CN110819697B

CN110819697B - Detection method of uranyl ions

Info

Publication number: CN110819697B
Application number: CN201911180266.8A
Authority: CN
Inventors: 云雯; 吴虹; 尤琳烽; 熊政委
Original assignee: Chongqing Technology and Business University
Current assignee: Chongqing Technology and Business University
Priority date: 2019-11-27
Filing date: 2019-11-27
Publication date: 2023-03-17
Anticipated expiration: 2039-11-27
Also published as: CN110819697A

Abstract

The invention provides a simple DNA forceps probe which is used for amplifying and detecting uranyl ions based on a one-step method of DNA enzyme catalytic cracking. The two arms of the DNA tweezer probe are in close proximity in the original form, and therefore the fluorescent signal of the fluorophore at the end of the arm is significantly quenched. However, in the presence of uranyl ions, the structure of the DNA tweezer can change from "off" to "on" resulting in a strong fluorescent signal. The linear range of the obtained uranyl ions for detection is 0.1nM to 60nM by the amplification of DNA enzyme catalytic cracking reaction, and the detection limit is 25pM. Importantly, the whole detection process is very simple and only requires one operation step. In addition, the method has great potential and promising prospect for detecting the uranyl ions in practical application.

Description

Detection method of uranyl ions

Technical Field

The invention relates to the detection field of uranyl ions, in particular to the detection field of the uranyl ions by one-step amplification based on a DNA forceps probe and DNA enzyme catalytic cracking.

Background

Enriched uranium can be used as nuclear fuel and nuclear weapons material. Worldwide uranium consumption may result in uranium mining and nuclear waste releasing it into the environment, resulting in serious environmental pollution and human health problems. Uranium can be enriched in humans through the food chain, which can lead to severe childhood leukemia, lung cancer and other radiation-related diseases. Thus, the U.S. Environmental Protection Agency (EPA) sets a maximum contamination level of uranyl ions (130 nM) in water.

To date, a number of techniques have been developed for uranium detection, including inductively coupled plasma mass spectrometry and atomic emission spectrometry, among others. However, they require expensive instruments and complicated operations. Recently, DNases that bind the enzyme chain (E-DNA) and the substrate chain (S-DNA) have been used to design biosensors for metal ions, such as uranyl ion, mg2+, cu2+, pb2+, zn2+ and Cd2+. Various DNA enzyme-based methods for detecting uranyl ions have been reported, including colorimetric, fluorescent, and electrochemical methods. In addition, dnase-based probes have been used for fluorescence imaging of uranyl ions in living cells.

The DNA nano machine is a DNA assembled nano structure capable of realizing nano mechanical motion at a nano level. DNA nanomachines are programmed and constructed from the general material "DNA" and have some unique advantages, such as ease of chemical synthesis, good thermal stability and functional modification. Moreover, DNA nanomachines are a promising platform for logical molecular computation with biological nanoscopic design, drug delivery, and with one-, two-, and three-dimensional nanostructures. DNA nanomachines of great importance with nanoscale controllability and biocompatibility have been designed, such as DNA tweezers, DNA Walker, DNA motors, DNA gears and DNA nanocages. DNA tweezers are typically nanomachines that respond to various external stimuli, including nucleic acids, metal ions, proteins, enzymes, and pH. To date, no DNA forceps have been used for metal ion detection in combination with DNase.

Disclosure of Invention

In order to solve the problems, the invention provides a method for amplifying and detecting uranyl ions based on a DNA forceps probe and a DNA enzyme catalytic cracking one-step method.

The invention comprises the following steps:

a method for detecting the concentration of uranyl ions in a solution comprises the following steps:

(1) Preparing gold nanoparticles;

(2) The DNA sequence 4 modified by the gold nanoparticles is thiolated at one end of the DNA sequence 4, and the other end of the DNA sequence 4 is connected with a fluorescent group;

(3) Preparing a DNA forceps probe by using the DNA sequence 4 obtained in the step (2) after the gold nanoparticles are modified;

(4) Mixing the DNA forceps probe obtained in the step (3), a proper amount of uranyl ion specific DNA polymerase chain and a uranyl ion sample solution to be detected;

(5) And (4) detecting a fluorescence signal of the solution obtained in the step (4), and obtaining the concentration of the uranyl ions in the sample solution by using a standard curve.

