CN113584040B

CN113584040B - Aptamer HPV3301 of HPV33 virus particle and application thereof

Info

Publication number: CN113584040B
Application number: CN202110919827.2A
Authority: CN
Inventors: 吴冬
Original assignee: Individual
Current assignee: Individual
Priority date: 2021-08-11
Filing date: 2021-08-11
Publication date: 2023-08-01
Anticipated expiration: 2041-08-11
Also published as: CN113584040A

Abstract

The invention relates to a nucleic acid aptamer HPV3301 of HPV33 virus particles and application thereof, wherein the sequence of the nucleic acid aptamer HPV3301 is as follows: 5'-TAGGCGTTGCTCCCCTTCGTCCCCC CTTTAGCGCAGCCCCCCCCAATACGTTCTCTTGTCCTCTCGAGGTTGTTACGC-3'; the nucleic acid aptamer HPV3301 can be combined with HPV33 virus particles with high affinity and high specificity, and the nucleic acid aptamer HPV3301 has wide application prospect and important scientific and social values in diagnosis and treatment of HPV33 infection, particularly has the function of blocking HPV33 infection, and can be used as a potential HPV33 infection treatment drug.

Description

Aptamer HPV3301 of HPV33 virus particle and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a high-affinity nucleic acid aptamer HPV3301 specifically combined with HPV33 virus particles and application thereof.

Background

Human papilloma virus (Human Papilloma Virus, HPV) is a circular double stranded DNA virus that is not enveloped. Currently, HPV has been found in more than 200 types, most of which show no obvious symptoms after infection in humans, and few of which show viral infections, such as various papillomas or warts and genital epithelial hyperplasia lesions of the skin. According to the research results of WHO International cancer research Institute (IARC) and other international organizations, human Papillomavirus (HPV) nucleic acid detection, genotyping and reagent technology examination guidelines issued by the medical instrument technology assessment center of the national drug administration, HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59 and HPV68 are classified as high-risk types, and HPV26, HPV53, HPV66, HPV73 and HPV82 are classified as medium-risk types. Among them, the high-risk type is closely related to cervical cancer occurrence, and is one of the main carcinogen factors for women.

The current lack of effective HPV antiviral therapies is a worldwide consensus. Although some antiviral drugs such as "nucleoside" antiviral drugs and interferons are currently marketed, the efficacy is not exact or even at all. Antiviral therapies specifically directed against HPV have not been developed. Thus, the use of any drug to kill HPV viruses is not mentioned (or recommended) in all guidelines for HPV prevention and treatment. There is therefore an urgent need for safe and effective medicaments for the treatment of HPV infections.

Aptamers are also known as "synthetic antibodies", "chemical antibodies", the chemical nature of which is the folding of a single-stranded oligonucleotide molecule (ssDNA or RNA) into a specific three-dimensional structure for high affinity and high specificity binding to a target substance. The aptamer was obtained by an in vitro screening procedure by systematic evolution of ligands by exponential enrichment (Systematic evolution of ligands by exponential enrichment, SELEX). The aptamer has the characteristics of high affinity, high specificity, in vitro synthesis, modification to change the function and pharmacokinetics characteristics, no immunogenicity, economy and the like. The aptamer medicine developed based on the advantages can specifically block the biological functions of targets, for example, can be used as an infection blocker of viruses, a neutralizing antagonist of toxins, an inhibitor of cytokines, a tumor therapeutic medicine for blocking transcription factors and the like.

The viroid particles are highly identical to the viral structure, structurally still having proviral character but no self-replicating ability, in order to reassemble the remaining material after removal of viral genetic material. Viroid particles enable a person to mount an immune response against the virus, thereby producing antibodies that provide a person with a good protection against the virus. Existing first and second generation cervical cancer vaccines both use "viroid" like HPV natural viroid as vaccine antigen. In addition, HPV virus particles are also used as infection models, and are widely used in the research field of screening anti-HPV infection medicines. At present, the screening of nucleic acid aptamer of HPV16 virus particles is studied, and the potential effect of inhibiting HPV16 infection is found. However, even one HPV type virus particle vaccine can only prevent one HPV type due to the differences between HPV types. Therefore, screening out aptamer binding HPV33 virus particles with high specificity and high affinity has important scientific research and clinical value as a blocker of high-risk HPV33 infection.

