CN103555839B - Urinary sediment cell kidney fibrosis detection chip based on real-time fluorescent PCR (photo conductive relay) - Google Patents

Abstract

The invention relates to an mRNA (messager ribonucleic acid) detection chip related to the urinary sediment cell kidney fibrosis based on a real-time fluorescent PCR (photo conductive relay). The chip is used for extracting total RNA in urine and reversely transcribing the total RNA into complementary deoxyribonucleic acid (cDNA), and the cDNA is subjected to the real-time fluorescent PCR chip reaction, data analysis (double delta Ct method) and statistical analysis to find a differential expression mRNA. The urinary sediment cell kidney fibrosis detection chip can be noninvasively, rapidly, conveniently, high-efficiently, sensitively and repeatedly used for detecting the kidney fibrosis specificity mRNA, the established method is mainly used for detecting the urinary sediment cell mRNA and is a non-invasive detection method and high in detection accuracy. In addition, by adopting the method, fewer RNA samples are consumed, the concentration range of the detected samples is wide, the detection requirement can be met by adopting microgram-grade content of RNA, and the method is high in stability and good in repetition.

Description

Based on the arena cell renal fibrosis detection chip of real-time fluorescence PCR

Technical field

The invention belongs to the foundation of chronic renal disease renal fibrosis urinary biomarkers thing research method, particularly a kind of structure of urine specificity messenger RNA (mRNA) detection technique based on real-time fluorescence quantitative PCR chip method.

Background technology

Real-time fluorescence PCR technology is a kind of DNA(or RNA) amplification technique, it is highly sensitive, selectivity is strong, in conjunction with high resolving power melting curve analysis or fluorescence probe, can greatly reduce mispairing rate, avoid false positive, is the goldstandard of gene quantification.In clinical practice, be different from the protein product of traditional technique in measuring gene, the expression of real-time fluorescence PCR technology direct gene detection, be widely used in clinical research: comprise pathogen gene detection, cancer gene detection, hereditary disease genetic test etc., the selection for clinical stages, judging prognosis and therapeutic scheme is significant.PCR target gene chip requires to choose the target molecule relevant to a certain theme according to research usually, can realize more effective, special biomarker screen, quantitatively more accurate to gene expression, is the Perfected process studying specific gene expression at present.Kidney is the important filtration of body and excretory organs, renal lesions can be reflected in the change of its excreta composition, contain large number of biological information in urine and there is the advantage without extra earning collection, sample disposal relative ease, therefore, utilize contain in urine enrich biological information, by setting up novel, responsive high flux detection technique, realize to renal fibrosis without wound, dynamic monitoring provides brand-new technological means.And there is no the report that PCR-based chip technology detects renal fibrosis specific mrna method structure in urine at present.

Summary of the invention

The object of the invention is the inhereditary material extracting kidney cast-off cells from freshly voided urine, pass through real time fluorescent PCR method, disposable high flux detects in renal fibrosis forming process, plays the gene of key effect, and carries out correlation analysis to the expression of gene.Product is that one utilizes PCR orifice plate as pcr chip, every chip block detects 1 sample, adopt the method for real-time fluorescence PCR to detect the expression of marker gene in experimenter's sample, utilize computer software to assess experimenter and whether suffer from renal fibrosis and the order of severity thereof.

The technical scheme adopted is:

Based on the arena cell renal fibrosis detection chip of real-time fluorescence PCR, it is characterized in that, comprise the primer corresponding to following 3 relevant mRNA of renal fibrosis: ACE, CD71, CCL5 (RANTES).

When using this chip, be after needing that the mRNA reverse transcription of extracting kidney cast-off cells in freshly voided urine is cDNA, then carry out real-time fluorescent PCR amplification and determination and analysis is carried out to gene expression.

Design of primers principle is:

According to Gene Name, on NCBI, detect corresponding gene sequences by GENEBANK, with PRIMER Software for Design primer.Principle of design according to primer:

1) T of all primers _mbe worth close, can under same PCR condition high-level efficiency amplification gene;

2) primer designed by does not comprise SNP site, not in repetitive sequence district;

3) often pair of primer selectivity amplification target fragment;

4) design of primers is in the conserved region of expressing gene;

5) primer dimer, hairpin structure or mispairing is avoided;

6) primer length is designed to 18bp-25bp;

7) the GC content of primer controls 35 ~ 70%.

8) design primer, select primer according to Blast analysis result, pcr amplification gene outcome cut to lengthen is at 60 ~ 300bp.