Wherein, the DNA sequence 4 specifically comprises: HS-TACCAAAAACCT GGCTGCAACTCACTATATrAGGAAGATGGACGTGACATACAAACCCTA-FAM.

Wherein, the DNA tweezers probe prepared together with the DNA sequence 4 in the step (3) also has DNA sequences 1-3, wherein the DNA sequence 1 is: TAGGCTTCGTAAGGTCCACACACTACACCAGCGAGAATGTTCCGTT, the DNA sequence 2 is: TAGGGTTTTTGTACCGTACCGTACCGTACAGCGAACTTCTCGCTGG, the DNA sequence 3 is: TGGACCTTACGAAGCCTAACTAGCCAGGTTTTTTGGGTA.

Preferably, the uranyl ion-specific dnase chain is specifically: CACGTCCATCTGCAGTCGGTAGTTAAACCGACCTTCAGACATAGTGAGT.

Preferably, the step (2) is specifically: thiolated DNA sequence 4 was contacted with gold nanoparticles at a ratio of 1:1 for 12 hours to obtain the DNA sequence 4 modified by the gold nanoparticles.

Preferably, the step (3) is specifically: DNA tweezer probes were formed by mixing 100nM DNA sequences 1-4 in 100mM MES buffer (pH 5.5) and 300mM NaCl, then heating the mixture to 95 ℃ and slowly cooling.

Preferably, the step (4) is specifically: the 30nM uranyl ion-specific DNA polymerase chain and the solution of uranyl ions to be tested were mixed with DNA tweezers in 10mM MES buffer solution (pH 5.5) containing 300mM NaCl and incubated at 40 ℃ for 60 minutes.

Preferably, the fluorescent signal in step (5) is a fluorescent signal measured at 500nm to 600nm under excitation at 492 nm.

The invention constructs DNA enzyme-based one-step amplification catalysis DNA tweezers for sensitive fluorescence detection of uranyl ions. DNA tweezers are formed by hybridization of DNA sequences. Fluorophores and gold nanoparticles (gold nanoparticles) are immobilized at the ends of the two arms of the DNA forceps, respectively. The two arms of the DNA tweezer are tightly connected by single-stranded DNA, causing quenching of the fluorescent signal. The linker sequence is then cleaved by the uranyl ion-specific dnase chain in the presence of the uranyl ion-specific dnase chain and uranyl, resulting in recovery of fluorescence intensity. The DNase can circularly cut other DNA tweezers to obviously improve the sensitivity.

The invention creatively combines DNA tweezers and DNA enzyme for metal ion detection, improves the sensitivity, also leads the detection process to be easy to operate and reduces the cost.

Drawings

Fig. 1 is a schematic diagram of the present invention.

FIG. 2 is a graph showing the intensity of fluorescence signals after changing the detection conditions.

FIG. 3 (A) fluorescence spectra of DNA tweezers for different concentrations of uranyl ions: 0.1nM,5nM,10nM,30nM,60nM,100nM,150nM,200nM. (B) a relationship between fluorescence intensity and uranyl ion concentration. Inserting a drawing: calibration plots of fluorescence intensity and uranyl ion between 0.1nM and 60 nM.

FIG. 4 is a graph showing the intensity of fluorescence signals generated by solutions containing the same concentration (60 nM) of uranyl ions, ca2+, mg2+, pb2+, sn2+, hg2+, zn2+, cu2+ and Co 2+.

Detailed Description

The present invention will be described in further detail with reference to embodiments.

