CN110819697A - A kind of detection method of uranyl ion - Google Patents

Abstract

The present invention provides a simple DNA tweezers probe for one-step amplification and detection of uranyl ions based on DNase catalytic cleavage. The two arms of the DNA tweezers probe abut in their original form, and therefore, the fluorescence signal of the fluorophore at the end of the arms is significantly quenched. However, in the presence of uranyl ions, the structure of the DNA tweezers can be changed from "closed" to "open," resulting in a strong fluorescent signal. Amplification by DNase-catalyzed cleavage reaction resulted in a linear range of 0.1 nM to 60 nM for the detection of uranyl ions with a detection limit of 25 pM. Importantly, the entire detection process is very simple and requires only one operation step. Furthermore, it shows great potential and promising prospects for uranyl ion detection in practical applications.

Description

A kind of detection method of uranyl ion

technical field

The invention relates to the field of detection of uranyl ions, in particular to the field of one-step amplification and detection of uranyl ions based on DNA tweezers probes and DNase catalytic cracking.

Background technique

Enriched uranium can be used as nuclear fuel and nuclear weapons material. Global uranium consumption can lead to uranium mining and nuclear waste releasing it into the environment, causing serious environmental pollution and human health problems. Uranium can be enriched into the human body through the food chain, which can lead to severe childhood leukemia, lung cancer and other radiation-related diseases. Therefore, the US Environmental Protection Agency (EPA) has set a maximum contamination level (130 nM) for uranyl ions in water.

To date, a number of techniques have been developed for uranium detection, including inductively coupled plasma mass spectrometry and atomic emission spectrometry, among others. However, they require expensive instruments and complicated operations. Recently, DNases that combine enzyme strands (E-DNA) and substrate strands (S-DNA) have been used to design biosensors for metal ions, such as uranyl ions, Mg2+, Cu2+, Pb2+, Zn2+, and Cd2+. A variety of DNase-based uranyl ion detection methods have been reported, including colorimetric, fluorescent, and electrochemical methods, among others. In addition, DNase-based probes have been used for fluorescence imaging of uranyl ions in living cells.

DNA nanomachines are DNA-assembled nanostructures that can achieve nanomechanical motion at the nanoscale. DNA nanomachines are programmed and constructed from the universal material "DNA", which has some unique advantages such as easy chemical synthesis, good thermal stability and functional modification. Moreover, DNA nanomachines are promising platforms for biological nanodesign, drug delivery, and logical molecular computing with one-, two-, and three-dimensional nanostructures. Serious DNA nanomachines such as DNA tweezers, DNA Walkers, DNA motors, DNA gears, and DNA nanocages have been designed with nanoscale controllability and biocompatibility. DNA tweezers are typical nanomachines that can respond to different external stimuli, including nucleic acids, metal ions, proteins, enzymes, and pH. So far, there are no DNA tweezers combined with DNase for metal ion detection.

SUMMARY OF THE INVENTION

In order to solve the above problems, the present invention provides a one-step amplification and detection method for uranyl ions based on DNA tweezers probe and DNase catalytic cleavage.

The present invention comprises the following steps:

A method for detecting uranyl ion concentration in a solution, comprising the steps of:

(1) Preparation of gold nanoparticles;

(2) DNA sequence 4 modified with the gold nanoparticles, one end of the DNA sequence 4 is thiolated, and the other end is connected with a fluorescent group;

(3) preparing a DNA tweezer probe with the DNA sequence 4 obtained in step (2) after the modified gold nanoparticles;

(4) mixing the DNA tweezers probe obtained in step (3), an appropriate amount of uranyl ion-specific DNase chain, and the uranyl ion sample solution to be tested;

(5) Detecting the fluorescence signal of the solution obtained in step (4), and using the standard curve to obtain the concentration of uranyl ions in the sample solution.

Wherein, the DNA sequence 4 is specifically: HS-TACCCAAAAAACCT GGCTGCAACTCACTATrAGGAAGAGATGGACGTGACATACGGTACAAAAACCCTA-FAM.