Disclosure of Invention

It is an object of the present invention to provide a nucleic acid aptamer HPV3301 of HPV 33-like virus particles having high specificity and high affinity; the invention also aims to provide application of the aptamer HPV3301 in preparing an HPV33 virus particle separation and enrichment reagent in a sample, an HPV33 detection reagent or kit and an HPV33 infection blocking medicament.

The aim of the invention is realized by the following technical scheme: a nucleic acid aptamer HPV3301 of an HPV33 virus-like particle, the sequence of which is as follows:

5'-TAGGCGTTGCTCCCCTTCGTCCCCCCTTTAGCGCAGCCCCCCCCAATACGTTCTCTTGTCCTCTCGAGGTTGTTACGC-3'(SEQ ID NO:1)

the nucleic acid aptamer HPV3301 of the HPV33 type virus particles is obtained by an in vitro SELEX screening technology based on the nucleic acid aptamer, wherein a PVDF membrane is used as a solid phase medium, the HPV33 type virus particles are used as targets, and the nucleic acid aptamer which is specifically combined with the HPV33 type virus particles is screened from a ssDNA library and named as the nucleic acid aptamer HPV3301.

The aptamer HPV3301 of the HPV33 virus particle can be subjected to chemical modification such as fluorescent group, amino, biotin, digoxin or polyethylene glycol at the 5 'end or the 3' end.

The aptamer HPV3301 of the HPV33 virus particle has the effect of inhibiting HPV33 infection at the level of a cell model, and can be used as a potential HPV33 infection blocker. The application of the aptamer HPV3301 of the HPV33 virus particle in preparing HPV33 infection treatment drugs.

The application of the aptamer HPV3301 of the HPV33 virus particles in preparing the separation and enrichment reagent of the HPV33 virus particles in the sample.

The nucleic acid aptamer HPV3301 of the HPV33 virus particle is applied to preparation of HPV33 detection reagents or kits.

Compared with the prior art, the invention has the advantages that:

1. the aptamer HPV3301 of the invention has no toxicity, small molecular weight, good permeability and easy synthesis and marking.

2. The synthesis cost of the aptamer HPV3301 is lower than that of antibody preparation, and the aptamer has the advantages of short period and good reproducibility.

3. The aptamer HPV3301 of the invention can be combined with HPV33 virus particles with high affinity and high specificity, has a dissociation constant of 103.7pM, and is not combined with other control HPV virus particles.

4. The aptamer HPV3301 has wide application prospect and important scientific and social values in diagnosis and treatment of HPV33 infection, particularly has the function of blocking HPV33 infection, and can be used as a potential HPV33 infection treatment drug.

Drawings

FIG. 1 is a diagram of bioinformatics modeling of the secondary structure of aptamer HPV3301.

FIG. 2 is a diagram showing the specificity of the fluorescent binding rate assay for aptamer HPV3301. In fig. 2, the abscissa indicates the analyzed protein, and the ordinate indicates the fluorescence binding rate.

FIG. 3 is a graph plotting dissociation constants of the aptamer HPV3301 binding HPV 33-type virus particles for fluorescence binding rate assay. The dissociation constant (Kd) was 103.7pM. In FIG. 3, the abscissa indicates the DNA concentration (pM), and the ordinate indicates the fluorescence binding rate.

FIG. 4 is a graph showing the dose-inhibition rate of flow cytometry analysis of aptamer HPV3301 to inhibit pseudoinfection of HPV 33-type viral particles. The abscissa indicates the DNA concentration (pM), and the ordinate indicates the relative infection rate.

