CN113584131B - Colorimetric biosensor for detecting UDG based on Au@Ag - Google Patents

Abstract

The invention belongs to the technical field of biosensors, and relates to a colorimetric biosensor for detecting UDG based on Au@Ag. The invention provides a DNA biosensor for detecting UDG based on colorimetric technology, which has high specificity and sensitivity, low cost and high detection speed, and comprises the following components: s1 chain, S2 chain, S3 chain, hairpin probes H1, H2 and H3, endonuclease IV, heme and Mg ²⁺ Buffer, au@Ag and H ₂ O ₂ The method comprises the steps of carrying out a first treatment on the surface of the And (3) utilizing an active conformation of the stable three-chain structure closed DNAzyme formed at the beginning to generate enzyme digestion activity in the presence of UDG so as to generate a trigger, and further opening H1 by the trigger, then opening H2 by the H1, and opening H3 by the H2 so as to trigger CHA reaction and realize the color change of the nano material.

Description

Colorimetric biosensor for detecting UDG based on Au@Ag

Technical Field

The invention belongs to the technical field of biosensors, and relates to a colorimetric biosensor for detecting UDG based on Au@Ag.

Background

The genome carries important genetic information for the life of an organism. Maintaining genome integrity and sequence accuracy are key preconditions for all organisms. However, the stability and accuracy of the genome can be disturbed by some endogenous or exogenous factors, such as radiation, genotoxic chemicals, and ultraviolet radiation. These disturbances are often extremely detrimental to cells, leading to mutagenesis and carcinogenesis. A range of enzymes are assigned the difficult task of maintaining DNA integrity, and many DNA repair mechanisms have been extensively described. Although different DNA repair pathways have been found, these pathways are often significantly conserved from bacteria to humans, underscores their importance in maintaining the functional properties of DNA. More and more examples illustrate the importance of DNA repair in preventing diseases such as cancer.

Base Excision Repair (BER) is a critical mechanism that can remove and replace damaged bases in DNA, helping to maintain genome integrity. UDG is one of BER enzymes present in most organisms and has a specific recognition function, which converts the N-glycosidic bond between uracil and deoxyribose into a uracil-free/pyrimidine-free site (AP). Uracil is a common damaged base in DNA, and uracil-DNA glycosylase (UDG) is an essential enzyme for repair of uracil in DNA. It can specifically cleave uracil, leaving Apurinic Pyrimidine (AP) sites in the corresponding region, thus eventually cooperating with other repair proteins to effect DNA repair. Research on UDG has shown that abnormal activity of UDG in human cells can interfere with uracil excision repair processes, ultimately leading to various diseases including human immunodeficiency, lymphoma, cancer, and the like. Furthermore, abnormalities in UDG activity usually occur far before signs of other malignancies, and can be used as potential biomarkers and therapeutic targets for early diseases. Therefore, development of ultrasensitive methods for detecting UDG activity is of great significance to biochemical research and clinical diagnosis. In recent years, with the continuous development of DNA biosensors, they play an increasingly important role in the fields of biology, medicine, etc. Compared with other detection means, the DNA colorimetric biosensing technology has the advantages of remarkable advantages, high sensitivity, strong specificity and low cost.

Disclosure of Invention

Aiming at the problems existing in the detection of the UDG activity at the present stage, the invention provides a DNA biosensor for detecting the UDG based on a colorimetric technology, which has high specificity and sensitivity, low cost and high detection speed.

Another object of the present invention is to provide an application and a method of the above biosensor in detecting UDG.

In order to achieve the above purpose, the invention adopts the following technical scheme:

a colorimetric biosensor for detecting UDG based on au@ag, comprising: s1 chain, S2 chain, S3 chain, hairpin probes H1, H2 and H3, endonuclease IV, heme and Mg ²⁺ Buffer, au@Ag and H ₂ O ₂ ；

The sequence of the S1 is SEQ ID No. 1; the 21 st base of the 5' end of the S1 is provided with a DNAzyme cutting site adenosine ribonucleotiderA；

The sequence of the S2 is SEQ ID No. 2;

the sequence of the S3 is SEQ ID No. 3; the 11 th base at the 5' end of the S1 is provided with uracil dU nucleotide;

the sequence of H1 is SEQ ID No. 4;

the sequence of H2 is SEQ ID No. 5;

the sequence of H3 is SEQ ID No. 6.

