nucleotide sequence of the stem-loop specific reverse transcription primer of the hsa-miR-21-5p is shown in SEQ ID NO:4 is shown in the specification;
(2) respectively taking cDNA of a sample as a template, and carrying out real-time fluorescence quantitative PCR by adopting a primer pair consisting of a general forward amplification primer and a specific reverse amplification primer of target miRNA to obtain a Cq value of the sample;
the nucleotide sequence of the universal forward amplification primer is shown as SEQ ID NO:5 is shown in the specification;
the nucleotide sequence of the specific reverse amplification primer of hsa-miR-451a is shown in SEQ ID NO:6 is shown in the specification;
the nucleotide sequence of the specific reverse amplification primer of hsa-miR-21-5p is shown in SEQ ID NO:7 is shown in the specification;
(3) respectively obtaining the target miRNA copy number of the sample according to the Cq value of the sample;
(4) obtaining 451/21Ratio for each sample;
451/21Ratio ═ hsa-miR-451a copy number/hsa-miR-21-5 p copy number.
In any of the above methods, the method for obtaining the copy number of the miRNA of interest from the Cq value of the sample may be as follows: replacing Total RNA of the sample in the step (1) with target miRNA standard RNA with known initial copy number, and obtaining cDNA of an hsa-miR-451a standard product in other steps; carrying out continuous dilution on cDNA of an hsa-miR-451a standard substance to obtain a plurality of diluents; replacing cDNA of the sample in the step (2) with diluent respectively, and obtaining the Cq value of the diluent in the same steps; drawing a standard curve of the target miRNA according to the initial copy number and the Cq value of the target miRNA; and substituting the Cq value of the sample into a standard curve to obtain the target miRNA copy number of the sample.
In any of the methods described above, the statistical analysis of the 451/21Ratio obtained may be statistical analysis using SPSS 26.0 software, including Mann-Whitney U tests (nonparametric), with p <0.05 considered statistically significant. Receiver Operating Characteristics (ROC) curve is used to evaluate the ability of ratio discrimination. The jotan index (sensitivity + specificity-1) was used to determine the cutoff value for discrimination (i.e., jotan index cutoff).
Any of the methods can be used for analyzing the tissue source of the spot of the body fluid left on site during case detection.
The invention also protects a kit which can comprise a substance for detecting the copy number of hsa-miR-451a and hsa-miR-21-5p in body fluid to be detected;
the function of the kit may be d1) or d 2):
d1) identifying whether the body fluid to be tested is peripheral blood, menstrual blood or non-blood;
d2) identifying whether the body fluid to be tested is blood or non-blood;
the blood is menstrual blood or peripheral blood;
the non-blood is saliva, semen or vaginal secretion.
The kit can specifically consist of substances for detecting the copy numbers of hsa-miR-451a and hsa-miR-21-5p in body fluid to be detected.
The invention also provides a kit for identifying whether blood to be detected is menstrual blood or peripheral blood, which comprises a substance for detecting the copy number of hsa-miR-451a and hsa-miR-21-5p in body fluid to be detected; the blood to be detected is menstrual blood or peripheral blood.
The kit can specifically consist of substances for detecting the copy numbers of hsa-miR-451a and hsa-miR-21-5p in body fluid to be detected.
Any one of the substances for detecting the copy number of hsa-miR-451a and hsa-miR-21-5p in the body fluid to be detected can comprise hsa-miR-451a stem-loop specific reverse transcription primers, hsa-miR-21-5p stem-loop specific reverse transcription primers, universal forward amplification primers, hsa-miR-451a specific reverse amplification primers and hsa-miR-21-5p specific reverse amplification primers;
the nucleotide sequence of the hsa-miR-451a stem-loop specific reverse transcription primer is shown in SEQ ID NO. 3;
the nucleotide sequence of the hsa-miR-21-5p stem-loop specific reverse transcription primer is shown in SEQ ID NO. 4;
the nucleotide sequence of the universal forward amplification primer is shown as SEQ ID NO. 5;
the nucleotide sequence of the specificity reverse amplification primer of hsa-miR-451a is shown in SEQ ID NO 6;
the nucleotide sequence of the specificity reverse amplification primer of hsa-miR-21-5p is shown in SEQ ID NO. 7.
Any one of the substances for detecting the copy number of hsa-miR-451a and hsa-miR-21-5p in the body fluid to be detected can specifically consist of the hsa-miR-451a stem-loop specific reverse transcription primer, the hsa-miR-21-5p stem-loop specific reverse transcription primer, the general forward amplification primer, the hsa-miR-451a specific reverse amplification primer and the hsa-miR-21-5p specific reverse amplification primer.
The substance for detecting the copy number of hsa-miR-451a and hsa-miR-21-5p in the body fluid to be detected can also comprise hsa-miR-451a standard substance RNA and/or hsa-miR-21-5p standard substance RNA.
The substance for detecting the copy number of hsa-miR-451a and hsa-miR-21-5p in the body fluid to be detected can specifically consist of the hsa-miR-451a stem-loop specific reverse transcription primer, the hsa-miR-21-5p stem-loop specific reverse transcription primer, the general forward amplification primer, the hsa-miR-451a specific reverse amplification primer, the hsa-miR-21-5p specific reverse amplification primer, the hsa-miR-451a standard product RNA and the hsa-miR-21-5p standard product RNA.
The invention also protects the application of any one of the substances for detecting the copy number of hsa-miR-451a and hsa-miR-21-5p in the body fluid to be detected, which is d1), d2) or d 3):
d1) identifying whether the body fluid to be tested is peripheral blood, menstrual blood or non-blood;
d2) identifying whether the body fluid to be tested is blood or non-blood;
d3) identifying whether the blood to be detected is menstrual blood or peripheral blood;
the blood is menstrual blood or peripheral blood;
the non-blood is saliva, semen or vaginal secretion;
the use is for the diagnosis and treatment of non-diseases.
The invention also protects the application of hsa-miR-451a and hsa-miR-21-5p, which is d1), d2) or d 3):