Detailed Description

The present invention is described in detail below with reference to the drawings and examples of the specification:

a nucleic acid aptamer HPV3301 of an HPV33 virus-like particle, the sequence of which is as follows:

the aptamer HPV3301 of HPV33 virus particle is 100mM Na at 25 DEG C ⁺ ，1mM Mg ²⁺ The spatial structure is as follows:

the aptamer HPV3301 of the HPV33 virus particle is subjected to chemical modification on the 5 'end or the 3' end of the aptamer HPV3301, wherein the chemical modification comprises but is not limited to fluorescent groups, amino groups, biotin, digoxin, polyethylene glycol and the like.

The nucleic acid aptamer HPV3301 of the HPV33 virus particle is obtained by carrying out chemical modification on products obtained by carrying out truncated or prolonged or partial base substitution on the nucleic acid aptamer HPV3301, wherein the products comprise but are not limited to fluorescent groups, amino groups, biotin, digoxin, polyethylene glycol and the like.

The aptamer HPV3301 of the HPV33 type virus particles is obtained by an in vitro SELEX screening technology based on the aptamer, PVDF membrane is used as a solid phase medium, HPV33 type virus particles are used as targets, and the aptamer specifically combined with the HPV33 type virus particles is screened from a ssDNA library.

The screening method of the aptamer HPV3301 of the HPV33 virus particle comprises the following steps:

(1) Preparation of screening library: a random ssDNA library shown in the following sequence was prepared:

5’-TAGGCGTTGCTCCCCTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN CCTCTCGAGGTTGTTACGC-3’；

(2) Transferring HPV33 virus particles onto a PVDF film to prepare a PVDF transfer film;

(3) Subjecting the ssDNA library to a heat activation treatment;

(4) Incubating the ssDNA library obtained in the step (3) with the PVDF transfer film obtained in the step (2);

(5) Separating the PVDF transfer film obtained in the step (4), and washing off ssDNA which is not combined, weakly combined and non-specifically combined on the surface of the PVDF transfer film; heating the PVDF transfer film, and collecting ssDNA which is specifically combined with HPV33 virus particles, namely ssDNA enrichment library;

(6) And (3) PCR amplification: performing PCR amplification on the ssDNA enrichment library obtained in the step (5), wherein the primers used for the PCR amplification are as follows:

primer HPVup:5'-FAM-TAGGCGTTGCTCCCCTTCG-3' (SEQ ID NO: 2)

Primer HPVdown:5'-Biotin-GCGTAACAACCTCGAGAGG-3' (SEQ ID NO: 3);

(7) Purification of PCR products: purifying the PCR product by using a small fragment DNA purification kit; incubating the purified dsDNA with streptavidin magnetic beads, washing the streptavidin magnetic beads combined with the dsDNA, melting the dsDNA, separating by using a magnetic frame, and collecting the supernatant; the supernatant is subjected to ethanol precipitation to obtain a secondary ssDNA library for the next round of screening;

(8) And (3) circularly screening: taking the FAM-labeled secondary ssDNA library obtained in the step (7) as a secondary library for the next round of screening, and repeating the screening processes of the steps (3) to (7).

Embodiment one: screening of aptamer HPV3301

(1) Preparation of screening library: designing a ssDNA random library, wherein the sequence of the ssDNA random library is as follows: 5'-TAGGCGTTGCTCCCCTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCTCGAGGTTGTTACGC-3' comprising a fixed sequence region at both ends (19 nucleotides at each of the 5 'and 3' ends) and a random sequence region in the middle (40 random sequence nucleotides), and was assigned to the company of the division of biological engineering, inc.