Wherein, in step (3), DNA sequences 1-3 are prepared together with DNA sequence 4, wherein DNA sequence 1 is: TAGGCTTCGTAAGGTCCACATACATACATACACCAGCGAGAATGTTCCGT, DNA sequence 2 is: TAGGGTTTTTTGTACCGTACCGACGGAACATTCTCGCTGG, and DNA sequence 3 is: TGGACCTTACGAAGCCTAACTAGCCAGGTTTTTTGGGTA.

Preferably, the uranyl ion-specific DNA enzyme chain is specifically: CACGTCCATCTCTGCAGTCGGGTAGTTAAACCGACCTTCAGACATAGTGAGT.

Preferably, step (2) is specifically as follows: mixing the thiolated DNA sequence 4 and the gold nanoparticles at a molar ratio of 1:1 for 12 hours to obtain the DNA sequence 4 modified by the gold nanoparticles.

Preferably, step (3) is specifically as follows: by mixing 100 nM of DNA sequences 1-4 in 100 mM MES buffer solution (pH 5.5) and 300 mM NaCl, then heating the mixture to 95° C. and slowly cooling to form DNA tweezers probes .

Preferably, step (4) is specifically as follows: mixing 30 nM uranyl ion-specific DNase chain and the uranyl ion solution to be tested with DNA tweezers in 10 mM MES buffer solution (pH 5.5) containing 300 mM NaCl, and then at 40° C. Incubate for 60 min.

Preferably, the fluorescence signal in step (5) is the fluorescence signal measured at 500 nm to 600 nm under excitation at 492 nm.

The invention constructs a DNA tweezers based on one-step amplification and catalysis of DNase, which is used for the sensitive fluorescence detection of uranyl ions. DNA tweezers are formed by hybridization of DNA sequences. Fluorophores and gold nanoparticles (gold nanoparticles) were immobilized on the ends of the two arms of the DNA tweezers, respectively. The two arms of the DNA tweezers are tightly connected by single-stranded DNA, resulting in quenching of the fluorescent signal. Then, in the presence of the uranyl ion-specific DNase strand and uranyl, the linker sequence is cleaved by the uranyl ion-specific DNase strand, resulting in the recovery of fluorescence intensity. DNase can cycle through other DNA tweezers to dramatically increase sensitivity.

The invention creatively combines the DNA tweezers with the DNA enzyme for metal ion detection, which improves the sensitivity, makes the detection process easy to operate, and reduces the cost.

Description of drawings

FIG. 1 is a schematic diagram of the present invention.

Figure 2 is a graph of the fluorescence signal intensity after changing the detection conditions.

Figure 3(A) Fluorescence spectra of DNA tweezers for different concentrations of uranyl ions: 0.1nM, 5nM, 10nM, 30nM, 60nM, 100nM, 150nM, 200nM. (B) Relationship between fluorescence intensity and uranyl ion concentration. Inset: calibration plot of fluorescence intensity and uranyl ion between 0.1 nM and 60 nM.

Figure 4 is a graph of the fluorescence signal intensity generated by solutions containing the same concentration (60nM) of uranyl ions, Ca2+, Mg2+, Pb2+, Sn2+, Hg2+, Zn2+, Cu2+ and Co2+.

Detailed ways

The present invention will be described in further detail below in conjunction with the embodiments.

As shown in FIG. 1 , the principle of the present invention is that the DNA tweezers structure is combined with sequences 1-4. Sequences 2 and 3 are partially complementary to the terminal region of sequence 1, respectively. They can respectively hybridize to the end of sequence 1 to form the two arms of DNA tweezers. Then, sequence 4 modified with FAM and gold nanoparticles at both ends can hybridize with a single part of sequence 2 and 3, respectively, to form a complete DNA tweezers structure. The middle part of sequence 4 tightly connects the two arms of the DNA tweezers, resulting in severe fluorescence quenching. The linking region has the same sequence as the substrate strand of the uranyl-specific DNase. It can hybridize with uranyl ion-specific DNase strands to form uranyl ion-specific DNase. The linking region can be cleaved in the presence of uranyl ions, thereby separating FAM and gold nanoparticles. Then, the uranyl ion-specific DNase strand can recombine with other DNA tweezers to form another DNase structure, which then catalyzes the cleavage of the connecting portion of the DNA tweezers, and thus, the fluorescent signal is remarkably restored. The concentration of uranyl can be quantitatively detected by fluorescence intensity.