As shown in fig. 1, the principle of the present invention is: the DNA tweezer structure is combined with sequences 1-4. The

sequences

2 and 3 are each partially complementary to the terminal regions of sequence 1. They can hybridize to the ends of sequence 1, respectively, to form the two arms of the DNA tweezer. Sequence 4, modified at both ends with FAM and gold nanoparticles, can then hybridize to a single portion of

sequences

2 and 3, respectively, to form a complete DNA tweezer structure. The middle part of sequence 4 is tightly attached to both arms of the DNA tweezer, resulting in severe fluorescence quenching. The joining region has the same sequence as the substrate strand of the uranyl-specific dnase. It can be hybridized with uranyl ion specific DNA enzyme chain to form uranyl ion specific DNA enzyme. The linker region can be cleaved in the presence of uranyl ions to separate FAM and gold nanoparticles. The uranyl ion specific dnase chain can then be recombined with other DNA tweezers to form another dnase structure, and then the linking parts of the DNA tweezers are catalytically cleaved, so that the fluorescence signal is significantly restored. The concentration of uranyl can be quantitatively detected by fluorescence intensity.

The following experiments verify the feasibility of the detection method of the invention: the detection result of the optimal detection process is compared with the detection result obtained by changing partial conditions of the optimal detection processAnd the feasibility of the method is proved. The optimal detection process comprises the following steps: preparing gold nanoparticles; DNA sequence 4 (HS-TACCCCAAAAACCTGGCAACTCACTATATrAGGAAGAGATGGACGTACAAACCCTTA-FAM) modified by the gold nanoparticles, wherein one end of the DNA sequence 4 is thiolated, and the other end is connected with a fluorescent group; preparing a DNA forceps probe by using the obtained DNA sequence 4 modified with the gold nanoparticles; mixing the obtained 100nM DNA forceps probe, 30nM uranyl ion specific DNA polymerase chain (CACGTCCATCTGTCGCAGTCGGGTAGTTAAACCGACCTTCAGACATAGTGAGT) and uranyl ion sample solution to be detected, and incubating at 40 deg.C for 60 min; the fluorescence signal of the resulting solution (signal of sample 6 in fig. 2) was measured. Sample 1 is a blank solution, i.e. the solution to be tested does not contain uranyl ions, the rest of the process is the same as the optimal detection process, and in the absence of uranyl ions, the DNA tweezers are still in an "off" state, and therefore, a weak fluorescence signal (signal of sample 1 in fig. 2) can be obtained. Sample 2 was a sample without the uranyl ion specific dnase chain and the rest of the process was identical to the optimal detection process (sample 2 signal in fig. 2), with similar fluorescence intensity as sample 1, indicating that no uranyl ion specific dnase chain could not form a uranyl ion specific dnase and that the linker of sequence 4 was still intact. Sample 3 is a substitution of the uranyl ion-specific DNA polymerase chain in the optimum detection procedure for Pb ²⁺ Specific DNA polymerase chain: CATCTTCTCCCGAGCCGGTCGAAAATAGTGAGT, the rest of the procedure being identical to the optimal detection procedure (signal for sample 3 in FIG. 2). The reason for the low fluorescence intensity of sample 3 is Pb ²⁺ The specific DNA polymerase chain can not form uranyl ion specific DNA enzyme with sequence 4, so that the tweezers can not be opened when encountering uranyl ions. The sample 4 is half reaction time, i.e. after mixing with the solution of uranyl ion sample to be detected, incubation is carried out for 30 minutes at 40 ℃, the rest processes are the same as the optimal detection process (signal of sample 4 in fig. 2), and the fluorescence intensity is obviously recovered. This is because the cleavage reaction has proceeded to some extent in half the reaction time, and part of the tweezers has been opened. The mole ratio of the uranyl ion-specific dnase chain to the DNA tweezers in sample 5 was 2.

To determine the fluorescent response of uranyl ions, various concentrations of uranyl ions were tested with the resulting DNA tweezer probe. As shown in fig. 3A, the fluorescence signal gradually increased with uranyl ions in the range of 0.1nM to 200nM. In the range of 0.1nM to 60nM between the fluorescence intensity and the uranyl concentration, a good linear relationship can be obtained with a correlation coefficient of 0.993 (FIG. 3B). The detection limit of the sensitive DNA tweezers was evaluated to be 25pM according to the 3. Sigma. Blank standard. This limit of detection is comparable to other reported dnase-based methods, including fluorescence, colorimetric and electrochemical methods. RSD of 0.1nM uranyl ion measured in six replicates was 8.8%, indicating satisfactory reproducibility of the DNA tweezer probe.