(2) PVDF transfer film for preparing HPV33 virus particles: the HPV33 virus particles were derived from an escherichia coli expression system, purchased from us Creative Diagnostics company, purity >95% (SDS-PAGE), and the PVDF membrane was purchased from bioengineering company, inc. HPV33 virus particles were mixed in 5 XSDS-PAGE loading buffer and boiled in water for 10min. HPV33 virus particles were separated by SDS-PAGE electrophoresis. Soaking PVDF membrane in methanol for 3-5 seconds to saturation, and then placing the PVDF membrane in a membrane transfer buffer solution for balancing; and (3) transferring HPV33 virus particles in the SDS-PAGE gel to a PVDF membrane by using a Berle BIO-RAD omnipotent protein rapid transfer membrane instrument under the condition of 10V of a power supply, wherein the time is 60min. After washing the membrane with PBS buffer solution for 5min, putting the PVDF transfer membrane into PBS sealing solution containing 5% skimmed milk, sealing for 2h in a shaking table at 37 ℃, and rinsing the PVDF transfer membrane with PBS for 5min.

(3) 1nmol of the random ssDNA library was dissolved in 500. Mu.L of selection buffer (50 mM Tris-HCl,100mM NaCl,1mM MgCl) ₂ 5mM KCl, pH 7.4) and then heat activated. The method for heat activation treatment comprises the following steps: denaturation at 95℃for 5min, immediately followed by iceIce bath in water bath for 10min, followed by 10min at room temperature.

(4) Incubating the ssDNA library obtained in the step (3) with the PVDF transfer membrane of HPV33 virus particles (HPV 33 virus particle loading is 20 ng) obtained in the step (2) for 1h at room temperature, wherein the molar amount of the PVDF transfer membrane is 5 times that of the ssDNA library.

(5) Taking out the PVDF transfer film of the HPV33 virus particles after the step (4), and washing off ssDNA which is not combined, weakly combined and non-specifically combined on the surface of the PVDF transfer film of the HPV33 virus particles by using a selection buffer solution containing 0.2% BSA; then, the HPV33 type virus particle PVDF transfer film was placed at 200. Mu.L ddH ₂ O, after 5min of hot water bath at 100 ℃, the supernatant is collected by high-speed centrifugation, and ssDNA which is specifically bound with HPV33 virus particles, namely ssDNA enrichment library, is obtained.

(6) And (3) PCR amplification: adding the ssDNA enriched library obtained in step (5) to 1mL PCRmix; after vortex shaking and mixing, 50 mu L of each tube is subpackaged for PCR amplification, and the amplification conditions are as follows: pre-denaturing at 94 deg.c for 5 min; denaturation at 94℃for 30S, annealing at 63℃for 30S, elongation at 72℃for 30S,15-25 cycles.

Wherein 1mL of PCRmix contains: 100. Mu.L of 10 XPCR buffer; pfu enzyme 3. Mu.L; dNTP 20. Mu.L; primer HPVup:5'-FAM-TAGGCGTTGCTCCCCTTCG-3' and primer HPVdown: primer HPVdown: 3 mu L each of 5 '-Biotin-GCGTAACAACCTCGAGAGG-3'; the primer HPVup and the primer HPVdown are both entrusted to the synthesis of the engineering and bioengineering Co.Ltd.

(7) Purification of PCR products: PCR products, labeled with biotin and fluorescent groups FAM at both ends, were purified using a small fragment purification kit (the small fragment purification kit was purchased from Biotechnology Co., ltd.), the purified dsDNA was incubated with streptavidin beads (purchased from Invitrogen-Dynal Co.) at 37℃for 20min, and after washing the dsDNA-binding streptavidin beads three times with wash buffer (5 mM Tris-HCl, pH 7.5,1M NaCl, 500. Mu.MEHPVA), dsDNA was melted by incubation with 50. Mu.L NaOH solution (0.1M) for 30min at 37 ℃; the FAM-labeled secondary ssDNA library was obtained by ethanol precipitation of the supernatant, which was isolated with a magnetic rack, and dissolved in selection buffer as the secondary library for the next round of screening.

(8) The screening process was performed for a total of 12 rounds. From the second round, the secondary libraries were used in an amount of 30pmol each.