d1) identifying whether the body fluid to be tested is peripheral blood, menstrual blood or non-blood;
d2) identifying whether the body fluid to be tested is blood or non-blood;
d3) identifying whether the blood to be detected is menstrual blood or peripheral blood;
the blood is menstrual blood or peripheral blood;
the non-blood is saliva, semen or vaginal secretion;
the use is for the diagnosis and treatment of non-diseases.
Any of the applications can be used for tissue source analysis of on-site left body fluid spots in case detection.
Any of the above body fluids to be tested may be peripheral blood, saliva, menstrual blood, semen or vaginal secretion.
In one embodiment of the present invention, 47 parts of peripheral blood, 56 parts of menstrual blood, 10 parts of saliva, 10 parts of semen and 10 parts of vaginal secretion were used as samples. According to the above method, in the discrimination between blood and non-blood, the cutoff value by the john index (that is, john index cutoff value 1) was 0.929, and both the sensitivity and the specificity were 1. In the discrimination between menstrual blood and peripheral blood, the cutoff value of the jotan index judgment (i.e., jotan index cutoff value 2) was 10.201, and both the sensitivity and the specificity were 1. If the 451/21Ratio of the unknown body fluid sample is greater than 0 and less than 0.929, the sample is non-blood; if 451/21Ratio is more than 0.929 and less than 10.201, then the menstruation is menstrual blood; if 451/21Ratio is greater than 10.201, peripheral blood is obtained.
The blood sample is the most common and important biological sample in a crime scene, belongs to menstrual blood or peripheral blood, and is an important clue for solving certain criminal cases. miRNA is an important biomarker with strong tissue specificity, and can be used for identifying the tissue attributes of forensic body fluid samples. The method comprises the steps of respectively constructing standard curves of miR-451a and miR-21-5p by a real-time fluorescent quantitative PCR (polymerase chain reaction) technology, establishing a body fluid type identification method taking the copy number Ratio (451/21 Ratio) of two miRNAs as a judgment standard in two blood samples (comprising 47 peripheral blood samples and 56 menstrual blood samples) and three non-blood samples (10 parts of saliva, semen and vaginal secretion samples respectively), and determining the identification effect by ROC (Roc analysis). The results show that non-blood, menstrual blood and peripheral blood can be accurately distinguished by taking 0.929 and 10.201 as cut-off values, and the sensitivity and specificity are all 1. The external verification of 86 samples (24 peripheral blood samples and 62 menstrual blood samples) was consistent with the above rules. Meanwhile, the identification method provided by the invention is not influenced by various factors (sex, age, menstrual period, exposure time and the like) and different experiment platforms, and the detection requirement can be met when the total RNA amount of peripheral blood and menstrual blood is not less than 0.1 ng. The invention has important application value.
Drawings
FIG. 1 shows the results of the experiment in example 1. a is the primer efficiency of hsa-miR-451a (n-3). b is the primer efficiency of hsa-miR-21-5p (n-3). And c is a standard curve of hsa-miR-451a (n is 3). d is a standard curve of hsa-miR-21-5p (n-3). The standard deviation of all data points a-d is less than 0.3. e is an 451/21Ratio comparison of blood (n-103) and non-blood (n-30) samples. f is the 451/21Ratio results for the peripheral blood (PB, n-47) and menstrual blood (MB, n-56) samples. g is ROC result for blood (n ═ 103) and non-blood (n ═ 30) samples, AUC ═ 1.000. h is ROC result of peripheral blood (PB, n-47) and menstrual blood (MB, n-56) samples, AUC-1.000. Denotes p <0.0001.
FIG. 2 shows the verification and evaluation of the method established in example 1. a is the 451/21Ratio result in peripheral blood samples of different sex, Male (n-10) and Female (n-10). b is the 451/21Ratio results of samples of different age groups, each group containing 10 copies of peripheral blood and menstrual blood. c is the 451/21Ratio results in menstrual blood samples taken on different days. Blue dots represent menstrual blood samples (n-38) from 10 healthy female volunteers on different days (Day1-Day6) and are compared to f in fig. 1. d is the 451/21Ratio results for samples of different exposure times, 6 each for peripheral and menstrual blood at each time gradient. e is the sensitivity results of peripheral blood (PB, n ═ 3) and menstrual blood (MB, n ═ 3)451/21 Ratio, and the lowest detection limit of RNA was 0.1 ng. f is the sensitivity results of saliva (SA, n-3), semen (SE, n-3) and vaginal secretion (VA, n-3) 451/21Ratio, the lowest detection limit of saliva and vaginal secretion RNA is 1ng, and the lowest detection limit of semen RNA is 0.1 ng. P <0.0001, ns: not significan.
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.
The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
In the following examples, all primers were synthesized by sangon. miRNeasy MiniKit is a product of Qiagen, germany. Nanodrop2000c is a product of Thermo Scientific, USA. 5 XFirst-Strand Buffer, DTT (0.1M) and reverse transcriptase M-MLV are products of Invitrogen. dNTP mix and nuclease-free water are products of TaKaRa Co. Recombinant
Figure RE-GDA0003280088360000061
RNase Inhibitor is a product of Promega corporation. M-MLV Reverse Transcriptase Kit is a product of Invitrogen corporation, USA. QuantStaudio TM7 Flex Real-Time PCR System, Applied Biosystems, USAThe product of sauce. Power SYBR GreenPCR Master Mix (2X) is a product of Applied Biosystems.
In the following examples, the names and nucleotide sequences of 2 mirnas are shown in table 1 on lines 2 to 3.
TABLE 1
Target miRNA Nucleotide sequence (5 '-3')
hsa-miR-451a AAACCGUUACCAUUACUGAGUU(SEQ ID NO：1)
hsa-miR-21-5p UAGCUUAUCAGACUGAUGUUGA(SEQ ID NO：2)
Example 1 establishment of method for identifying whether body fluid to be tested is peripheral blood, menstrual blood or non-blood, and accuracy identification
First, sample collection
All samples of the present invention were provided by volunteers, and all samples were provided by unrelated individuals.