The feasibility of the detection method of the present invention is verified by the following experiments: the detection results of the optimal detection process are compared with the detection results after changing some conditions of the optimal detection process to prove the feasibility of the method. The optimal detection process is as follows: preparing gold nanoparticles; using the gold nanoparticles modified DNA sequence 4 (HS-TACCCAAAAAAACCTGGCTGCAACTCACTATrAGGAAGAGATGGACGTGACATACGGTACAAAAACCCTA-FAM), one end of the DNA sequence 4 is thiolated, and the other end is connected with a fluorescent group; DNA sequence 4 after nanoparticles to prepare DNA tweezers probe; the obtained 100nM DNA tweezers probe, 30nM uranyl ion-specific DNase chain (CACGTCCATCTCTGCAGTCGGGTAGTTAAACCGACCTTCAGACATAGTGAGT), and the uranyl ion sample solution to be tested were mixed, and then incubated at 40°C for 60 min; measure the fluorescence signal of the resulting solution (signal of sample 6 in Figure 2). Sample 1 is a blank solution, that is, the solution to be tested does not contain uranyl ions, and the rest of the process is the same as the optimal detection process. In the absence of uranyl ions, the DNA tweezers are still in the "off" state, therefore, weak fluorescence can be obtained. signal (signal for sample 1 in Figure 2). Sample 2 is a sample without uranyl ion-specific DNase chain, and the rest of the process is the same as the optimal detection process (the signal of sample 2 in Figure 2), with a similar fluorescence intensity to sample 1, indicating that there is no uranyl ion-specific DNase The strand was unable to form the uranyl ion-specific DNase, and the linker of sequence 4 remained intact. Sample 3 is to replace the uranyl ion-specific DNase chain in the optimal detection process with a Pb ²⁺ -specific DNase chain: CATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT, and the rest of the process is the same as the optimal detection process (signal of sample 3 in Figure 2). The reason for the low fluorescence intensity of sample 3 is that the Pb ²⁺ -specific DNase chain cannot form uranyl ion-specific DNase with sequence 4, so that the tweezers cannot be opened when encountering uranyl ions. Sample 4 is the half-reaction time, that is, after mixing with the uranyl ion sample solution to be tested and incubating at 40°C for 30 minutes, the rest of the process is the same as the optimal detection process (the signal of sample 4 in Figure 2), and the fluorescence intensity is significantly recovered . This is because the cleavage reaction has progressed to a certain extent in half the reaction time, and part of the tweezers has been opened. Sample 5 is the molar ratio of uranyl ion-specific DNase chain and DNA tweezers changed to 2:10, and the rest of the process is the same as the optimal detection process (the signal of sample 5 in Figure 2). Due to the incomplete DNase cleavage reaction, the DNA The amount of enzyme is less, resulting in a decrease in fluorescence intensity.

To determine the fluorescence response of uranyl ions, different concentrations of uranyl ions were tested with the formed DNA tweezers probes. As shown in Figure 3A, the fluorescence signal gradually increased with uranyl ions in the range of 0.1 nM to 200 nM. A good linear relationship was obtained in the range of 0.1 nM to 60 nM between fluorescence intensity and uranyl concentration, with a correlation coefficient of 0.993 (Figure 3B). The detection limit of this sensitive DNA tweezers was estimated to be 25 pM according to the 3σ blank criterion. This detection limit is comparable to other reported DNase-based methods including fluorescence, colorimetric and electrochemical methods. The RSD of 0.1 nM uranyl ion measured in six replicates was 8.8%, indicating a satisfactory reproducibility of this DNA tweezers probe.