Embodiment two: acquisition and analysis of nucleic acid aptamer HPV3301 sequences:

(1) After 12 rounds of screening, the enriched ssDNA library was collected and the beijing xinnaobao medical examination was committed to all companies to analyze the library sequence using high throughput sequencing technology, the analysis process was: PCR amplifying the enriched library and adding sequencing adapter and Index portions; selecting a purified library by gel electrophoresis; measuring the concentration and purity of the DNA by using the Nanodrop one for quality control analysis; by Illuminate NovaSeq ^TM 6000 platform, using single-chain library as template to make bridge PCR amplification, sequencing primer annealing and sequencing while synthesizing; and comparing and enriching the sequencing result.

(2) According to the enrichment degree of the aptamer in the library, ssDNA with high enrichment degree is selected as a candidate aptamer, wherein the aptamer HPV3301 accounts for 16.9% of the enrichment library, and the sequence of the aptamer is shown as SEQ ID NO. 1.

(3) Analysis using a UNAFold network platform at 25℃with 100mM Na ⁺ ，1mM Mg ²⁺ Under conditions of the nucleic acid aptamer HPV3301 sequence. The secondary structure schematic of the analyzed aptamer HPV3301 sequence is shown in FIG. 1.

Embodiment III: specific analysis of nucleic acid aptamer HPV 3301:

(1) FAM-labeled aptamer HPV3301 was chemically synthesized in vitro and dissolved in selection buffer.

(2) Referring to step (2) of example one, BSA (purchased from Sigma Co.), HPV16 type virus particles, HPV18 type virus particles, HPV31 type virus particles, HPV33 type virus particles, HPV35 type virus particles, HPV39 type virus particles, HPV45 type virus particles, HPV51 type virus particles, HPV52 type virus particles, HPV56 type virus particles, HPV58 type virus particles, HPV59 type virus particles and HPV68 type virus particles (purchased from U.S. Creative Diagnostics Co.) were transferred onto PVDF membranes, respectively, to prepare PVDF transfer membranes containing the respective HPV type virus particles.

(3) 200. Mu.L of the aptamer HPV3301 solution obtained in the step (1) was mixed with each of the PVDF transfer films obtained in the step (2), and incubated in a cassette at room temperature for 1h.

(4) Washing the PVDF transfer film of step (3) with 0.1% PBST for 3 times, and eluting the aptamer bound to the PVDF transfer film by boiling with 200. Mu.L of selection buffer solution at 100 ℃ for 5min.

(5) The fluorescence intensities of the initial solution and the eluent are measured by a fluorescence quantitative analyzer, and the calculated fluorescence binding rate = (initial fluorescence intensity-elution fluorescence intensity)/initial fluorescence intensity×100% is used to preliminarily represent the binding rate of the nucleic acid aptamer HPV3301 to the target molecule.

As shown in FIG. 2, the binding rate of the aptamer HPV3301 and HPV33 virus particles is obviously higher than that of other HPV virus particles, which indicates that the aptamer HPV3301 and HPV33 virus particles have better specificity.

Embodiment four: affinity assay for aptamer HPV3301

(1) Different concentrations of FAM-labeled aptamer HPV3301 solution are respectively mixed with HPV33 virus particle PVDF transfer film, and incubated in a cassette for 1h at room temperature.

(2) Referring to the step (4) and the step (5) in the third embodiment, the fluorescence binding rates of the aptamer HPV3301 solution with different concentrations and the PVDF transfer film of the HPV33 virus particles are obtained and calculated through experiments.

(3) And drawing a saturation binding curve of the nucleic acid aptamer HPV3301 to the HPV33 type virus particles by using a calculated value of the fluorescence binding rate, and calculating a dissociation constant of the nucleic acid aptamer HPV3301 to the HPV33 type virus particles by nonlinear regression analysis.