53 peripheral blood samples, 100 menstrual blood samples, 10 saliva samples, 10 semen samples and 10 vaginal secretion samples are collected together, and the samples are collected according to the principle of informed consent and are subjected to ethical examination by the material evidence identification center of the ministry of public Security.
Peripheral blood samples were collected by venipuncture and then placed in EDTA anticoagulant tubes and stored at-80 ℃.
Saliva samples were collected in sterile plastic tubes, fasted for 1 hour prior to collection, and stored at-80 ℃.
Semen samples were collected in sterile wide-mouth plastic cups and stored at-80 ℃ for 2 days before collection.
Menstrual blood samples were collected with a tampon 4 days before the menstrual cycle, air dried at room temperature for 1 day, and stored at-80 ℃.
Vaginal secretion samples were collected with a tampon during non-menstrual periods, air dried at room temperature for 1 day and stored at-80 ℃.
47 parts of peripheral blood samples, 56 parts of menstrual blood samples, 10 parts of saliva samples, 10 parts of semen samples and 10 parts of vaginal secretion samples (total 133 parts) are randomly selected for subsequent experiments.
II, obtaining cDNA
1. Total RNAs of 133 samples were extracted using the miRNeasy Mini Kit, respectively, to obtain Total RNAs of 133 samples.
The sample dosage is respectively as follows: peripheral blood 200. mu.L, saliva 2mL, semen 350. mu.L, menstrual blood 1cm2Sanitary napkin, vaginal secretion 1cm2A sanitary napkin.
2. After completion of step 1, 133 samples of Total RNA were each (small) subjected to agarose gel electrophoresis (for the purpose of testing the integrity of 133 samples of Total RNA).
3. After step 2 was completed, 133 samples of Total RNA were taken and quantified using Nanodrop2000c (i.e. the concentration of Total RNA in 133 samples was measured).
4. After the step 3 is completed, respectively taking Total RNA (containing 100ng RNA) of 133 samples as templates, and carrying out Reverse transcription by adopting M-MLV Reverse transcriptase primer and stem-loop specific Reverse transcription primer to obtain corresponding cDNA.
The nucleotide sequences of the stem-loop specific reverse transcription primers are shown in Table 2.
TABLE 2
Figure RE-GDA0003280088360000081
The reaction system for reverse transcription was 20. mu.L consisting of template (containing 100ng RNA), 4. mu.L of 5 XFirst-Strand Buffer, 2. mu.L of DTT (0.1M), 1. mu.L of reverse transcriptase M-MLV, 1. mu.L of stem-loop specific reverse transcription primer (1. mu.M), 0.5. mu.L of dNTP mix (10mM), 0.2. mu.L of Recombinant
Figure RE-GDA0003280088360000082
RNase Inhibitor (40U/. mu.L) and nuclease-free water.
Reaction conditions for reverse transcription: 30min at 16 deg.C, 30min at 37 deg.C, 5min at 65 deg.C, and storing at 4 deg.C.
Reverse transcription was performed using M-MLV Reverse Transcriptase Kit using nuclease-free water as a template, and used as a negative control for eliminating contamination of exogenous genomic RNA during cDNA synthesis.
Establishment of method for identifying whether body fluid to be detected is peripheral blood, menstrual blood or non-blood
1. Real-time fluorescent quantitative PCR detection
And (3) respectively taking the cDNA obtained in the second step as templates, and carrying out real-time fluorescence quantitative PCR (three parallel samples are made for each template) by adopting a primer pair consisting of a general forward amplification primer and a specific reverse amplification primer of the target miRNA (hsa-miR-451a or hsa-miR-21-5 p). Real-time fluorescent quantitative PCR in QuantStudio TM7 Flex Real-Time PCR System.
The nucleotide sequences of the universal forward amplification primers and the specific reverse amplification primers are shown in Table 3.
TABLE 3
Nucleotide sequence (5 '-3')
Universal forward amplification primers GTGCAGGGTCCGAGGT(SEQ ID NO：5)
Specific reverse amplification primer of hsa-miR-451a CGGAAACCGTTACCATTACTGAG(SEQ ID NO：6)
Specific reverse amplification primer of hsa-miR-21-5p TCGGCTTAGCTTATCAGACTGATG(SEQ ID NO：7)
The reaction system of real-time fluorescent quantitative PCR is shown in Table 4.
TABLE 4
Components Volume of
Power SYBR GreenPCR Master Mix(2×) 5μL
General Forward amplification primers (concentration 10. mu.M) 0.25μL
Specific reverse amplification primer (concentration 10. mu.M) 0.25μL
Nuclease-free water 4μL
Form panel 0.5μL
Reaction conditions of real-time fluorescent quantitative PCR: 10min at 95 ℃; at 95 ℃ for 15s and 60 ℃ for 1min for 40 cycles; 15s at 95 ℃; the melting curve was analyzed at 60 ℃ for 1 min.
Replacing the cDNA obtained in the second step with nuclease-free water, keeping the other steps unchanged, and using the cDNA as a negative control to detect potential pollution.
2. The result of the real-time fluorescent quantitative PCR obtained in the step 1 is processed by QuantStudioTMReal-Time PCR Software V1.3 (product of Thermo Fisher Scientific, USA) output, namely Cq value of each sample. Cq values above 35 are considered to be non-specific amplifications.
3. Efficiency of amplification of primers
(1) And (3) replacing the Total RNA of the sample in the step (4) with the RNA (TaKaRa) of the hsa-miR-451a standard product with known initial copy number, and obtaining the cDNA of the hsa-miR-451a standard product in sequence without changing other steps.
(2) The cDNA of hsa-miR-451a standard was serially diluted 10-fold in 5 gradients with RNase-free water (TaKaRa) to obtain 5 dilutions. And then, respectively replacing the template in step 1 by 5 diluents in the step three, and obtaining Cq values of the 5 diluents without changing other steps. All gradient settings were averaged in 3 replicates.
(3) A linear relationship between the log dilution factor and the Cq mean was constructed. According to the formula E-10(-1/slope)-1 (E is amplification efficiency and slope k) calculating amplification efficiency.
Replacing the RNA of the hsa-miR-451a standard product with the RNA (TaKaRa) of the hsa-miR-21-5p standard product according to the steps, and obtaining the amplification efficiency of the hsa-miR-21-5p without changing other steps.
The results of the detection of hsa-miR-451a and hsa-miR-21-5p are shown in a and b of FIG. 1, respectively. The result shows that the amplification efficiency of hsa-miR-451a is 98.213%, the amplification efficiency of hsa-miR-21-5p is 99.635%, and the amplification efficiencies are both higher and similar in primer efficiency.