The above-mentioned primer corresponding to 3 genes, through a large amount of tests and optimization, can adopt the primer described in table 1, the corresponding forward primer of each gene and a reverse primer.

Table 13 primer that renal fibrosis related gene is corresponding

Further, above-mentioned chip can adopt PCR orifice plate as carrier, such as 96 hole PCR plate etc., and a forward primer corresponding to each gene and a reverse primer are added in a hole and carry out pcr amplification.

Further, when carrying out real-time fluorescent PCR amplification, also need to carry out corresponding pcr amplification to house-keeping gene, those skilled in the art can adopt conventional house-keeping gene as reference, for the standardization of pcr chip data, in the present invention, preferably adopt 3 following house-keeping genes as reference gene: B2M, ACTB, GAPDH.Preferred, be using the mean value of above-mentioned 3 house-keeping gene expressions as reference point.Forward primer corresponding to each house-keeping gene and reverse primer are also be added in a hole to carry out pcr amplification.

For above-mentioned reference gene, following forward primer and reverse primer can be adopted to increase:

B2M：

Forward primer 5'->3'AGGCTATCCAGCGTACTCCA (SEQIDNO.7)

Reverse primer 5'->3'CACGGCAGGCATACTCATCT (SEQIDNO.8)

ACTB：

Forward primer 5'->3'TGGCACCCAGCACAATGAA (SEQIDNO.9)

Reverse primer 5'->3'CTAAGTCATAGTCCGCCTAGAAGCA (SEQIDNO.10)

GAPDH：

Forward primer 5'->3'GGAGCGAGATCCCTCCAAAAT (SEQIDNO.11)

Reverse primer 5'->3'GGCTGTTGTCATACTTCTCATGG (SEQIDNO.12)

Further, also comprise reverse transcription contrast in above-mentioned chip, for detecting reverse transcription efficiency, reverse transcription contrast can add separately in a hole.

Further, in above-mentioned chip, also include genomic DNA control, the non transcribed genomic DNA fragment of the specific detection of energy, thus detect the content of remaining genomic DNA in sample.

Further, in above-mentioned chip, also including negative control, whether having pollution for detecting reflection environment.

Further, also positive control is included in above-mentioned chip.Reflect the efficiency of PCR reaction, also also to may be used between detection chip and consistance in chip.

Further, the configuration of above-mentioned chip reaction system in each hole can be:

Table 2 reaction system configures

Reagent component	Single reacting dose	Final concentration
			qPCRMasterMix(2×)	10μl	1×
cDNA	1μl
			ddH 2O	Complement to 20 μ l

Archaeal dna polymerase, dNTPs, Mg is included in qPCR Master Mix ²⁺, fluorescent dye, forward primer and reverse primer; Wherein the volume of forward primer and reverse primer is about 2 μ l (2.5 μMs) respectively.

The using method of chip provided by the present invention is:

1st step, collects cell specimen in urine;

2nd step, extracts the RNA in cell specimen;

RNA reverse transcription is cDNA by the 3rd step;

4th step, carries out real-time fluorescent PCR amplification to cDNA sample;

5th step, detects pcr amplification, calculates gene expression amount;

6th step, carries out statistical analysis to the gene expression amount of testing sample and the gene expression amount of normal specimens, judges whether testing sample and normal specimens have significant difference.

In the 1st above-mentioned step, conventional centrifuge method can be adopted to obtain the sediment containing cell sample in urine.

In the 2nd above-mentioned step and the 3rd step, can adopt conventional RNA extraction method from cell sample, obtain RNA sample, reverse transcription also can be undertaken by the kit of routine.

In the 4th above-mentioned step, when real-time fluorescent PCR amplification is carried out to cDNA, following program can be adopted:

Table 3 real-time fluorescence PCR program

Period	Step	Temperature	Time
				1	Denaturation	95℃	5min
	Sex change	95℃	15sec
				40	Annealing	60℃	32sec
	Extend	72℃	32sec

In the 4th above-mentioned step, after PCR EOP (end of program), melting curve (dissociationcurve, DC) can also be set up and identifies product specificities.The program of melting curve setting is as follows:

Table 4 melting curve program

Step	Temperature	Constant temperature time	Programming rate
					95℃	15sec	4.4℃/sec
Melting curve	60℃	1min	2.2℃/sec
					95℃	15sec	0.11℃/sec
Cooling	40℃	30sec

In the 6th above-mentioned step, compare threshold method (2 can be adopted ^{-Δ Δ Ct}) method carries out computational analysis to gene expression amount, that is:

The inverse of [(check-out console gene ct value-check-out console reference gene ct value)-(control board gene ct value-control board reference gene ct value)] power of 2.Wherein,

1) each target gene relative expression quantity adopts Δ Ct (relative cycle value) to represent, Δ Ct _{target gene}=Ct _{target gene}-Ct _{same sample house-keeping gene}

Using the average of selected 3 house-keeping gene ct values as marking of correction radix measurement result.