As shown in FIG. 3, the saturated binding curve of the aptamer HPV3301 is obtained, and the dissociation constant of the aptamer HPV3301 is 103.7pM calculated, which shows that the aptamer HPV3301 has strong binding capacity to HPV33 virus particles, and the dissociation constant is in picomolar level.

Fifth embodiment: research on inhibition of HPV33 infection by aptamer HPV3301

(1) Cell culture: 293TT cells in DMEM37℃and 5% CO in culture medium ₂ Culturing under the condition, adding 5% Gibco fetal bovine serum, 100IU/mL penicillin and 100mg/mL streptococcal mycin.

(2) Method of investigation of nucleic acid aptamer HPV3301 to inhibit HPV33 infection:

the pseudoinfection of HPV33 type virus particles is used as a cell model of HPV33 infection. 293TT cells were seeded in 24-well plates (1X 10) ⁵ Well), incubated overnight at 37 ℃. Infection mixtures were prepared with 5000InU HPV33 virus particles and different concentrations of aptamer HPV3301 in a final volume of 80 μl PBS buffer. Random sequence ssDNA at the same concentration served as a blank. The infection mixture was gently stirred at room temperature for 20min and then added to 500. Mu.L of 293TT cell DMEM solution. After 20min, the supernatant was discarded to remove the infection mixture, and 1mL of pre-warmed DMEM with 5% fetal bovine serum was added. After 72h, cells were collected by centrifugation at 1000rpm, cell pellets were washed with PBS buffer, then resuspended in 0.5mL volume of PBS buffer, and analyzed in a flow cytometer using bandpass filters at 530/30nm (FL 1). Excitation with an argon laser of 488nm (1X 10) ⁴ Cells/time). The relative infection rates at the different concentrations were calculated as an indicator of inhibition of HPV33 infection by the aptamer HPV3301. Relative infection rate = infection rate of nucleic acid aptamer HPV 3301/infection rate of control.

(3) Results of studies on inhibition of HPV type 33 infection by nucleic acid aptamer HPV 3301:

as shown in FIG. 4, the aptamer HPV3301 is capable of inhibiting HPV type 33 pseudovirus infection in a dose-dependent manner. When the aptamer HPV3301 concentration reaches 30 mu M, the inhibition effect reaches saturation, and the inhibition rate (1-relative infection rate) can reach 45%.

The foregoing is merely a preferred embodiment of the present invention, and it should be noted that changes, modifications and adaptations to those skilled in the art may be made without departing from the spirit of the present invention and are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> Wu Dong

<120> aptamer HPV3301 of HPV33 virus particle and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 78

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

taggcgttgc tccccttcgt ccccccttta gcgcagcccc ccccaatacg ttctcttgtc 60

ctctcgaggt tgttacgc 78

<210> 2

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

taggcgttgc tccccttcg 19

<210> 3

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

gcgtaacaac ctcgagagg 19

Claims

1. A nucleic acid aptamer HPV3301 of an HPV33 type viral particle, characterized in that: the sequence of the nucleic acid aptamer is as follows:

5'-TAGGCGTTGCTCCCCTTCGTCCCCCCTTTAGCGCAGCCCCCCCCAATACGTTCTCTTGTCCTCTCGAGGTTGTTACGC-3'。

2. the aptamer HPV3301 of HPV 33-like virus particles of claim 1, wherein: the 5 'or 3' end of the aptamer HPV3301 is chemically modified with a fluorophore, amino, biotin, digoxygenin or polyethylene glycol.

3. Use of the aptamer HPV3301 of HPV33 virus particles of claim 1, in the manufacture of a medicament for the treatment of HPV33 infection.

4. Use of the aptamer HPV3301 of HPV33 type virus particles of claim 1, in the preparation of a reagent for the isolation and enrichment of HPV33 type virus particles in a sample.

5. Use of the aptamer HPV3301 of HPV33 virus-like particles of claim 1 in the preparation of an HPV33 detection reagent or kit.