Preferably, the preparation method of the Au@Ag comprises the following steps:

s1, preparation of gold seeds: CTAB solution and HAuCl ₄ Mixing the solutions, adding NaBH ₄ A solution;

preparation of S2 AuNRs solution: CTAB solution and AgNO ₃ Mixing, adding HAuCl ₄ Gently mixing; adding ascorbic acid, and changing the color of the solution from dark yellow to colorless; finally, adding the seed solution in the step S1;

preparation of S3 Au@Ag: centrifuging the AuNRs solution of S2, and re-suspending the AuNRs solution by using a CTAB solution; mixing with PVP and silver nitrate; adding ascorbic acid and sodium hydroxide; placing until the color is unchanged; centrifuged and resuspended in CTAB.

The preparation method of the colorimetric biosensor for detecting UDG based on Au@Ag comprises the following steps:

（1）S ₁₂₃ preparation of triplex: mixing an S1 chain, an S2 chain and an S3 chain, adding into a Tris buffer, and heating, reacting and annealing; cooling to room temperature;

（2）S ₁₂₃ mixing UDG, endonuclease IV and Tris-HCl buffer for reaction;

(2) Adding H1 solution, H2 solution and H3 solution to react;

(3) Adding heme and reacting; then respectively adding H ₂ O ₂ Finally, au@Ag is added for detecting the ultraviolet-visible light scanning absorbance, and the scanning range is 400-800 nm.

The application of the colorimetric biosensor for detecting UDG based on Au@Ag is the application of preparing a reagent for detecting UDG.

A kit comprising a colorimetric biosensor for detecting UDG based on au@ag.

The detection principle of the invention is as follows:

the base sequences used in the invention are as follows:

the sequence of S1 is as follows: 5' -TTATCCCTACGTTGTAGCTAGrACTATACTGTGGGTAATGACTCTGGGT-3'；

The sequence of the S2 is as follows: 5' -CACAGTATAGGGCTAGCTACAACGCTAGCTACAACGTAGGGATAA -3'；

The sequence of the S3 is as follows: 5' - TTATCCCTACGUTGTAGCT -3'；

The sequence of H1 is as follows: 5'-TGGGTAATGACTCTGGGTTAGAAACTTGGGT ACCCAGAGTCATTACCCACAGTATAG TGGGTAGGGCGGG-3';

the sequence of H2 is as follows: 5'-TGGGTTAGAAACTTGGGTCTATACTGTGGGTACCC AAGTTTCTAACCCAGAGTCATT TGGGTAGGGCGGG-3';

the sequence of H3 is as follows: 5'-TGGGTCTATACTGTGGGTAATGACTCTGGGT ACCCACAGTATAGACCCAAGTTTCTA TGGGTAGGGCGGG-3'.

The designed triplex DNA comprises a substrate strand (S1) containing an adenosine ribonucleotide of DNAzyme cleavage siterA). The S1 sequence is designed so that part hybridizes to the sequence region of the metalloenzyme chain (S2) of the DNA, which is responsible for the enzymatic activity of DNAzyme. In addition, the S2 partial region hybridizes with a portion of S1. The S3 strand of the ligation strand comprises a uracil (dU) nucleotide hybridized to the S2 portion. The formation of the S1, S2, S3 structures effectively prevented the formation of DNAzyme active conformations. In the presence of the target UDG, uracil nucleotides are cleaved by catalytic hydrolysis to form an AP site, followed by Endo IV cleavage of the phosphodiester bond at the AP site, thus cleaving S3 into two fragments. After this cleavage, hybridization of the two fragments to the S2 strand is unstable and de-hybridization occurs. At the same time, a partial region of S1 hybridizes with a partial region of S2 enzyme chain to form an active conformation of DNAzyme. Subsequently, at Mg ²⁺ S1 is selected fromrACleavage occurs at the position and the S1 bolded portion is dehybridized with S2. The resulting S1 moiety triggers the CHA (catalytic hairpin self-assembly) reaction as a trigger chain. The H1, H2, H3 partial sequences are cleaved G quadruplex sequences. The Trigger strand is complementary to a partial region of H1, which opens H1, a partial region of H1 is complementary to a partial region of H2, opens H2, a partial region of H2 is complementary to a partial region of H3, opens H3, and triggers CHA. Exponential amplification is achieved through the infinite number of cycles described above, producing a large number of G quadruplets to achieve signal amplification. The resulting G tetrad, after addition of heme, has peroxidase-like properties, at H ₂ O ₂ When the ultraviolet-visible light change exists, hydroxyl free radicals are generated, thereby etching the Au@Ag material, generating color change, and detecting the amount of UDG through the ultraviolet-visible light change。

Advantageous effects

The biosensor provided by the invention has low detection limit, utilizes the active conformation of the stable three-chain structure closed DNAzyme formed at the beginning to generate enzyme digestion activity under the existence of UDG so as to generate a trigger, the trigger further opens H1, H1 then opens H2, H2 then opens H3, thereby triggering CHA reaction and realizing the color change of the nano material.

The detection sensitivity is improved, and the ultra-sensitive detection of the target object UDG is realized; the sensor is simple to construct, effectively avoids pollution and complicated sample pretreatment process possibly caused by adding samples in multiple steps, and has the advantages of simplicity in operation, high reaction speed, stable performance and the like; the main process of the detection principle is realized in homogeneous phase, so that the reaction speed is improved, the operation complexity is reduced, and the rapid, simple and sensitive detection of the target is realized; the manufacturing process of the biosensor has low cost, and is suitable for the low cost requirement in industrialization. The method is suitable for detection of UDG and practical application of industrialization of the biosensor.

The sensor has the advantages of high detection speed, simple operation, low price, low detection limit, high specificity and the like, can make up the defects and the shortcomings of the existing detection method of the UDG, and realizes the rapid and accurate quantitative detection of the UDG.

Drawings

FIG. 1 is a schematic diagram of a biosensor according to the present invention;

FIG. 2 is a graph of the result of the optimized detection of the concentration of hairpin probe H1;

FIG. 3 is H ₂ O ₂ A concentration optimization detection result diagram;

FIG. 4 is a graph of the results of the reaction time optimization test;

FIG. 5 is a standard curve of different concentrations of UDG.

Detailed Description

The present invention will be further described with reference to examples and drawings, but the present invention is not limited to the examples.

Example 1 preparation of Au@Ag

1. Preparation method of gold rod

1.1 preparation method of gold seed

5 mL of CTAB solution (0.2M) was mixed with 5 mL of HAuCl4 solution (0.0005M) and inverted several times. The newly prepared NaBH ₄ (0.01M) 0.6. 0.6 mL, and shaking vigorously for 2 min, and preserving in 25deg.C water bath for 1 hr.

1.2 preparation method of growth solution

100 mL of CTAB solution (0.2. 0.2M) was combined with 6 mL of AgNO ₃ (0.0035M) mixing, and adding HAuCl ₄ (0.01M) 100. 100 mL was added to the above mixed solution and gently mixed. Ascorbic acid 1.4. 1.4 mL (0.0788M) was added and the solution changed color rapidly from dark yellow to colorless. Finally, 240. Mu.L of seed solution was added to the growth solution at 28 ℃. After 8 hours, the mixture was removed and centrifuged at 8500 rpm for 10 minutes.

1.3 preparation method of Au@Ag

The AuNRs solution was centrifuged at 8500 rpm for 10 min and resuspended in 0.1M CTAB solution. 0.8 The mL CTAB-AuNRs solution was mixed with 2.4 mL 3 wt% PVP and 240. Mu.L silver nitrate (1.0 mM). To the mixed solution were added 120. Mu.L (0.1. 0.1M) of ascorbic acid and 200. Mu.L (0.1. 0.1M) of sodium hydroxide. Finally, the solution was placed in a water bath at 30 ℃ until the color was unchanged. Au@ag NRs were purified by centrifugation at 8500 rpm for 10 minutes and resuspended in 0.5 mM CTAB.

Example 2S ₁₂₃ Preparation of triplex

The desired DNA triplex was synthesized according to the sequence shown in No. 1-3 by the method of the method in Tris buffer (50 mm Tris,100 mm NaCl,50 mm KCl,1 mm MgCl) ₂ Preparation of S by heating and annealing S1/S2/S3 in pH 7.4) ₁₂₃ The solution was heated at 90 ℃ for 5 minutes and then cooled slowly to room temperature.

Example 3 influence of changes in H1 concentration on detection of exosomes

The triplex synthesized in example 2, hairpin probes H1, H2, H3 were taken and then screened for H1 optimum concentration according to the following procedure:

(1) 6 EP tubes were taken and 10 mu L S were added to each tube ₁₂₃ (1 μL，5 μM)、UDG（1 μL，1U / μL）、2 U EndoⅣ、50 mM Tris-HCl buffer（100 mm NaCl，50 mM KCl，1 mM MgCl ₂ ，pH 7.4（pH 7.4)), at 37 ℃, reaction 2 h;

(2) Then respectively adding H1 solutions with different concentrations in equal volumes to make the final concentrations of the H1 solutions respectively 0.2 mu M,0.4 mu M,0.6 mu M,0.8 mu M,1 mu M and 1.2 mu M, then respectively adding H2 (1 mu L,1 mu M) and H3 (1 mu L,1 mu M), and reacting for 90 min at 37 ℃;

(3) Then adding heme (1 μL,1 μM) respectively, and reacting at 37deg.C for 30 min; then respectively adding H ₂ O ₂ (2. Mu.L, 40, mM) and finally 15. Mu.L of Au@Ag (abs. 0.5) were added for detection by ultraviolet-visible light scanning absorbance, ranging from 400 to 800 nm.

As a result, as shown in fig. 2, it can be seen from the graph that the detected ultraviolet wavelength value gradually increases as the H1 concentration increases and the ultraviolet wavelength becomes stable when the concentration exceeds 1.0 μm; the optimum concentration of H1 is 1.0. Mu.M.

Example 4H ₂ O ₂ Effect of concentration variation on UDG detection

The triplexes synthesized in example 2 were used as hairpin probes H1, H2 and H3, and H was selected according to the following procedure ₂ O ₂ Optimal concentration:

(1) 6 EP tubes were taken and 10 mu L S were added to each tube ₁₂₃ (1 μL，5 μM)、UDG（1 μL，1U / μL）、2 U EndoⅣ、50 mM Tris-HCl buffer（100 mm NaCl，50 mM KCl，1 mM MgCl ₂ pH 7.4 (pH 7.4)), at 37 ℃, reaction 2 h;

(2) Then H1 (1. Mu.L, 1. Mu.M), H2 (1. Mu.L, 1. Mu.M) and H3 (1. Mu.L, 1. Mu.M) were added, respectively, and reacted at 37℃for 90 min;

(3) Then adding heme (1 μL,1 μM) respectively, and reacting at 37deg.C for 30 min; respectively adding H with different concentrations in equal volumes ₂ O ₂ The concentrations were made 20 mM, 25 mM, 30 mM, 35 mM, 40 mM, 45 mM, respectively, and finally 15 μl au@ag (abs. 0.5) was added for detection by uv-vis scanning absorbance, with a scanning range of 400-800 nm.

As a result, as shown in FIG. 3, it can be seen from the graph that the detected ultraviolet wavelength value follows H ₂ O ₂ Concentration of (2)Increasing the red shift gradually increases, and the ultraviolet wavelength tends to be stable when the concentration exceeds 40 mM; so H is ₂ O ₂ Is preferably 40 mM.

Example 5 Effect of reaction time on UDG detection

The triplexes synthesized in example 2, hairpin probes H1, H2, H3 were taken and then screened for optimal reaction time according to the following procedure:

(1) 6 EP tubes were taken and 10 mu L S were added to each tube ₁₂₃ (1 μL，5 μM)、UDG（1 μL，1U / μL）、2 U EndoⅣ、50 mM Tris-HCl buffer（100 mm NaCl，50 mM KCl，1 mM MgCl ₂ pH 7.4 (pH 7.4)), at 37 ℃, reaction 2 h;

(2) Then H1 (1. Mu.L, 1. Mu.M), H2 (1. Mu.L, 1. Mu.M) and H3 (1. Mu.L, 1. Mu.M) are added respectively, and the reaction is carried out for 50 min, 60 min, 70 min, 80 min, 90 min and 100 min at 37 ℃;

(3) Then adding heme (1 μL,1 μM) respectively, and reacting at 37deg.C for 30 min; then respectively adding H ₂ O ₂ (2. Mu.L, 40, mM) and finally 15. Mu.L of Au@Ag (abs. 0.5) were added for detection by ultraviolet-visible light scanning absorbance, ranging from 400 to 800 nm.

As a result, as shown in fig. 4, it can be seen from the graph that the detected ultraviolet wavelength value increases red-shifted gradually with an increase in reaction time, and the ultraviolet wavelength becomes stable after the time exceeds 90 minutes. The optimal reaction time is 90 min.

Example 6 detection of exosomes at different concentrations by biosensors

Taking the triplex synthesized in example 2, hairpin probes H1, H2 and H3, and detecting the UDG with different concentrations according to the following steps:

(1) 7 EP tubes were taken and 10 mu L S were added to each tube ₁₂₃ (1 μL，5 μM)、2 U EndoⅣ、50 mM Tris-HCl buffer（100 mm NaCl，50 mM KCl，1 mM MgCl ₂ pH 7.4 (pH 7.4)), 10. Mu.L of UDG of different concentrations was added to the tube to give concentrations of 0, 1U/mL, 5U/mL, 10U/mL, 15U/mL, 20U/mL, respectively; mix, 37 ℃, reaction 2 h.

Then H1 (1. Mu.L, 1. Mu.M), H2 (1. Mu.L, 1. Mu.M) and H3 (1. Mu.L, 1. Mu.M) were added, respectively, and reacted at 37℃for 90 min; then adding heme (1 μL,1 μM) respectively, and reacting at 37deg.C for 30 min; then respectively adding H ₂ O ₂ (2. Mu.L, 40 mM), finally 15. Mu.L of Au@Ag (abs. 0.5) is added for detection by ultraviolet-visible light scanning absorbance, the scanning range is 400-800 nm, then H1 (1. Mu.L, 1. Mu.M), H2 (1. Mu.L, 1. Mu.M), H3 (1. Mu.L, 1. Mu.M) and 37 ℃ are added respectively for reaction for 90 min; then adding heme (1 μL,1 μM) respectively, and reacting at 37deg.C for 30 min; H2O2 (2 mu L,40 and mM) is added respectively, and finally 15 mu L of Au@Ag (abs. 0.5) is added for detecting ultraviolet-visible light scanning absorbance, and the scanning range is 400-800 nm; the detected uv wavelength value gradually increases with increasing UDG concentration. The difference between absorbance values measured at different concentrations of UDG and absorbance values without UDG is plotted on the ordinate, and the different concentrations of UDG are plotted on the abscissa, as shown in fig. 5, to obtain a regression equation of y=16.02692x+4.01948, and a correlation coefficient of 0.9779. The minimum detection limit of the method is 4.12 multiplied by 10 ^-4 U ml ^-4 。

Sequence listing

<120> colorimetric biosensor for detecting UDG based on Au@Ag

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 47

<212> DNA

<213> Artificial sequence (artiartificial sequence)

<400> 1

ttatccctac gttgtagcta gctatactgt gggtaatgac tctgggt 47

<210> 2

<211> 45

<212> DNA

<213> Artificial sequence (artiartificial sequence)

<400> 2

cacagtatag ggctagctac aacgctagct acaacgtagg gataa 45

<210> 3

<211> 18

<212> DNA

<213> Artificial sequence (artiartificial sequence)

<400> 3

ttatccctac gtgtagct 18

<210> 4

<211> 70

<212> DNA

<213> Artificial sequence (artiartificial sequence)

<400> 4

tgggtaatga ctctgggtta gaaacttggg tacccagagt cattacccac agtatagtgg 60

gtagggcggg 70

<210> 5

<211> 70

<212> DNA

<213> Artificial sequence (artiartificial sequence)

<400> 5

tgggttagaa acttgggtct atactgtggg tacccaagtt tctaacccag agtcatttgg 60

gtagggcggg 70

<210> 6

<211> 70

<212> DNA

<213> Artificial sequence (artiartificial sequence)

<400> 6

tgggtctata ctgtgggtaa tgactctggg tacccacagt atagacccaa gtttctatgg 60

gtagggcggg 70

Claims (5)

1. A colorimetric biosensor for detecting UDG based on au@ag, comprising: s1 chain, S2 chain, S3 chain, hairpin probes H1, H2 and H3, endonuclease IV and red blood cellPlain, mg ²⁺ Buffer, au@Ag and H ₂ O ₂ ；

The sequence of the S1 is SEQ ID No. 1; the 21 st base of the 5' end of the S1 is provided with a DNAzyme cutting site adenosine ribonucleotiderA；

The sequence of the S2 is SEQ ID No. 2;

the sequence of the S3 is SEQ ID No. 3; the 11 th base at the 5' end of the S1 is provided with uracil dU nucleotide;

the sequence of H1 is SEQ ID No. 4;

the sequence of H2 is SEQ ID No. 5;

the sequence of H3 is SEQ ID No. 6.

2. The colorimetric biosensor for detecting UDG based on Au@Ag according to claim 1, wherein the preparation method of the Au@Ag is as follows:

s1, preparation of gold seeds: CTAB solution and HAuCl ₄ Mixing the solutions, adding NaBH ₄ A solution;

preparation of S2 AuNRs solution: CTAB solution and AgNO ₃ Mixing, adding HAuCl ₄ Gently mixing; adding ascorbic acid, and changing the color of the solution from dark yellow to colorless; finally, adding the seed solution in the step S1;

preparation of S3 Au@Ag: centrifuging the AuNRs solution of S2, and re-suspending the AuNRs solution by using a CTAB solution; mixing with PVP and silver nitrate; adding ascorbic acid and sodium hydroxide; placing until the color is unchanged; centrifuged and resuspended in CTAB.

3. The method for preparing the colorimetric biosensor for detecting UDG based on Au@Ag, which is disclosed in claim 1, is characterized by comprising the following steps:

（1）S ₁₂₃ preparation of triplex: mixing an S1 chain, an S2 chain and an S3 chain, adding into a Tris buffer, and heating, reacting and annealing; cooling to room temperature;

（2）S ₁₂₃ mixing UDG, endonuclease IV and Tris-HCl buffer for reaction;

(2) Adding H1 solution, H2 solution and H3 solution to react;

(3) Adding heme and reacting; then respectively adding H ₂ O ₂ Finally, au@Ag is added for detecting the ultraviolet-visible light scanning absorbance, and the scanning range is 400-800 nm.

4. The use of a colorimetric biosensor for detecting UDG based on au@ag according to claim 1, wherein the use is the use for preparing a reagent for detecting UDG.

5. A kit comprising the au@ag detection UDG-based colorimetric biosensor of claim 1.