In terms of specificity, the "sample solution containing uranyl ions" in the above-described optimal detection process was changed to a solution containing Ca2+, mg2+, pb2+, sn2+, hg2+, zn2+, cu2+ and Co2+ at the same concentration (60 nM), and the fluorescence signal obtained in the rest of the detection process was negligible as in the optimal detection process (see fig. 4). It can be seen that the fluorescence intensity of other metal ions is much lower than that of uranyl ions. Meanwhile, experiments prove that even if the concentration of the interference ions is 100 times that of the uranyl ions, the interference generated by the interference ions can be ignored. The good selectivity of this method can be attributed to the strong specificity of the uranyl ion specific dnase chain.

Detecting uranyl ions in an actual sample:

the feasibility and applicability of the method for detecting uranyl ions are evaluated through different water samples (drinking water, tap water and river water). The water sample was purified by centrifugation and filtered through a 0.22 μm membrane. The pH of the sample was adjusted to 5.5. The sample is then tested according to the optimal testing procedure. The uranyl concentration in the tap water sample determined in this way was 2.9nM and in the river was 4.7nM. The recovery of the spiked samples was determined to be between 91.0% and 107.0%. In addition, the RSD is from 5.6% to 9.2%. The results show that the DNA forceps are feasible and can be used for practical water analysis.

The above description is only a preferred embodiment of the present application and is not intended to limit the present application, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A method for detecting the concentration of uranyl ions in a solution comprises the following steps:

(1) Preparing gold nanoparticles;

(2) Modifying a DNA sequence 4 by using the gold nanoparticles, wherein one end of the DNA sequence 4 is thiolated, and the other end of the DNA sequence 4 is connected with a fluorescent group, wherein the DNA sequence 4 specifically comprises: HS-TACCAAAAACCTGGCTGCAACTACTATrAGGAAGAGATGGACGTGACATACGG TACAAAAAACCCTA-FAM;

(3) Preparing a DNA forceps probe by using the DNA sequence 4 modified by the gold nanoparticles obtained in the step (2);

(4) And (3) mixing the DNA forceps probe obtained in the step (3), a proper amount of uranyl ion specificity DNA polymerase chain and a to-be-detected uranyl ion sample solution, wherein the uranyl ion specificity DNA polymerase chain specifically comprises the following steps: CACGTCCATCTGCAGTCGGTAGTTAAACCGACCTTCAGACATAGTGAGT;

(5) Detecting the fluorescence signal of the solution obtained in the step (4), obtaining the concentration of the uranyl ions in the sample solution by using a standard curve,

wherein, the DNA tweezers probe prepared in step (3) together with the DNA sequence 4 also has DNA sequences 1-3, wherein the DNA sequence 1 is: TAGGCTTCGTAAGGTCCACACATATACATTACACACAGCGAATGTTCCGTT, the DNA sequence 2 is: TAGGGTTTTTGTACCGTACCGTACCGTACAGCGAACTTCTCGCTGG, the DNA sequence 3 is: TGGACCTTACGAAGCCTAACTAGCCAGGTTTTTTGGGTA.

2. The method according to claim 1, wherein the step (2) is specifically: thiolated DNA sequence 4 was mixed with gold nanoparticles in a 1:1 for 12 hours to obtain the DNA sequence 4 modified by the gold nanoparticles.

3. The method according to claim 1 or 2, characterized in that step (3) is in particular: DNA tweezer probes were formed by mixing 100nM of the DNA sequence 1-4 in 100mM MES buffer, pH 5.5, and 300mM NaCl, then heating the mixture to 95 ℃ and slowly cooling.

4. The method according to claim 3, wherein the step (4) is specifically: the 30nM uranyl ion specific DNA polymerase chain and the solution of uranyl ions to be tested were mixed with DNA tweezers in 10mM MES buffer pH 5.5 containing 300mM NaCl and incubated for 60 minutes at 40 ℃.

5. The method of claim 3, wherein the fluorescent signal in step (5) is a fluorescent signal measured at 500nm to 600nm under excitation at 492 nm.