4. Standard curve
(1) And (3) replacing the Total RNA of the sample in the step (4) with the RNA (TaKaRa) of the hsa-miR-451a standard product with known initial copy number, and obtaining the cDNA of the hsa-miR-451a standard product in sequence without changing other steps.
(2) The cDNA of hsa-miR-451a standard was serially diluted 10-fold in 6 gradients with RNase-free water (TaKaRa) to obtain 6 dilutions. And then, respectively replacing the template in step 1 by 6 diluents in the step three, and obtaining Cq values of the 6 diluents without changing other steps. All gradient settings were averaged in 3 replicates.
(3) A standard curve of hsa-miR-451a is drawn according to the starting copy number logarithm (lgcopies/. mu.L) of hsa-miR-451a and the Cq mean value.
Replacing the RNA of the hsa-miR-451a standard product with the RNA (TaKaRa) of the hsa-miR-21-5p standard product according to the steps, and obtaining the standard curve of the hsa-miR-21-5p without changing other steps.
According to R2Values evaluate the linear relationship of the standard curve.
The standard curves for hsa-miR-451a and hsa-miR-21-5p are shown in c and d, respectively, in FIG. 1. The result shows that the standard curve R of hsa-miR-451a20.9954, standard curve R of hsa-miR-21-5p20.9976, both have a good linear relationship. The two standard curves substantially cover detectable Cq values with a large linear dynamic range.
5. And (3) substituting the Cq value of each sample in the step (2) into the standard curve in the step (4) to obtain the copy number of hsa-miR-451a and hsa-miR-21-5p in each sample, and then calculating 451/21Ratio (namely the copy number Ratio of hsa-miR-451a and hsa-miR-21-5p) of each sample according to the following formula:
Figure RE-GDA0003280088360000101
451/21Ratio is the copy number Ratio of miR-451a and miR-21-5p, and the copy number Ratio is calculated according to miR-451a and miR-21-5p standard curves respectively. Obtaining the average Cq value of miR-451a and miR-21-5p of a certain sample through real-time fluorescent quantitative PCR, substituting the average Cq value into respective standard curves to calculate the log value of the copy number, and converting the copy number according to the log value of the copy number. Of the two standard curves, -4.860 and-5.173 are the slopes of the standard curves, and 60.13 and 64.97 are the intercepts of the standard curves, the data are obtained from QuantStudio of real-time fluorescent quantitative PCRTMReal-Time PCR Software V1.3 andthe GraphPad Prism 8 software automatically calculated the output.
The Cq values of 133 samples of the target miRNA, Copies and 451/21Ratio of the target miRNA are shown in table 5.
TABLE 5
Figure RE-GDA0003280088360000102
Figure RE-GDA0003280088360000111
Figure RE-GDA0003280088360000121
Figure RE-GDA0003280088360000131
Note: SA is saliva, SE is semen, VA is vaginal secretion, PB is peripheral blood, and MB is menstrual blood.
6. After completion of step 5, statistical analyses were performed using SPSS 26.0 software, including Mann-Whitney U tests (nonparametric), with p <0.05 considered statistically significant. Receiver Operating Characteristics (ROC) curve is used for evaluating the capacity of ratio identification, and a johnson index (sensitivity + specificity-1) is used for determining a cut-off value of identification and the sensitivity (true positive rate, correctly determined as menstrual blood) and specificity (true negative rate, correctly determined as peripheral blood) of identification at the moment. Plots were made using GraphPad Prism 8 software.
The results of comparing 451/21 ratios of 47 peripheral blood samples, 56 menstrual blood samples, 10 saliva samples, 10 semen samples and 10 vaginal secretion samples are shown in fig. 1 e, the Ratio of blood samples (greater than 1) is significantly greater than the Ratio of non-blood samples (greater than 0 and less than 1), and the difference is significant (p < 0.0001). The comparison result of 451/21Ratio of 47 peripheral blood samples and 56 menstrual blood samples is shown in f in fig. 1, the Ratio of the peripheral blood samples is greater than that of the menstrual blood samples, i.e. the peripheral blood minimum (10.3352) is greater than the menstrual blood maximum (10.0667), and the Ratio distribution has significant difference (p < 0.0001). Therefore, 451/21Ratio has the ability to accurately distinguish between blood and non-blood, as well as menstrual blood and peripheral blood.
ROC results for blood and non-blood, and menstrual blood and peripheral blood discrimination are shown in g and h in fig. 1, respectively, and both curves have ideal discrimination effect with AUC of 1.000. In the discrimination between blood and non-blood, the cutoff value by the john index was 0.929, and both the sensitivity and the specificity were 1. In the discrimination between menstrual blood and peripheral blood, the cutoff value of the judgman index was 10.201, and both the sensitivity and specificity were 1. Therefore, if the 451/21Ratio of the unknown body fluid sample is greater than 0 and less than 0.929, the sample is non-blood; if 451/21Ratio is more than 0.929 and less than 10.201, then the menstruation is menstrual blood; if 451/21Ratio is greater than 10.201, peripheral blood is obtained.
Fourth, influence of other factors on the identification method established in step three
Although mirnas are well known for their stability, their expression has been reported to be affected by a variety of endogenous or exogenous factors, such as sex, age, period, exposure time, etc. However, the limitations of forensic materials make the above factors unavoidable in practical cases, and therefore, the ideal identification method needs to exclude the interference of irrelevant factors on the results. For this reason the inventors carried out the following experiments: grouping the peripheral blood samples in the step one according to gender (male or female) and age (less than 35 years old and more than 35 years old), grouping the menstrual blood samples according to age (less than 35 years old and more than 35 years old), randomly selecting 10 samples from each group of each body fluid to explore 451/21Ratio rule under the influence of gender and age; external validation was performed using other samples to further clarify the effect of menstruation and exposure time on 451/21 Ratio; randomly selecting 10 healthy female volunteers (with different 3-6 days of menstrual period), and collecting 38 periodic samples for menstrual period verification; 6 parts of peripheral blood and menstrual blood are randomly selected and placed for 0 day, 30 days, 180 days and 365 days at room temperature respectively to verify the exposure time.