2) group difference of each gene expression is labeled as Δ Δ Ct.Formula: Δ Δ Ct=Δ Ct (test set)-Δ Ct (control group).By calculating 2 ^{-Δ Δ Ct}the relatively differential expression of two groups of genes.When certain 2 ^{-Δ Δ C}time t value≤O.5 (downward) or>=2 (rise), think that the differential expression of this gene between two groups has statistical significance.

The derivation of △ △ Ct method

PCR exponential amplification formula is:

Xn=X0*(1+Ex)n [1]

In formula, Xn is target molecule number after the n-th circulation, and Xo is initial target molecular number, and Ex is amplified target molecule efficiency, and n is period.Represent target amplification product with Ct and reach the period setting threshold value and experience, therefore:

Xt=X0*(1+Ex)Ctx [2]

In formula, Xt is the molecular number of target molecule X when reaching the threshold value of setting, is a constant.Ctx is target molecule X amplification period of (when reaching the copy number of regulation) when reaching threshold value.

PCR for house-keeping gene reacts, and also has same formula:

Rt=R0*(1+ER)CtR [3]

In formula, ER is house-keeping gene R amplification efficiency.Rt is the molecular number of house-keeping gene R when reaching the threshold value of setting, for using the real-time amplification of Taqman probe, the value of Xt and Rt is determined by series of factors: comprise probe with fluorescence report group, probe sequence is on the setting of the impact of fluorescence probe characteristic, the hydrolysis efficiency of probe and purity and fluorescence threshold.Therefore Rt might not equal Xt.

Hypothetical target sequence is identical with house-keeping gene amplification efficiency, EX=ER=E, and with target molecule number (constant) divided by house-keeping gene molecular number (constant), i.e. the expression ratio K of target molecule and house-keeping gene, K is a constant.

K=Xt/Rt=[X0*(1+E)Ctx]/[R0*(1+E)CtR]=（X0/R0）*(1+E)Ctx-CtR [4]

Ctx-CtR is called △ Ct, (X0/R0) is called the molecular number ratio of XN(initial target sequence and house-keeping gene, the initial target molecular number after its meaning is through and is corrected by internal reference), arrange above formula and obtain:

XN=K*(1+E)-△Ct [5]

Finally obtain divided by the XN with reference to the factor (calibrator, cb) (the reference factor can be normal control also can be relative comparison) with the XN of arbitrary sample q:

XN,q/XN,cb=[K*(1+E)-△Ctq]/[K*(1+E)-△Ct,cb]=(1+E)–(△Ctq-△Ct,cb) [6]

So by △ Ctq-△ Ct, cb is called △ △ Ct, this data analysing method is called △ △ Ct method.

For an am-plified fragments being less than 150bp, if Mg ²⁺concentration, primer have all carried out suitable optimization, and amplification efficiency E is close to 1.Therefore the number of target sequence after being corrected by internal reference relative to for the factor is exactly

Initial target gene number/initial reference because of subnumber XN, q/XN, cb=2-△ △ Ct

Arrangement formula [5], XN/K=2-△ Ct

Constant K=Xt/Rt, when K ≠ 1, when namely reaching threshold value, target gene number ≠ house-keeping gene number, its meaning is after elimination experiment processes the factor of the target gene number ≠ house-keeping gene number caused, initial target gene number/initial house-keeping gene number; As K=1, XN=2-△ Ct.

In general, the standard of statistical analysis is: utilize T to check the difference compared between two groups, think fold differences >2 doubly or <-2 doubly and P<0.05, think there is statistical significance.

Owing to employing 3 reference genes in the chips, when calculating Δ Δ Ct value, the expression numerical value of each genes of interest carries out calculating with the average expression amount of three reference gene.

More preferably, be form associating mark to the relative expression quantity of 3 genes of interest to judge, the computing formula of associating mark is as follows:

Equation $Y=105.986\&times;{\left(2^{{-\mathrm{\&Delta;}}_{\mathrm{Ct}}}\right)}_{\mathrm{ACE}}+14.465\&times;{\left(2^{{-\mathrm{\&Delta;}}_{\mathrm{Ct}}}\right)}_{\mathrm{CCL}5}+5.156\&times;{\left(2^{{-\mathrm{\&Delta;}}_{\mathrm{Ct}}}\right)}_{\mathrm{CD}71}-1.394$

In above formula, in △ Ct refer to the expression of ACE gene and reference gene expression difference;

Similar, in △ Ct refer to the expression of CCL5 gene and reference gene expression difference;

in △ Ct refer to the expression of CD71 gene and reference gene expression difference;

Decision threshold is taken as-5.68 × 10 ^-1, when equation calculated value is more than or equal to this threshold value, think normal, when the calculated value of equation is less than this threshold value, think ill i.e. renal fibrosis.

The present invention can quick, sensitive, early stage, human blood glucose renal fibrosis to be correlated with mRNA, can be used for discovery and the checking of renal fibrosis gene marker.The reason producing this advantage and following factor are about 1, the acquisition of sample: urine specimen can obtain without new discovery, and it is easy to collect processing procedure, and containing deriving from kidney cast-off cells in a large number in urine, for research provides material; 2, adopt real-time fluorescence quantitative PCR to detect the expression of gene, sensitive, single-minded, quantification range is wide, operates without the need to rear PCR, avoids the pollution of experimentation; 3, one piece of pcr chip detects multiple key gene relevant to kidney injury simultaneously, can find expeditiously and

The gene marker of checking kidney injury; 4, this core is in use, adopts three genes to form associating mark,

Detection accuracy for sufferer is high.

Accompanying drawing explanation

Fig. 1 is the pcr chip schematic diagram detecting arena cell mRNA.

Fig. 2 chip sensitivity testing.

Fig. 3 chip specific assay---89 gene melting curves.

Fig. 4 chip repeatability measures.

Fig. 5 is 6 species diversity genes and clinical indices serum creatinine, eGFR, fibrosis area correlation analysis.

Fig. 6 is the ROC analysis chart of 5 species diversity genes

Fig. 7 is the use step schematic diagram of chip.

Embodiment

By reference to the accompanying drawings the present invention is described in further detail below by embodiment.But it will be understood to those of skill in the art that the following example only for illustration of the present invention, and should not be considered as limiting scope of the present invention.Unreceipted concrete technology or condition person in embodiment, (such as show with reference to J. Pehanorm Brooker etc. according to the technology described by the document in this area or condition, " Molecular Cloning: A Laboratory guide " that Huang Peitang etc. translate, the third edition, Science Press) or carry out according to product description.Agents useful for same or the unreceipted production firm person of instrument, being can by the conventional products of commercial acquisition.

In research process, first have chosen 89 genes relevant with renal fibrosis as investigation object, the Genebank registration number of genes of interest and full name are see table 5.

The Genebank registration number of a table 589 renal fibrosis related gene and full name

Design of primers principle is:

According to Gene Name, on NCBI, detect corresponding gene sequences by GENEBANK, with PRIMER Software for Design primer.Principle of design according to primer:

1) the Tm value of all primers is close, can under same PCR condition high-level efficiency amplification gene;

2) primer designed by does not comprise SNP site, not in repetitive sequence district;

3) often pair of primer selectivity amplification target fragment;

4) design of primers is in the conserved region of expressing gene;

5) primer dimer, hairpin structure or mispairing is avoided;

6) primer length is designed to 18bp-25bp;

7) the GC content of primer controls 35 ~ 70%.

8) design primer, select primer according to Blast analysis result, pcr amplification gene outcome cut to lengthen is at 60 ~ 300bp.

The above-mentioned primer corresponding to 89 genes, through a large amount of tests and optimization, can adopt the primer described in table 2, and each gene has a forward primer and a reverse primer.

Table 689 primer that renal fibrosis related gene is corresponding

The checking of embodiment 1PCR amplification condition

Step 1, the collection of urine specimen: leave and take patient's freshly voided urine 200-300ml, urine is centrifugal, centrifugal force is 3000g, temperature 4 DEG C, centrifugal 30 minutes, abandon supernatant, cell sediment Eddy diffusion is in 1ml pyrocarbonic acid diethyl ester-PBS damping fluid (pyrocarbonic acid diethyl ester and PBS damping fluid by volume 1:1000 are prepared), obtain suspending liquid, suspending liquid to be placed on hydro-extractor and to be 12000g at centrifugal force, at temperature 4 DEG C, centrifugal 5 minutes, abandon supernatant, 1ml RNAiso Plus(TAKARA is added in residue sediment, Dalian, China), abundant mixing, obtain the mixed liquor of sediment and RNAiso Plus,

Step 2, Total RNAs extraction step: the mixed liquor of described sediment and RNAiso Plus is placed on hydro-extractor by step 2.1 and at centrifugal force is 12000g, temperature 4 DEG C, centrifugal 5 minutes, Aspirate supernatant, proceeded to new centrifuge tube; Step 2.2 adds 200 μ l chloroforms in the supernatant obtained by step 2.1, covers tightly centrifuge tube, thermal agitation 15 seconds, and after solution is fully emulsified and lamination disappears, then room temperature leaves standstill 5 minutes, obtains suspension; The suspension that step 2.2 obtains by step 2.3 to be placed on hydro-extractor and at centrifugal force is 12000g, temperature 4 DEG C, centrifugal 5 minutes; Step 2.4 takes out centrifuge tube, and Aspirate supernatant is transferred in another new centrifuge tube; Step 2.5 adds equal-volume isopropyl alcohol in the supernatant obtained by step 2.4, after the centrifuge tube that turns upside down fully mixes, leaves standstill 10 minutes, obtain mixed liquor at 15-30 DEG C; The mixed liquor that step 2.5 obtains by step 2.6 to be placed on hydro-extractor and at centrifugal force is 12000g, temperature 4 DEG C, centrifugal 5 minutes; Step 2.7 supernatant discarded, add along centrifugal tube wall the ethanol 1ml that volumetric concentration is 75%, turn upside down washing centrifuge tube, to be placed on hydro-extractor and at centrifugal force is 12000g, temperature 4 DEG C, to discard ethanol after centrifugal 5 minutes, obtains RNA precipitation; Step 2.8 drying at room temperature RNA precipitates 2-5 minute, adds 30ulRnase-free water, and precipitate with liquid-transfering gun piping and druming RNA and make it dissolve, obtain RNA solution, recycling ultraviolet spectrophotometer (Nanodrop, Thermo, USA) measures RNA concentration and purity;

Step 3, reverse transcription: reaction system: the RNA solution described in 1ug step 2.8,1 μ l500ng/uloligo (dT) ₁₈, 0.3 μ l500ng/ul random ₉, 1 μ l10mM dNTP Mix; aqua sterilisa mixing is to 13 μ l; 65 DEG C of water-baths placed at least 1 minute on ice after 5 minutes; of short duration centrifugal after; add successively in centrifuge tube: 4 μ l5X First-Strand Buffer, 1 μ l0.1MDTT, 1 μ l RNase Ihibitor, 1 μ l SuperScript.IIIRT(invitrogen; the U.S.); liquid-transfering gun is inhaled gently to beat and is mixed several times; 50 DEG C of incubations 60 minutes; 70 DEG C of incubations make enzyme deactivation in 15 minutes; every 20 μ lcDNA add the mixing of 91ul aqua sterilisa, put stand-by or-20 DEG C of preservations of ice bath;

Step 4, preparation pcr chip;

As Fig. 1,96 orifice plates are utilized to build pcr chip, 89 kinds of gene primers are separately fixed on chip, A1-H5 is selected 89 kinds and relevant gene to occur to renal fibrosis and is in progress, H6-H8 is 3 kinds of house-keeping genes B2M, ACTB, GAPDH, for the standardization of pcr chip data, H9:RTC hole and reverse transcription contrast, for detecting reverse transcription efficiency.H10:GDC hole is genomic DNA control; the primer of the non transcribed genomic DNA of the specific detection of embodied energy; thus the content of remaining genomic DNA in detection sample; H11:BLANK(H2O) whether pollution is had for detecting reflection environment; H12:PPC hole is that positive PCR is with reference to (PPC); add the DNA sequence dna of Prof. Du Yucang and corresponding primer in this hole, reflect the efficiency of PCR reaction, also also to may be used between detection chip and consistance in chip;

The forward primer sequence that PPC uses is: 5'->3'CAGCCACACTGTCCCCATCTA;

Reverse primer sequences is: 3'->5'AGCAAGGTCGAGACGAAGGA;

The sequence of PPC is:

CAGCCACACTGTCCCCATCTATGAAGGATATGCTCTCCCCCATGCTATCCTTCGTCTCGACCTTGCT

Step 5, real-time fluorescence quantitative PCR react: pcr chip reaction system: the cDNA that 100 μ l have diluted, 1ml qPCR Master Mix (2 ×), 900 μ l ddH ₂o is being mixed into the mixed liquor that cumulative volume is 2ml, add in each hole corresponding to 20 μ l to PCR Array, pcr amplification: 1. PCR reaction system is heated to 95 DEG C and carries out denaturation, reaction 5min, 2. at 95 DEG C, be cooled to 60 DEG C of annealing reaction 32s after reaction of degeneration (RD) 15s, and be a circulation with 72 DEG C of extension 32s, so amplification 40 circulations, finally set up melting curve (dissociation curve, DC) by the program of table 5 and identify product specificities;

The composition of qPCR Master Mix is Hot-start Taq DNA polymerase, dNTP Mixture, Mg ²⁺, SYBR Green, forward primer and reverse primer; Wherein forward and reverse primer total amount is be 2.5 μMs respectively respectively, and volume is 2 μ l.

In step 6, the data importing computer software of specifying that experiment is produced, adopt 2-Δ Δ ct method, show that measurement result adopts compare threshold method (2 ^{-Δ Δ Ct}) method carries out computational analysis to gene expression amount, that is: the inverse of [(check-out console gene ct value-check-out console reference gene ct value)-(control board gene ct value-control board reference gene ct value)] power of 2.Wherein,

1) each target gene relative expression quantity adopts Δ Ct (relative cycle value) to represent, Δ Ct _{target gene}=Ct _{target gene}-Ct _{same sample house-keeping gene}, using the average of selected 3 house-keeping gene ct values as marking of correction radix measurement result,

2) group difference of each gene expression is labeled as Δ Δ Ct, formula: Δ Δ Ct=Δ Ct (test set)-Δ Ct (control group),

3) by calculating 2 ^{-Δ Δ Ct}the relatively differential expression of two groups of genes, when certain 2 ^{-Δ Δ Ct}value≤O.5 (downward) or>=2 (rise) time, think that the differential expression of this gene between two groups has statistical significance;

Step 7, sensitivity Detection: chip susceptibility represents with the positive signal ratio of each sample all kinds of genes of interest (the gene percentage example of Ct<35) usually.The positive signal ratio of samples as all in Fig. 2 is all greater than 80%, has the positive signal ratio of 34 samples to be greater than 95% in 36 samples, and it is high that positive signal ratio is greater than 80% explanation chip susceptibility;

Step 8, specific detection: the usual reaction chip specificity of melting curve.Melting curve analysis is unimodal as shown in Figure 3, points out each gene outcome specificity good;

Step 9, repeatability detect: PPC hole is commonly used to reflect between the plate of chip and plate and often organizes the repeatability between testing.Experimental result shows as shown in Figure 4: PPC Ct value is all 20.7 ± 0.35, and coefficient of dispersion is only 1.69%, show utilize customization pcr chip carry out fluorescent quantitation experiment, between plate and plate, often group experiment between reproducible.

This chip of embodiment 2 is used for the detection of sufferer sample

Relatively IgA nephrotic and normal healthy controls urine fiberization are correlated with mrna expression difference: select 30 routine pathology of the renal biopsies to confirm to be diagnosed as the patient of primary IgAN.Main exclusion standard: age <18 one full year of life; Infect; Pregnant woman; Wound or operation; Once the medicines such as glucocorticoid, immunodepressant, angiotensin converting enzyme inhibitor (ACEI) and (or) angiotensin ii receptor blocker (ARB) were taken; And the Secondary cases lgA ephrosis that systemic loupus erythematosus, anaphylactoid purpura, hepatitis B, tumour, colitis, psoriasis, erythema nodosum, herpetic dermatitis etc. cause.

Select without hypertension, non-diabetic, without albuminuria and kidney function damage, normal adults 6 example in contrast simultaneously.

Method according to the sample collection in embodiment 1, RNA extraction, reverse transcription, real-time fluorescence PCR detects sample.

Finally, data analysis adopts Δ Δ Ct method:

1) each target gene relative expression quantity adopts Δ Ct (relative cycle value) to represent, Δ Ct _{target gene}=Ct _{target gene}-Ct _{with one sample house-keeping gene}, using the average of selected 3 house-keeping gene ct values as marking of correction radix measurement result,

2) group difference of each gene expression is labeled as Δ Δ Ct, formula: Δ Δ Ct=Δ Ct (test set)-Δ Ct (control group), in the present embodiment, Δ Δ Ct=Δ Ct (IgA nephrotic group)-Δ Ct (normal healthy controls group);

Step 8, statistical study: utilize T to check the difference compared between two groups, fold differences in two groups of 89 genes and T assay is as shown in table 7 (only lists 20 genes that correlativity is high in table, decision rule is: think fold differences >2 doubly or <-2 doubly and P<0.05, have statistical significance).

In table 7 embodiment 2,20 genes have the differential gene of statistical significance in two groups.

Gene Clustering	Gene Name	Fold differences
			Sertoli cell is correlated with	PODXL	3.19
RASS system is correlated with	ACE	3.76
				REN	-6.29
EMT is correlated with	TGF-β1	2.14
				FN1	2.18
	VIM	6.15
			Tubular damage is correlated with	CD71	2.10

	TF	-2.13
				FABP	-4.42
	NGAL	-5.82
			Cell factor	TNFSF13	2.06
	TNF-α	2.09
				MMP9	2.34
	MMP2	2.45
				PDGFB	2.88
	PAI-1	3.65
				MCP-1	4.88
	RANTES	5.30
			Signal path is correlated with	SNAI-1	5.04
Apoptosis is correlated with	P53	3.28

As can be seen from the table, the expression of some genes has obvious difference between sufferer and normal sample, and the expression of some genes has the difference of conspicuousness in two samples.

Define following decision rule: when certain 2 ^{-Δ Δ Ct}value≤O.5 (downward) or>=2 (rises), i.e. fold differences>=2 times or≤-2 times, and P<0.05, from 89 genes, find following 20 genes to meet this rule: PODXL, ACE, REN, TGF-β 1, FN1, VIM, CD71, TF, FABP, NGAL, TNFSF13, TNF-α, MMP9, MMP2, PDGFB, PAI-1, MCP-1, RANTES, SNAI-1, P53.

Adopt the clinical indices data of above 36 samples, carry out the discovery of Spearman correlation analysis, in 20 species diversity genes, 6 kinds of genes: ACE, CD71, PODXL, CCL5 (RANTES), VIM, FN1 are simultaneously and clinical indices: serum creatinine serum creatinine (A), eGFR (B), fibrosis area scoring fibrosisarea% (C) correlativity is good, and correlation analysis is shown in Fig. 5.

Next, ROC curve assessment and good above 6 kinds of mRNA (ACE, the CD71 of clinical indices correlativity are utilized, PODXL, CCL5, FN1, VIM), wherein ACE, CD71, PODXL, CCL5 (RANTES), VIM have the ability distinguishing ill group and normal group.As shown in Figure 6, ACE, CD71, PODXL, CCL5, and VIMmRNA build ROC area under curve (AUC) be respectively 0.814(95% credibility interval, 0.641 – 0.987, P=0.01), 0.795 (95% credibility interval, 0.640 – 0.951, P=0.02), 0.736 (95% credibility interval, 0.535 – 0.937, P=0.03), 0.832 (95% credibility interval, 0.653 – 1.011, P=0.01), 0.777 (95% credibility interval, 0.601 – 0.954, P=0.02).

Next, pass through Fisher ' s linear discriminant analysis, good and have the gene of diagnostic value 5 correlativitys: to screen in ACE, CD71, PODXL, CCL5 (RANTES), VIM, and grope through a large amount of tests, find that its determination rate of accuracy is obviously better than other 5 genes by setting up associating discriminant equation (associating mark).The expression formula of associating discriminant equation is as follows:

Equation $Y=105.986\&times;{\left(2^{{-\mathrm{\&Delta;}}_{\mathrm{Ct}}}\right)}_{\mathrm{ACE}}+14.465\&times;{\left(2^{{-\mathrm{\&Delta;}}_{\mathrm{Ct}}}\right)}_{\mathrm{CCL}5}+5.156\&times;{\left(2^{{-\mathrm{\&Delta;}}_{\mathrm{Ct}}}\right)}_{\mathrm{CD}71}-1.394$

In above formula, in △ Ct refer to the expression of ACE gene and reference gene expression difference;

Similar, in △ Ct refer to the expression of CCL5 gene and reference gene expression difference;

in △ Ct refer to the expression of CD71 gene and reference gene expression difference;

Statistical analysis is carried out to the test figure of 36 samples, determines optimum decision threshold, be taken as-5.68 × 10 ^-1, when equation calculated value is more than or equal to this threshold value, think normal, when the calculated value of equation is less than this threshold value, think ill i.e. renal fibrosis.

By diagnostic evaluation, the evaluation of the diagnostic value of 5 genes and optimum discriminant equation is as shown in table 8.

Table 8 Diagnostic Value

As shown in table 8, utilize Gene A CE, CD71, PODXL, CCL5 (RANTES), VIM and associating mark equation Y to carry out diagnostic evaluation to 30 ill samples and 6 normal samples respectively.The accuracy rate of diagnosis of associating mark (equation Y), susceptibility, specificity, Youden index and ROC area under curve are respectively 84%, 82%, 90%, 0.72,0.88; All be better than the diagnostic value of individual gene.Therefore, this detection chip may be used for the detection to renal fibrosis sample.

SEQUENCE LISTING

 

<110> Southeast China University

<120> is based on the arena cell renal fibrosis detection chip of real-time fluorescence PCR

<130> none

<160> 12

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> artificial sequence

<400> 1

cgctggaggg tatttgatgg 20

<210> 2

<211> 23

<212> DNA

<213> artificial sequence

<400> 2

gatgtaaggc acgctagaag gaa 23

<210> 3

<211> 20

<212> DNA

<213> artificial sequence

<400> 3

gggaccagaa gccaaagact 20

<210> 4

<211> 20

<212> DNA

<213> artificial sequence

<400> 4

gtgccaaaag gacagaaagc 20

<210> 5

<211> 18

<212> DNA

<213> artificial sequence

<400> 5

ttgctactgc cctctgcg 18

<210> 6

<211> 18

<212> DNA

<213> artificial sequence

<400> 6

cacttggcgg ttctttcg 18

<210> 7

<211> 20

<212> DNA

<213> artificial sequence

<400> 7

aggctatcca gcgtactcca 20

<210> 8

<211> 20

<212> DNA

<213> artificial sequence

<400> 8

cacggcaggc atactcatct 20

<210> 9

<211> 19

<212> DNA

<213> artificial sequence

<400> 9

tggcacccag cacaatgaa 19

<210> 10

<211> 25

<212> DNA

<213> artificial sequence

<400> 10

ctaagtcata gtccgcctag aagca 25

<210> 11

<211> 21

<212> DNA

<213> artificial sequence

<400> 11

ggagcgagat ccctccaaaa t 21

<210> 12

<211> 23

<212> DNA

<213> artificial sequence

<400> 12

ggctgttgtc atacttctca tgg 23

 

Claims (7)

1. based on the arena cell renal fibrosis detection chip of real-time fluorescence PCR, it is characterized in that, comprise the primer that on following 3 mRNA, renal fibrosis related gene is corresponding: ACE, CD71, CCL5; The primer that 3 described renal fibrosis related genes are corresponding is: ACE:SEQ ID NO.1-2; CD71: SEQ ID NO. 3-4; RANTES: SEQ ID NO. 5-6.

2. the arena cell renal fibrosis detection chip based on real-time fluorescence PCR according to claim 1, it is characterized in that: described chip is using PCR orifice plate as carrier, a forward primer corresponding to each gene and a reverse primer are added in a hole.

3. the arena cell renal fibrosis detection chip based on real-time fluorescence PCR according to claim 1, it is characterized in that: also include the primer corresponding to 3 reference genes, described reference gene is B2M, ACTB, GAPDH.

4. the arena cell renal fibrosis detection chip based on real-time fluorescence PCR according to claim 1, it is characterized in that, the primer corresponding to each reference gene is: B2M: SEQ ID NO.7-8, ACTB:SEQ ID NO.9-10, GAPDH:SEQ ID NO.11-12.

5. the arena cell renal fibrosis detection chip based on real-time fluorescence PCR according to claim 1, is characterized in that: also include genomic DNA control.

6. the arena cell renal fibrosis detection chip based on real-time fluorescence PCR according to claim 1, is characterized in that: also include negative control and positive control.

7. the arena cell renal fibrosis detection chip based on real-time fluorescence PCR according to claim 2, is characterized in that: the reaction system configuration in every hole is: qPCR Master Mix 10 μ l, cDNA 1 μ l, ddH ₂o complements to 20 μ l, includes archaeal dna polymerase, dNTPs, Mg in described qPCR Master Mix ²⁺, fluorescent dye, forward primer and reverse primer; Wherein forward and reverse primer total amount is 2.5 μMs respectively, and volume is 2 μ l.