In terms of specificity, the "sample solution containing uranyl ions" in the above optimal detection process was changed to a solution containing the same concentration (60nM) of Ca2+, Mg2+, Pb2+, Sn2+, Hg2+, Zn2+, Cu2+ and Co2+, and the rest of the detection process As with the optimal detection procedure described, the resulting fluorescent signal was negligible (see Figure 4). It can be seen that the fluorescence intensity of other metal ions is much lower than that of uranyl ions. At the same time, experiments have shown that even if the concentration of the above-mentioned interfering ions is 100 times that of uranyl ions, the interference generated by them can be ignored. The good selectivity of this method can be attributed to the strong specificity of the uranyl ion-specific DNase chain.

Detection of uranyl ions in real samples:

The feasibility and applicability of this method for the detection of uranyl ions were evaluated by different water samples (drinking water, tap water and river water). The water samples were purified by centrifugation and filtered through a 0.22 μm membrane. The pH of the above sample was adjusted to 5.5. The sample is then tested according to the optimal testing procedure. The uranyl concentration in tap water samples determined by this method was 2.9 nM and 4.7 nM in river water. The recoveries of the spiked samples assayed ranged from 91.0% to 107.0%. Also, the RSD went from 5.6% to 9.2%. The results show that the DNA tweezers are feasible and can be used for practical water analysis.

The above descriptions are only preferred embodiments of the present application, and are not intended to limit the present application. For those skilled in the art, the present application may have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of this application shall be included within the protection scope of this application.

Claims (8)

1. A method for detecting the concentration of uranyl ions in a solution comprises the following steps:

(1) preparing gold nanoparticles;

(2) the DNA sequence 4 is modified by the gold nanoparticles, one end of the DNA sequence 4 is thiolated, and the other end of the DNA sequence 4 is connected with a fluorescent group;

(3) preparing a DNA forceps probe by using the DNA sequence 4 obtained in the step (2) after the gold nanoparticles are modified;

(4) mixing the DNA forceps probe obtained in the step (3), a proper amount of uranyl ion specific DNA polymerase chain and a uranyl ion sample solution to be detected;

(5) and (4) detecting a fluorescence signal of the solution obtained in the step (4), and obtaining the concentration of the uranyl ions in the sample solution by using a standard curve.

2. The method according to claim 1, characterized in that the DNA sequence 4 is in particular: HS-TACCAAAAACCTGGCAACTCACTATATrAGGAAGAGATGGACGGACGTGACGGACACACTACGGTACAAAACCCTA-FAM.

3. The method according to any of the preceding claims, characterized in that in step (3) DNA sequences 1 to 3 are also prepared together with DNA sequence 4 for the DNA tweezer probe, wherein DNA sequence 1 is: TAGGCTTCGTAAGGTCCACATACATACATACACCAGCGAGAATGTTCCGT, DNA the sequence 2 is: TAGGGTTTTTGTACCGTACCGACGGAACATTCTCGCTGG, DNA SEQ ID NO: TGGACCTTACGAAGCCTAACTAGCCAGGTTTTTTGGGTA are provided.

4. Method according to one of the preceding claims, characterized in that the uranyl ion-specific dnase chain is in particular: CACGTCCATCTCTGCAGTCGGGTAGTTAAACCGACCTTCAGACATAGTGAGT are provided.

5. The method according to one of the preceding claims, characterized in that step (2) is embodied as: thiolated DNA sequence 4 was mixed with gold nanoparticles in a 1: 1 for 12 hours to obtain the DNA sequence 4 modified by the gold nanoparticles.

6. The method according to one of the preceding claims, characterized in that step (3) is embodied as: DNA tweezer probes were formed by mixing 100nM DNA sequences 1-4 in 100mM MES buffer (pH 5.5) and 300mM NaCl, then heating the mixture to 95 ℃ and slowly cooling.

7. The method according to one of the preceding claims, characterized in that step (4) is embodied as: the 30nM uranyl ion-specific DNA polymerase chain and the solution of uranyl ions to be tested were mixed with DNA tweezers in 10mM MES buffer solution (pH 5.5) containing 300mM NaCl and incubated at 40 ℃ for 60 minutes.

8. The method of any of the preceding claims, wherein the fluorescent signal in step (5) is a fluorescent signal measured at 500nm to 600nm under excitation at 492 nm.

Images