In order to determine the influence rule of sex and age on the ratio, randomly selecting part from the existing samples for regular exploration. First, results of randomly selected 10 male peripheral blood samples and 10 female peripheral blood samples were analyzed, and 451/21Ratio results thereof are shown as a in fig. 2. The 451/21Ratio values of the male sample and the female sample are distributed similarly, and have no significant difference (p >0.05), namely the sex factor has no significant influence on the peripheral blood Ratio value. Next, 10 samples of peripheral blood and 10 samples of menstrual blood were randomly selected from each of the two age groups, and the 451/21Ratio results thereof are shown in b in fig. 2. The peripheral blood ratios were greater for both age groups than for menstrual blood (p <0.0001), and there was no cross-over between the groups.
To further clarify the effect of the comparative values of menstruation period and exposure time, 38 menstrual period samples of different days taken from 10 healthy female volunteers were used for validation, the 451/21Ratio results of which are shown in fig. 2 c. The ratio distribution of the whole menstrual period is similar to the data distribution of the menstrual blood sample in f in fig. 1, and the ratios of the menstrual blood samples on different collection days are all smaller than the ratio of the peripheral blood sample in f in fig. 1 (p is less than 0.0001), so that the identification rule of the menstrual blood and the peripheral blood is met. However, there was no clear rule between the ratio size and the different acquisition days. Next, the test was performed using samples of different exposure times of peripheral blood and menstrual blood, and the 451/21Ratio results thereof are shown as d in fig. 2. The ratio of peripheral blood on all exposure days is larger than the ratio of menstrual blood (p <0.0001), and the differentiation rule of menstrual blood and peripheral blood is met.
Fifth, accuracy identification
All samples for this experiment were provided by volunteers, and all samples were provided by unrelated individuals.
To further verify the accuracy of the method established in step three, 24 peripheral blood samples and 62 menstrual blood samples were randomly collected for external verification. The samples were collected according to the principle of informed consent and were ethically reviewed by the department of public Security, namely the center for evidence identification. Peripheral blood samples were collected by venipuncture and then placed in EDTA anticoagulant tubes and stored at-80 ℃. Menstrual blood samples were collected with a tampon 4 days before the menstrual cycle, air dried at room temperature for 1 day, and stored at-80 ℃.
The Cq values of 86 samples of miRNA, Copies and 451/21Ratio of miRNA are shown in table 6.
TABLE 6
Figure RE-GDA0003280088360000151
Figure RE-GDA0003280088360000161
Figure RE-GDA0003280088360000171
Note: SA is saliva, SE is semen, VA is vaginal secretion, PB is peripheral blood, and MB is menstrual blood.
The result shows that the method established in the third step can completely identify the peripheral blood and the menstrual blood, and the accuracy rate reaches 100 percent.
In summary, with a large number of verifications, menstrual blood and peripheral blood samples can be identified based on the 451/21Ratio and still be completely distinguishable under the influence of a variety of factors.
Example 2, example 1 method for sensitivity detection and reproducibility (reproducibility) evaluation
First, sensitivity detection
From the samples collected in step one of example 1, 3 samples were randomly selected from each body fluid, diluted in a 10-fold gradient of 100ng to 0.001ng, and used as substrates for reverse transcription to determine the detection limits of hsa-miR-451a, hsa-miR-21-5p and 451/21 Ratio. Cq values above 35 are considered to be non-specific amplifications.
The results are shown in fig. 2 as e and f. The results show that the minimum detection limit of peripheral blood and menstrual blood is 0.1ng of total RNA, the minimum detection limit of semen is 0.1ng of total RNA, and the minimum detection limit of saliva and vaginal secretion is 1ng of total RNA.
Second, evaluation of reproducibility
From the samples collected in step one of example 1, 5 peripheral blood samples and 5 menstrual blood samples were randomly selected and re-tested by different researchers on ABI 7500 Real-Time PCR (applied biosystems) to evaluate the reproducibility of this identification method between different researchers and between different platforms.
The result shows that the 451/21Ratio results obtained by the two experimental platforms both accord with the identification rule of menstrual blood and peripheral blood. It can be seen that the method established in example 1 has good reproducibility between different researchers and different experimental platforms.
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
<110> material evidence identification center of public security department
<120> a method for identifying whether a body fluid to be tested is peripheral blood, menstrual blood or non-blood
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 22
<212> RNA
<213> Artificial sequence
<400> 1
aaaccguuac cauuacugag uu 22
<210> 2
<211> 22
<212> RNA
<213> Artificial sequence
<400> 2
uagcuuauca gacugauguu ga 22
<210> 3
<211> 50
<212> DNA
<213> Artificial sequence
<400> 3
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacaactca 50
<210> 4
<211> 50
<212> DNA
<213> Artificial sequence
<400> 4
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgactcaaca 50
<210> 5
<211> 16
<212> DNA
<213> Artificial sequence
<400> 5
gtgcagggtc cgaggt 16
<210> 6
<211> 23
<212> DNA
<213> Artificial sequence
<400> 6
cggaaaccgt taccattact gag 23
<210> 7
<211> 24
<212> DNA
<213> Artificial sequence
<400> 7
tcggcttagc ttatcagact gatg 24

Claims (10)

1. A method for identifying whether a body fluid to be tested is peripheral blood, menstrual blood or non-blood, comprising the steps of:
(a1) obtaining 451/21Ratio in a number of blood samples and a number of non-blood samples; the 451/21Ratio is the copy number Ratio of hsa-miR-451a and hsa-miR-21-5 p;
the blood is menstrual blood or peripheral blood;
the non-blood is saliva, semen or vaginal secretion;
(a2) performing statistical analysis on the 451/21Ratio obtained in the step (a1) to obtain a jotans index cutoff value 1 for identifying blood and non-blood and a jotans index cutoff value 2 for identifying peripheral blood and menstrual blood; then, the following judgment is made:
if 0< 451/21Ratio of the body fluid to be detected < jodon index cutoff value 1, the body fluid to be detected is non-blood;
if the john index cutoff value 1< 451/21Ratio of the body fluid to be detected < john index cutoff value 2, the body fluid to be detected is menstrual blood;
if the 451/21Ratio of the body fluid to be detected is greater than the approximate exponential cutoff value 2, the body fluid to be detected is peripheral blood;
the method is useful for diagnosis and treatment of non-diseases.
2. A method for identifying whether a body fluid to be tested is blood or non-blood, comprising the steps of:
(b1) obtaining 451/21Ratio in a number of blood samples and a number of non-blood samples; the 451/21Ratio is the copy number Ratio of hsa-miR-451a and hsa-miR-21-5 p;
the blood is menstrual blood or peripheral blood;
the non-blood is saliva, semen or vaginal secretion;
(b2) performing statistical analysis on the 451/21Ratio obtained in step (b1) to obtain a john's index cutoff of 1 for identifying blood and non-blood; then, the following judgment is made:
if 0< 451/21Ratio of the body fluid to be detected < jodon index cutoff value 1, the body fluid to be detected is non-blood;
if the 451/21Ratio of the body fluid to be detected is greater than the approximate exponential cutoff value 1, the body fluid to be detected is blood;
the method is useful for diagnosis and treatment of non-diseases.
3. A method for identifying whether blood to be tested is menstrual blood or peripheral blood, comprising the following steps:
(c1) obtaining 451/21Ratio in a plurality of menstrual blood samples and a plurality of peripheral blood samples; the 451/21Ratio is the copy number Ratio of hsa-miR-451a and hsa-miR-21-5 p;
(c2) performing statistical analysis on the 451/21Ratio obtained in the step (c1) to obtain a joden index cutoff value 2 for identifying peripheral blood and menstrual blood; then, the following judgment is made:
if the 451/21Ratio of the blood to be detected is less than the Johnson index cutoff value 2, the blood to be detected is menstrual blood;
if the 451/21Ratio of the blood to be detected is greater than the approximate exponential cutoff value 2, the blood to be detected is peripheral blood;
the blood to be detected is menstrual blood or peripheral blood;
the method is useful for diagnosis and treatment of non-diseases.
4. A kit, which comprises a substance for detecting the copy number of hsa-miR-451a and hsa-miR-21-5p in body fluid to be detected;
the function of the kit is d1) or d 2):
d1) identifying whether the body fluid to be tested is peripheral blood, menstrual blood or non-blood;
d2) identifying whether the body fluid to be tested is blood or non-blood;
the blood is menstrual blood or peripheral blood;
the non-blood is saliva, semen or vaginal secretion.
5. A kit for identifying whether blood to be detected is menstrual blood or peripheral blood comprises a substance for detecting copy numbers of hsa-miR-451a and hsa-miR-21-5p in body fluid to be detected;
the blood to be detected is menstrual blood or peripheral blood.
6. The kit of claim 4 or 5, wherein: the substances comprise hsa-miR-451a stem-loop specific reverse transcription primers, hsa-miR-21-5p stem-loop specific reverse transcription primers, universal forward amplification primers, hsa-miR-451a specific reverse amplification primers and hsa-miR-21-5p specific reverse amplification primers;
the nucleotide sequence of the hsa-miR-451a stem-loop specific reverse transcription primer is shown in SEQ ID NO. 3;
the nucleotide sequence of the hsa-miR-21-5p stem-loop specific reverse transcription primer is shown in SEQ ID NO. 4;
the nucleotide sequence of the universal forward amplification primer is shown as SEQ ID NO. 5;
the nucleotide sequence of the specificity reverse amplification primer of hsa-miR-451a is shown in SEQ ID NO 6;
the nucleotide sequence of the specificity reverse amplification primer of hsa-miR-21-5p is shown in SEQ ID NO. 7.
7. The kit of claim 6, wherein: the kit also comprises hsa-miR-451a standard substance RNA and/or hsa-miR-21-5p standard substance RNA.
8. The application of the substances for detecting the copy number of hsa-miR-451a and hsa-miR-21-5p in the body fluid to be detected is d1), d2) or d 3):
d1) identifying whether the body fluid to be tested is peripheral blood, menstrual blood or non-blood;
d2) identifying whether the body fluid to be tested is blood or non-blood;
d3) identifying whether the blood to be detected is menstrual blood or peripheral blood;
the blood is menstrual blood or peripheral blood;
the non-blood is saliva, semen or vaginal secretion;
the use is for the diagnosis and treatment of non-diseases.
Use of hsa-miR-451a and hsa-miR-21-5p as d1), d2) or d 3):
d1) identifying whether the body fluid to be tested is peripheral blood, menstrual blood or non-blood;
d2) identifying whether the body fluid to be tested is blood or non-blood;
d3) identifying whether the blood to be detected is menstrual blood or peripheral blood;
the blood is menstrual blood or peripheral blood;
the non-blood is saliva, semen or vaginal secretion;
the use is for the diagnosis and treatment of non-diseases.
10. The method of claim 1 or 2, the kit of any one of claims 4 to 7 or the use of claim 8 or 9, wherein: the body fluid to be detected is peripheral blood, saliva, menstrual blood, semen or vaginal secretion.
CN202110947748.2A 2021-08-18 2021-08-18 Method for identifying whether body fluid to be tested is peripheral blood, menstrual blood or non-blood Active CN113584140B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110947748.2A CN113584140B (en) 2021-08-18 2021-08-18 Method for identifying whether body fluid to be tested is peripheral blood, menstrual blood or non-blood

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110947748.2A CN113584140B (en) 2021-08-18 2021-08-18 Method for identifying whether body fluid to be tested is peripheral blood, menstrual blood or non-blood

Publications (2)

Publication Number Publication Date
CN113584140A true CN113584140A (en) 2021-11-02
CN113584140B CN113584140B (en) 2023-11-28

Family

ID=78238361

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110947748.2A Active CN113584140B (en) 2021-08-18 2021-08-18 Method for identifying whether body fluid to be tested is peripheral blood, menstrual blood or non-blood

Country Status (1)

Country Link
CN (1) CN113584140B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117737262A (en) * 2024-02-21 2024-03-22 山东第一医科大学(山东省医学科学院) Application of miRNA marker in preparation of body fluid spot identification product

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150031574A1 (en) * 2012-02-23 2015-01-29 Sumitomo Bakelite Co., Ltd. Method for classification of test body fluid sample
US20180356405A1 (en) * 2015-09-29 2018-12-13 Essenlix Corp. Method of Detecting an Analyte in a Sample
CN110241192A (en) * 2019-07-11 2019-09-17 公安部物证鉴定中心 It is a kind of to identify that body fluid to be measured is non-blood, the method for menstrual blood or peripheral blood and its miRNA combination used
CN112980966A (en) * 2019-12-17 2021-06-18 公安部物证鉴定中心 Method for identifying whether body fluid to be detected is peripheral blood, menstrual blood, saliva, semen or vaginal secretion by using discriminant analysis
CN112980947A (en) * 2019-12-12 2021-06-18 中国科学院大连化学物理研究所 Primer and kit for detecting circulating microRNA (microribonucleic acid) related to lung cancer diagnosis and treatment

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150031574A1 (en) * 2012-02-23 2015-01-29 Sumitomo Bakelite Co., Ltd. Method for classification of test body fluid sample
US20180356405A1 (en) * 2015-09-29 2018-12-13 Essenlix Corp. Method of Detecting an Analyte in a Sample
CN110241192A (en) * 2019-07-11 2019-09-17 公安部物证鉴定中心 It is a kind of to identify that body fluid to be measured is non-blood, the method for menstrual blood or peripheral blood and its miRNA combination used
CN112980947A (en) * 2019-12-12 2021-06-18 中国科学院大连化学物理研究所 Primer and kit for detecting circulating microRNA (microribonucleic acid) related to lung cancer diagnosis and treatment
CN112980966A (en) * 2019-12-17 2021-06-18 公安部物证鉴定中心 Method for identifying whether body fluid to be detected is peripheral blood, menstrual blood, saliva, semen or vaginal secretion by using discriminant analysis

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ERIN K. HANSON 等: "The identification of menstrual blood in forensic samples by logistic regression modeling of miRNA expression", 《ELECTROPHORESIS》, vol. 0, pages 1 - 9 *
HONGXIA HE 等: "A stepwise strategy to distinguish menstrual blood from peripheral blood by Fisher’s discriminant function", 《INTERNATIONAL JOURNAL OF LEGAL MEDICINE》, pages 1 - 7 *
HONGXIA HE 等: "Identification of five types of forensic body fluids based on stepwise discriminant analysis", 《FORENSIC SCIENCE INTERNATIONAL: GENETICS》, pages 1 - 20 *
SOO-KYUNG PARK 等: "MiR 21-5p as a predictor of recurrence in young gastric cancer patients", 《JOURNAL OF GASTROENTEROLOGY AND HEPATOLOGY》, vol. 31, pages 1429 - 1435 *
何红霞 等: "基于microRNA 表达量及判别分析的外周血与月经血鉴别", 《法医学杂志》, vol. 36, no. 4, pages 514 - 518 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117737262A (en) * 2024-02-21 2024-03-22 山东第一医科大学(山东省医学科学院) Application of miRNA marker in preparation of body fluid spot identification product

Also Published As

Publication number Publication date
CN113584140B (en) 2023-11-28

Similar Documents

Publication Publication Date Title
CN107586884B (en) RT-PCR primer group for detecting feline infectious peritonitis virus, kit containing primer group and application of kit
CN103397107B (en) Bovine viral diarrhea virus (BVDV) fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit
He et al. A stepwise strategy to distinguish menstrual blood from peripheral blood by Fisher’s discriminant function
Rhodes et al. Developmental validation of a microRNA panel using quadratic discriminant analysis for the classification of seven forensically relevant body fluids
CN114410810B (en) Kit for detecting non-tuberculous mycobacteria, detection method and application thereof
CN113584140A (en) Method for identifying whether body fluid to be detected is peripheral blood, menstrual blood or non-blood
CN110241192B (en) Method for identifying whether body fluid to be detected is non-blood, menstrual blood or peripheral blood and miRNA combination used in method
CN102925558A (en) Kit for detecting mRNA expression level of PML-RARa fusion gene
CN111850106B (en) Method for judging blood mark formation time in forensic medicine by detecting RNA degradation degree
WO2021043139A1 (en) Primer group for obtaining cfdna standard product, pcr amplification positive standard product and preparation method therefor, and kit and application
CN112980966A (en) Method for identifying whether body fluid to be detected is peripheral blood, menstrual blood, saliva, semen or vaginal secretion by using discriminant analysis
CN117233400A (en) KCNN3 gene detection kit for diagnosis and prognosis evaluation of multiple myeloma and application thereof
CN107723343B (en) Method for quantitative analysis of gene
CN107873058B (en) Detection of nucleic acid molecules
CN114525349A (en) Method for identifying semen by using digital PCR and special kit thereof
CN103555839B (en) Urinary sediment cell kidney fibrosis detection chip based on real-time fluorescent PCR (photo conductive relay)
CN108707663B (en) Reagent for cancer sample miRNA sequencing quantitative result evaluation, preparation method and application
CN106755392B (en) qPCR (quantitative polymerase chain reaction) method for rapidly and quantitatively detecting coelomacter in algae culture
TWI718474B (en) Method for estimating a risk for a subject suffering from urothelial carcinoma and kit thereof
KR102602133B1 (en) Kit for diagnosing metastasis of cervical cancer
CN103173553A (en) Fluorogenic quantitative polymerase chain reaction (PCR) detection assay kit for complementary deoxyribonucleic acid (cDNA) sequence of mouse beta-actin
WO2017118230A1 (en) Mirna marker for diagnosing osteosarcoma
CN109136403B (en) Reference gene and construction method for Caucasian clover PCR expression analysis
CN106755393B (en) qPCR (quantitative polymerase chain reaction) method for rapidly and quantitatively detecting Brachionus brachialis in algae culture
Van Der Hofstadt et al. Assessment of salivary microRNA by RT-qPCR: Challenges in data interpretation for clinical diagnosis

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant