CN101503737A - HPV viral antigen, ligand tube-type PCR detection kit, preparation and use thereof - Google Patents
HPV viral antigen, ligand tube-type PCR detection kit, preparation and use thereof Download PDFInfo
- Publication number
- CN101503737A CN101503737A CNA2008102323187A CN200810232318A CN101503737A CN 101503737 A CN101503737 A CN 101503737A CN A2008102323187 A CNA2008102323187 A CN A2008102323187A CN 200810232318 A CN200810232318 A CN 200810232318A CN 101503737 A CN101503737 A CN 101503737A
- Authority
- CN
- China
- Prior art keywords
- pcr
- pipe
- ligand
- aglucon
- liquid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a PCR tubular detection kit for detecting an HPV virus antigen and a ligand thereof. The kit comprises a PCR tube of an antibody or a petunidin of a sexual human immunodeficiency virus (HPV) target molecule which is obtained by capture, detection agents of A solution and B solution for detecting a ligand or an antigen of the sexual human immunodeficiency virus (HPV), a standard product and a reference product. The invention converts a ligand signal into a nucleic acid petunidin signal by direct combination of specific oligonucleotide petunidin (specific oligonucleotide petunidin carrying signal molecules) and the ligand, and then measures the ligand by PCR augmentation for amplification and detection, so the detection kit has the characteristics for detecting the ligand with quickness, high sensitivity and quantitive measurement. The invention also discloses a preparation method for the kit and an application method of the kit for detecting sexual human immunodeficiency virus (HPV) in the specific oligonucleotide ligand.
Description
Technical field
The present invention relates to a kind of detection kit, relate in particular to a kind of HPV virus antigen and ligand pipe PCR detection kit and its production and application.
Background technology
Early protein detect be based on antibody with the proteinic low dissociation constant of specific thing to be checked and certain specificity, screening method---the antibody capture method of employing simple and convenient.This method is to have or not antigen in the test sample: at first with antigen coated in solid support, go conjugated antigen to form mixture with antibody then, unconjugated antibody is removed in flushing, at last with and the tagged molecule of binding antibody specific recognition remove to detect binding antibody; Also can antigen, antibody is after reaction forms mixture earlier, is attached on the solid support again, detects mixture then.Many antibody capture methods are to utilize indirect method to detect antibody, as to detect antibody be murine antibody, then detection molecules may be the rabbit anti-mouse antibody of band certification mark, but used traditional detection mark comprises radio isotope, dyestuff and acts on substrate generation detection molecules such as chromogenic enzyme.
Enzyme-linked immunosorbent assay (enzyme linked immunosorbent assay, ELISA) be the immunodetection that is widely known by the people, traditional elisa technique is like the sandwich sandwich assay, promptly two antibody are attached to a certain antigen---capture antibodies jointly, with it with the antigen combination in the sample, the detection antibody that adds the coupled enzyme of synantigen bonded again, reaction forms capture antibodies-antigen-detection antibody " sandwich " mixture then, surveys coupled enzymic activity at last and shows detected result.Though antibody testing method has bigger using value, its sensing range is subjected to capture antibodies and the restriction of antigen reactive dissociation constant (Kd) value.In practice, detecting lower bound approximately is 1% of Kd value, and when analyte concentration is reduced to this possibility limit of detection, the analysans antibody percentage that is captured will be not enough to produce the detectable signal with respect to signal to noise ratio.Therefore, with the about 1pg/ml of detection lower limit (10-4M is to molecular-weight average 50,000 daltonian protein) of the antibody testing method of fluorescence or chemiluminescence detection system.
Fast development along with gene engineering is used has more technique of gene detection in the antigen-antibody context of detection.
The detection of nucleic acid determinand requires to be different from the technology of antibody test.In middle 1980s, but the method discovered of dna technique by enzyme repeat amplification protcol process DNA amplification, be polymerase chain reaction (Polymerase Chain Reaction afterwards, PCR): at first add two complementary oligonucleotide sequences (being primer), it will be combined in the both sides in the zone that will increase, heat denatured then, in the cooling annealing process, allow primer with the complementary sequence combination, add Klenow fragment dna polymerase i again to extend primer, by repeating sex change, annealing, extend desirable fragment, target dna will increase with exponential manner.PCR once crossed many improvement, an important variation is the application of heat-resisting polymerase (being the Taq polysaccharase), it originates in thermophile bacteria in the hot spring, has thermostability, hardly by temperatures involved in the PCR sex change, so needn't must add polysaccharase after the sex change each time as using heat labile Klenow polysaccharase I.
In with the utilization of PCR, produced immunity-PCR method as amplification system.This method is that particular test is connected on the microwell plate, detect with the pcr amplification amplifying power then---for example bSA (BSA) is passive is adsorbed onto on the plate for detecting immunity, adding is to the specific antibody (being connected with albumin A streptavidin fusion rotein and biotin labeled report amplicon) of BSA, report amplicon with agarose electrophoretic analysis behind the PCR, can detect a hundreds of BSA molecule, but this method can not realize detection by quantitative, in default of the special seizure molecule of determinand, can not be used for biology sample detection simultaneously.For this reason, people constantly make improvements: at first is connected the streptavidin fusion rotein that biotinylation is reported amplicon with one, yet the adding of 5 kinds of reagent, washes plate, amplification, detection and waste time and energy very much with the biotinylation second antibody, and the complexity of dissociating; Again report amplicon covalency is linked on the second antibody subsequently, reduced the reagent number and the complicacy of dissociating though directly connect, but still need the PCR operation, labour intensity and testing laboratory's contamination of heavy can't reduce.
Sandwich style immunity-PCR is the reorganization by traditional E LISA mode, promptly detects antibody and is connected with dna marker, applies to the analyzing and testing biological sample again.Early stage antibody mediated immunity-PCR test format is that primary antibody is fixed on the flat board, adds sample then successively, detects antibody with biotinylation again, streptavidin and biotinylated DNA; Be improved to direct connection DNA afterwards and produce the PCR product to antibody and with labeled primer, and the amplification ability of PCR can produce a large amount of dna markers, this dna marker can be analyzed with the typical gels electrophoresis detection.The dna marker that pcr amplification antibody carries can improve sensitivity to Detection of antigen (this method lack with gene chips detect), and is also higher than the sensitivity of traditional E LISA method, but needs a large amount of manual operations with gel electrophoresis purifying amplified production, therefore consuming time; And the primer that is used for pcr amplification can cause that when annealing the dimer amplification produces byproduct; Also there is pollution ribose in it or pollutes the situation that also will be amplified equally simultaneously.
The immuno-PCR method is to adopt a capture antibodies, is similar to direct ELISA sandwich sandwich assay, and difference is to select detection method.This method successfully has been used to detect tumour necrosis factor, the sweet enzyme of beta galactose, human thyroid stimulates materials such as hormone, the solvable T-cell receptors of mouse, recombination hepatitis B surface antigen, different human atrial natriuretic peptide, beta-Glucoside kinase, chorionic-gonadotropin hormone, and the susceptibility that has reaches 10
-15Mol level.
In the immuno-PCR method, antigen concentration by PCR after product analysis decision, can be a gel electrophoresis analysis usually, also can be that PCR-ELISA analyzes.The dna marker of quantitative analysis PCR terminal point product easily produces error result, because the product rate of formation promptly descends after several logarithmic growth circulations, moreover the PCR sample preparation can cause laboratory pollution; In addition, these experiments are because step is many and need flushing, and therefore dissociating may appear in immune complex in this process.
Real-time quantitative PCR is more advanced round pcr, has been used for foranalysis of nucleic acids.In PCR in real time, pcr amplified dna is to carry out under non-linear mark, two fluorescent hybridization probe existence condition, and wherein a kind of fluorescence dye is as reporter molecules, and its emmission spectrum is by second kind of fluorescence dye cancellation; This PCR in real time is when chain extension, reporting dyes is positioned at hybridization probe 5 ' end (FAM), quencher dyes be positioned at 3 ' end (TAMRA), the special target sequence combination of this probe and pcr amplification, when not in conjunction with the time, 5 ' end FAM emitted fluorescence is by 3 ' TAMRA cancellation, but along with the PCR circulation increases, amplicon increases, and hybridization probe is by the active cutting of Taq polymerase 5 '-3 ' nucleic acid, the result discharges the report fluorescence dye from quencher dyes, causing the reporter molecules emission peak increases.Sequence detection system ar atmo laser active fluorescence (488nm), laser aid photographic camera monitoring PCR reaction, the 500nm-660nm fluorescence that collection is sent from all 96 holes utilizes corresponding principle then, sets up internal reference, and is directly quantitative by certain software analysis.This technology realization entire reaction is monitored in real time, also can use reverse transcription-pcr simultaneously.But therefore the fluorescence Spectra when reacting with PCR in the every hole of thermal cycler continuous detecting, 96 hole owing to sequence detection system, can be got rid of replicon testing laboratory and pollute.
Gold etc. are at nineteen ninety-five (Gold L, et al.Annu Rev Biochem (biological chemistry annual report), 64:763--797) use the RNA and the ssDNA aglucon of the systemic lupus erythematous specific antibody that SELEX filters out, not only systemic lupus erythematous is diagnosed, and can be carried out state of illness monitoring and curative effect check; Gold etc. are again at (Gold L, et al.Diagn Dec (diagnosis) in 1999; 4 (4): 381-8) in little gust of molecular diagnosis applied research of aglucon, little gust of resolving power of aglucon is studied.Above-mentioned research all demonstrates the detection of nucleic acid aglucon and has great application prospect, it all is to adopt directly to aglucon pcr amplification amplification detection that but present aglucon detects, this detecting operation complexity, not only need part is separated with aglucon, and since part with after aglucon separates, the combination again of aglucon purity and residual part and aglucon can be duplicated by blocking dna, therefore causes the low and poor accuracy of detection sensitivity.
It is universal phenomenon that nucleic acid and protein interact in cell, nucleic acid can be folded to form secondary structure and tertiary structure, this is extremely important to itself and the protein effect of mutually combining, and makes vitro detection nucleic acid protein interaction method maturation by making the nucleotide sequence variation.The aglucon phyletic evolution technology of index concentration (Systematic Evolutionof Ligandsby Exponential Enrichment, SELEX) be used to separate the nucleotide ligand of selected target, these parts are called as aglucon or aptamers, meaning is that nucleic acid can form a fixed structure and be fitted into the pocket of target molecule, and the SELEX technology is exactly to utilize the method for this principle screening target molecule aglucon.Utilize the SELEX technology, the Nucleotide aglucon of many targets is screened to be gone out, especially known energy and nucleic acid bonded numerous protein can be used as the SELEX technology than suitable targets, as autoimmune antibody, E2F transcription factor and the different HPV associated protein of T4DNA polysaccharase, phage R17 envelope protein, the intestinal bacteria rho factor, intestinal bacteria ribosomal protein S1, phenylalanine-tRNA synthetic enzyme, identification RNA.
The fact that the SELEX technology can filter out many different albumen aglucons has caused the expansion that aglucon is used, the substitute that these aglucons can be used as monoclonal antibody and how anti-product is applied to diagnosis and treatment, aglucon as archaeal dna polymerase has been used to the replicon that heat start PCR is diagnosed low copy, improves PCR susceptibility and fidelity; Simultaneously aglucon also is used to promote experimental technique, is used for flow cytometer as the enzyme part fluorescent mark of neutral elastin and detects Proteinase, bone marrow serine concentration, and neutral elastoser aglucon is used for mouse lung inflammation diagnostic model in-vivo diagnostic.
In enzyme connection oligonucleotide method, the aglucon that one or more antibody are resisted original high-affinity, high specific replaces, and such aglucon can obtain by SELEX technology in-vitro screening.
Enzyme connection oligonucleotide method has been described, wherein with detection antibody or capture antibodies in the Nucleotide aglucon replacement sandwich assay among United States Patent (USP) WO96/40991 and the WD97/38134; Also mention simultaneously seizure molecule-target molecule-detection molecules mixture amplifying nucleic acid aglucon pcr amplification detection system.The PCR primer of this method utilization reporter molecules commonly used such as enzyme, vitamin H etc. the amplicon that increases, when improving amount of ligand, also needing further increases the aglucon of amplification and impure nucleotide primer dimer separation steps like this.DNA and RNA aglucon also exist such problem.In addition, sandwich assay is surveyed antibody test with traditional enzyme joint inspection and is caught molecule-antigenic compound, use reporter enzyme molecule marker oligonucleotide then, this needs chemosynthesis step and extra work, being used for the primer of mark simultaneously can not solve impure problem and primer dimer amplification problem, therefore, can't solve the problem of detection by quantitative.
Summary of the invention
But technical problem to be solved by this invention provides a kind of highly sensitive, quick detection by quantitative human papillomavirus (Human papillomavirus, HPV) HPV virus antigen and ligand pipe PCR detection kit.
Another technical problem to be solved by this invention provides a kind of simple and easy to do HPV virus antigen and the preparation method of ligand pipe PCR detection kit.
The technical problem that the present invention also will solve provides HPV virus antigen and the application of ligand pipe PCR detection kit in the special oligonucleotide ligand that detects acquired human immunodeficiency HPV virus.
For addressing the above problem, a kind of HPV virus antigen of the present invention and ligand pipe PCR detection kit comprise
-PCR manages the regular-PCR pipe of making for polystyrene material, wraps the antibody or the aglucon of the acquired human immunodeficiency HPV virus target molecule that is captured on it;
-detection reagent A liquid and B liquid are used for acquired human immunodeficiency HPV virus part/Detection of antigen;
-standard detection sample;
-feminine gender and positive control sample.
A kind of A liquid that is used for aforesaid HPV virus antigen and ligand pipe PCR detection kit is characterized in that: it is that 7.4 25pmol/ul has the detection aglucon of artificial sequence modification and the phosphate buffered saline buffer of 2ug/ml antibody is formed by 100ul, pH value.
The detection aglucon of described artificial sequence modification is meant strand loop-stem structure and two the complementary two strandss that artificially add known array at 3 ' and 5 ' end of aglucon respectively or simultaneously.
A kind of B liquid that is used for aforesaid HPV virus antigen and ligand pipe PCR detection kit is characterized in that: it is made up of the hot resistant DNA polymerase and the water of 1ul upstream primer, 1ul downstream primer, 8ul4 * dNTP, 10u110 * PCR damping fluid, 2～5 units; Wherein the upstream primer sequence is 1:5 '-TCTAACGTGAATGATAG-3 '; The downstream primer sequence is 2:5 '-TATGGTCGAATAAGTTAA-3 '.
This B liquid also contains molecular beacon.
Described molecular beacon be stem toroidal molecule beacon, SYBR Green 1 fluorescence dye of modification sequence and have fluorescence molecule and the probe molecule beacon of quencher molecule in any one.
A kind of method for preparing aforesaid HPV virus antigen and ligand pipe PCR detection kit may further comprise the steps:
(1) under 37 ± 1 ℃, be that 1～20% glutaraldehyde is handled the PCR pipe with volumetric concentration, glutaraldehyde is managed attached to PCR;
(2) clean the PCR pipe with ultrapure water;
(3) will catch the aglucon/antibody sandwich of HPV target molecule on the PCR pipe;
(4) be that the PCR pipe is closed in 7.4 the sodium bicarbonate buffer fluid-tight that contains the smart DNA of 5% skim-milk, glycine, bovine serum albumin and tortoise with the pH value, drying gets the PCR pipe;
(5) preparation detection reagent A liquid: will detect the antibody of HPV virus and in pH value is 7.4 phosphate buffered saline buffer, hatch and pass through ultraviolet-crosslinkable, or dissolve aglucon with phosphate buffered saline buffer and get final product through the special oligonucleotide aglucon of the antibody of sequence modification;
(6) preparation detection reagent B liquid: will add water promptly after each component mixing of B liquid;
(7) with dried PCR pipe, detection reagent A liquid and B liquid and standard detection sample, feminine gender and positive control sample assembling, put into test kit and get final product.
Aglucon in the described step (3) is coated on and is meant on the PCR pipe that elder generation is coated on streptavidin on the PCR pipe, adds the part that has vitamin H again and catches aglucon, by the combination of streptavidin and vitamin H, the seizure aglucon is anchored on the PCR pipe.
Antibody sandwich in the described step (3) is that 9.6 sodium bicarbonate buffer liquid is coated on the PCR pipe being meant on the PCR pipe monoclonal anti body and function pH value.
The application in the special oligonucleotide ligand that detects acquired human immunodeficiency HPV virus of a kind of aforesaid HPV virus antigen and ligand pipe PCR detection kit may further comprise the steps:
1. be provided with feminine gender and and the positive criteria curve;
2. the preparation of testing sample;
3. in the PCR pipe, add testing sample regulating YIN and YANG control sample, hatched 45～120 minutes at 37 ± 1 ℃;
4. the effective washing lotion flushing of PCR after step being hatched in 3.;
5. in the PCR pipe, add A liquid, hatched 45～120 minutes at 37 ± 1 ℃;
6. the effective washing lotion flushing of PCR after step being hatched in 5.;
7. add standard substance again after in the PCR pipe, adding B liquid, adopt real-time quantitative-PCR to detect go forward side by side line data collection and processing.
Described step 4. and the washing lotion 6. be meant that the pH value is 7.4, contains the phosphate buffered saline buffer of 0.05% tween 20.
The marker that described step real-time quantitative-PCR in 7. detects is selected from one or more in chemiluminescent substance, enzyme, fluorescence and the isotropic substance.
The present invention compared with prior art has the following advantages:
1, because the present invention utilizes PCR pipe that polystyrene makes after glutaraldehyde is handled, can adhere to nucleic acid ligands (or antigen, antibody and aglucon etc.), directly combine with part by the special oligonucleotide aglucon special oligonucleotide aglucon of signaling molecule (or carry), the part conversion of signals is become nucleic acid aglucon signal, amplify, detect through PCR (or rolling-circle replication) amplification then, measure part, but so its detector ligand have the advantages that quick, highly sensitive, high specificity, multiple ligand micro array detection and mechanize are finished.
2, because the present invention utilizes the artificial modification DNA be connected on antibody or the aglucon or RNA sequence as signaling molecule, this modifying DNA or RNA sequence have a pair of primer and the artificial flag sequence of intermediary, at detected target molecule and testing goal require this a pair of primer can be identical also can be inequality, the intermediary flag sequence is the mark of target molecule, therefore by pcr amplification, can realize detection to antigen or part to the signal modification sequence.
3, since the present invention in use by adopting real-time quantitative-PCR instrument to carry out that amplified production detects or oligonucleotide chip detects and carries out data acquisition and processing (DAP), therefore the effect that reaches data by the conversion to DNA or RNA modification sequence just can effectively carry out the detection of simple sample or several samples simultaneously.
4, because the data acquisition and processing (DAP) in use carried out of the present invention disposable finishing in the PCR pipe all, need not the product conversion is local, purify, step such as detection, and the PCR product can be destroyed at the PCR closed frame tube, so operating process is simple, safety, can effectively avoid the environmental pollution that product caused of overflowing.
5, the present invention is owing to only need part and aglucon incubated at room just can be finished in 45 minutes the association reaction of part and aglucon in when reaction, so easy and simple to handle, is convenient to the popularization and application of common laboratory or Clinical Laboratory section office.
6, because the detection kit of the present invention's assembling or the biochip of structure can be widely used in fundamental research and clinical detection, therefore have certain economic benefits and social benefit.
Description of drawings
Below in conjunction with accompanying drawing the specific embodiment of the present invention is described in further detail.
Fig. 1 is the special oligonucleotide aglucon of the segmental aglucon of a mouse IgG-Fc of the present invention sequence.
Fig. 2 is novel immunity of the present invention-PCR testing process.
Fig. 2 a is the special oligonucleotides-modified aglucon of the Fc fragment of IgG antibody of the present invention.
Fig. 2 b is the special oligonucleotides-modified aglucon pcr amplification product of the Fc fragment of IgG antibody of the present invention, fluorescent signal molecule 5 ' fluorescence molecule-TTTTTTTTTT-fluorescent quenching molecule 3 ' sequence.
Fig. 3 is an aglucon testing process of the present invention.
Fig. 3 a is of the present invention 5 ' biotinylated seizure aglucon sequence.
Fig. 3 b is the detection aglucon sequence of modification of the present invention.
Fig. 3 c is a pcr amplification product of the present invention, the fluorescent signal molecule: 5 ' fluorescence molecule (excitation light source wavelength 470nm, detection light source wavelength 510nm)-TTTTTTTTTT-fluorescent quenching molecule 3 ' sequence.
Fig. 4 is real-time quantitative of the present invention-PCR schematic diagram.
Fig. 5 is the real-time quantitative PCR detection curve of present embodiment 1.
Fig. 6 is the typical curve of the sample detection of present embodiment 1.
Fig. 7 is the real-time quantitative PCR detection curve of present embodiment 2.
Fig. 8 is the typical curve of the sample detection of present embodiment 2.
Embodiment
A kind of HPV virus antigen and part PCR tubular type detection kit comprise and wrap the be captured antibody of HPV virus target molecule or the detection PCR pipe of aglucon on it; The detection reagent A liquid and the B liquid that are used for HPV virus part/Detection of antigen; Standard substance and reference substance.Wherein:
A liquid is made up of aglucon/antibody that has artificial sequence modification and phosphate buffer soln;
B liquid comprises upstream primer, downstream primer, 4 * dNTP, 10 * PCR damping fluid and hot resistant DNA polymerase;
The upstream primer sequence is 1:5 '-TCTAACGTGAATGATAG-3 '
The downstream primer sequence is 2:5 '-TATGGTCGAATAAGTTAA-3 '
The known titre that standard detection sample, feminine gender and positive control sample are assert for country is the test sample of 103～108 copy/ul.The standard detection sample sequence is 5 '-TCTAACGTGAATGATAGAAAAAAAAAAAAAAAAAAAAAATTAACTTATTCGACCAT A-3 '
In B liquid, can also add stem toroidal molecule beacon, SYBR Green 1 nucleic acid stain and have fluorescence molecule and the probe molecule beacon of quencher molecule in any one molecular beacon.
Selected fluorescent molecular bacon in the present embodiment for use, its sequence is 5 ' fluorescence molecule-TTTTTTTTTT-fluorescent quenching molecule 3 '.
For ease of understanding, the present invention selects for use the segmental special oligonucleotide aglucon sequence of mouse IgG-Fc (referring to Fig. 1) to carry out the description of specific embodiment, this sequence is the oligonucleotide fragment of one section 20-40 base going out at ligand screening by the SELEX technology, behind artificial increase modification sequence, make its aglucon sequence that becomes the portability bulk information be used for the synoptic diagram that multiple part detects simultaneously again.Artificial sequence can be added in 5 ' end, 3 ' end respectively or hold at 5 ' end and 3 ' and add that simultaneously length can be various, and wherein the PCR the primer is that the complementary sequence of sequence is artificially added at oligonucleotide aglucon two ends.
Embodiment 1: novel immunity-PCR detects
Novel PC R testing process (referring to Fig. 2) is meant: after the PCR pipe is handled, at first wrap by an antibody, hatch jointly with test sample then, form one antibody-antigenic compound; After cleaning, add detection antibody again, hatch the unconjugated detection antibody of back flush away jointly, carry out the analysis and the processing of pcr amplification and amplified production at the aglucon modification sequence at last through the aglucon mark.Its concrete steps are as follows:
1, the preparation of PCR pipe: be that 1～20% glutaraldehyde was handled 1～3 hour down at 37 ± 1 ℃ with the effective 50ul of 0.2ml polystyrene PCR, volumetric concentration; Manage three times with ultrapure water, each 2～5 minutes flushing PCR; With the pH value is that the monoclonal antibody 2ug/ml that 9.6 sodium bicarbonate buffer liquid will be caught the HPV virus antigen is coated on the PCR pipe, be that 7.4 the sodium bicarbonate buffer liquid that contains 5% skim-milk, glycine, bovine serum albumin and the smart DNA of tortoise was handled 1～3 hour down at 37 ± 1 ℃ then with the effective 100ul of this PCR, pH value, make the PCR duct occlusion, dry back is stand-by.
2, the preparation of antibody reagent A liquid: will detect HPV virus mouse IgG antibody 2ug/ml and through the special oligonucleotide aglucon of the mouse IgG antibody Fc of sequence modification 25pmol/ul (referring to Fig. 2 a: detect aglucon and form first part by two portions:
5 '-TAATACGACTCACTATAGCAATGGTACGGTACTTCCAAGCTAACCCTCATCTGCGC GCTCCCAAAAGTGCACGCTACTTTGCTAA-3 ' is the special oligonucleotide aglucon of mouse IgG antibody Fc; Second section: double-stranded 5 '-TCTAACGTGAATGATAGAAAAAAAAAAAAAAAAAAAAAATTAACTTATTCGACCAT A-3 ' is the aglucon modification sequence, wherein 5 '-AAAAAAAAAAAAAAAAAAAAA-3 ' is a flag sequence), in 100ul, pH value 1 * PBS (138mM NaCl of 7.4,2.7mM KCl, 8.1mM Na
2HPO
4, 1.1mM KH
2PO
4, 1mM MgCl
2) in hatched jointly 60～120 minutes, and, make antibody and aglucon form more stabilized complex by 308 nano wave lengths, 12 joules, 1 minute ultraviolet-crosslinkable.
3, the preparation of PCR detection reagent B liquid: will contain add water to 100ul after Taq archaeal dna polymerase (face and the use preceding adding) mixing of the upstream primer of modification sequence and downstream primer each (25pmol/ul) 1ul, 4 * dNTP8ul, 10 * PCR damping fluid 10ul (containing Mg2+) and 2～5 units (can be promptly according to detector.
Wherein 10 * PCR damping fluid is that the Tris-HCl of 8.3 50mmol Repone K, 15mmol magnesium chloride, 10mmol and mass concentration are the mixture that 0.1% gelatin is formed by the pH value; The mixture that 4 * dNTP is made up of dATP, dTTP, dGTP and the dCTP of every kind of 2.5mM.
Below for using the concrete operations step:
Each detection all should be pressed 100pg according to negative, positive control sample, and 10pg, 1pg, 0.1pg, 0.01pg, 0.001pg are provided with feminine gender and and positive criteria curve.
(1) taking out detection PCR pipe from test kit puts on the testing stand, will be at 60 minutes human serum sample 100ul of 56 ℃ of following deactivations, and the negative and positive control sample is put into common Eppendorf centrifuge, with 4000 rev/mins rotating speed after centrifugal 10 minutes, get each 50ul of detected person's serum regulating YIN and YANG control sample serum respectively and add in the detection PCR pipe, under 37 ± 1 ℃, hatched 45～120 minutes.
(2) manage 3 minutes/time 3 times with washing lotion flushing PCR; Wherein washing lotion is that the pH value is 7.4, contains the phosphate buffered saline buffer (PBS) of 0.05% tween 20 (Tween-20).
(3) in the PCR pipe, add A liquid 60ul, under 37 ± 1 ℃, hatched 45～120 minutes.
(4) manage 3 minutes/time 3 times with the flushing of the washing lotion in the step (2) PCR.
(5) in the PCR pipe, add B liquid 60ul after, the standard model that adds simultaneously 4 production standard curves again, adopt Rotor-Gene RG3000 to carry out real-time quantitative-pcr amplification, totally 35 circulations (referring to Fig. 4, Fig. 5) are carried out data acquisition and processing (DAP) then and are printed examining report.
Wherein amplification condition is 95 ℃ of pre-sex change, 5 minutes; Sex change 94 ℃, 30 seconds; Renaturation 55 ℃, 30 seconds; Extended 72 ℃, 30 seconds; Extended 72 ℃, 5 minutes eventually.
The marker that real-time quantitative-PCR detects is selected from one or more in chemiluminescent substance, enzyme, fluorescence and the isotropic substance.
Fig. 4 is real-time quantitative of the present invention-PCR schematic diagram.
Fig. 5 is the real-time quantitative PCR detection curve of present embodiment, and this curve X-coordinate is the cycle index of PCR, and ordinate zou is a PCR product fluoroscopic examination logarithmic value.Can calculate the Ct value of each template by this curve, there is linear relationship in the logarithm of the Ct value of each template and the initial copy number of this template, utilizes the standard substance of known initial copy number can make typical curve and reaches by typical curve at last unknown template is carried out quantitative analysis.
Fig. 6 is the typical curve of the sample detection of present embodiment, and this curve X-coordinate is the copy number of aglucon modification sequence template, and ordinate zou is the Ct value.Utilize the known initial copy number and the Ct value drawing standard curve of standard substance, the Ct value of each unknown template is obtained the initial copy number of unknown template by typical curve, thereby calculates detector ligand or antigenic content.
Detected result such as following table:
| Numbering | Multi-color cord | Title | Type | Ct | Predetermined copy (copies/ul) | Detect copy (copies/ul) |
| Numbering | Multi-color cord | Title | Type | Ct | Predetermined copy (copies/ul) | Detect copy (copies/ul) |
| 1 | ■ | |
Standard | 17.98 | 50,000,000.00000000 | 51,615,165.78285460 |
| 2 | ■ | |
Standard | 21.43 | 5,000,000.00000000 | 4,782,804.11532328 |
| 3 | ■ | |
Standard | 24.71 | 500,000.00000000 | 496,732.82251228 |
| 4 | ■ | |
Standard | 28.00 | 50,000.00000000 | 50,967.95853644 |
| 5 | ■ | 20080616H01 | Unknown | 34.25 | 680.48976215 | |
| 6 | ■ | 20080617H01 | Unknown | 32.34 | 2,555.21558119 | |
| 7 | ■ | 20080617H02 | Unknown | 34.06 | 776.30482338 | |
| 8 | ■ | Negative control | Unknown | |||
| 9 | ■ | Positive control | Unknown | 20.56 | 8,722,804.87739972 |
Embodiment 2: aglucon detects
Aglucon testing process (referring to Fig. 3) is meant: after the PCR pipe was handled, at first bag was identified the aglucon of part, hatches jointly with test sample then, forms part-aglucon mixture; After cleaning, add the different aglucons of the identification detector ligand of modified sequence mark again, hatch the unconjugated detection aglucon of back flush away jointly, carry out the analysis and the processing of pcr amplification and amplified production at the aglucon modification sequence at last.Its concrete steps are as follows:
1, the preparation of PCR pipe: the effective 50ul of 0.2ml polystyrene PCR, 1～20% glutaraldehyde were handled 1～3 hour at 37 ± 1 ℃; Manage three times with ultrapure water, each 2～5 minutes cleaning PCR; After being coated on 50ul chain bacterium avidin (streptavidin) on the PCR pipe, be that 7.4 the sodium bicarbonate buffer liquid that contains 5% skim-milk, glycine, bovine serum albumin and the smart DNA of tortoise is handled sealing in 2 hours at 37 ℃ with 60ul, pH value, dry back is stand-by; Be 7.4 sodium bicarbonate buffer liquid rinsings three times with 300ul, pH value then, each 3 minutes; What the 50ul that adds 25pmol/ul again caught the HPV part contains vitamin H aglucon (biotin, B, its sequence is vitamin H-5 '-TAATACGACTCACTATAGCAATGGTACGGTACTTCCTTAGTTGTTCTCCTAGGCAT GTTTCCAAAAGTGCACGCTACTTTGCTAA-3 ') (a) referring to Fig. 3, is 7.4 sodium bicarbonate buffer liquid rinsing three time with 300ul, pH value at 37 ± 1 ℃ after hatching 1 hour, each 3 minutes, dry back was stand-by.
The preparation of 2, the preparation of antibody reagent A liquid, PCR detection reagent B liquid reaches and specifically uses all with embodiment 1.
Wherein Fig. 7 is the real-time quantitative PCR detection curve of present embodiment; Fig. 8 is the typical curve of the sample detection of present embodiment.
Detected result is as follows:
| Numbering | Multi-color cord | Title | Type | Ct | Predetermined copy (copies/ul) | Detect copy (copies/ul) |
| 1 | ■ | |
Standard | 20.36 | 50,000,000.00000000 | 50,868,803.21156290 |
| 2 | ■ | |
Standard | 24.16 | 5,000,000.00000000 | 4,871,065.50894628 |
| 3 | ■ | |
Standard | 27.84 | 500,000.00000000 | 500,285.05007451 |
| 4 | ■ | |
Standard | 31.56 | 50,000.00000000 | 50,418.16112421 |
| 5 | ■ | 20080324H01 | Unknown | 20.32 | 52,214,313.17167810 | |
| 6 | ■ | Negative control | Negative? |
|||
| 7 | ■ | Positive control | Positive?Control | 22.96 | 10,256,470.10001870 |
Claims (12)
1, a kind of HPV virus antigen and ligand pipe PCR detection kit comprise
-PCR manages the regular-PCR pipe of making for polystyrene material, wraps the antibody or the aglucon of the acquired human immunodeficiency HPV virus target molecule that is captured on it;
-detection reagent A liquid and B liquid are used for acquired human immunodeficiency HPV virus part/Detection of antigen;
-standard detection sample;
-feminine gender and positive control sample.
2, a kind of A liquid that is used for HPV virus antigen as claimed in claim 1 and ligand pipe PCR detection kit is characterized in that: it is that 7.4 25pmol/ul has the detection aglucon of artificial sequence modification and the phosphate buffered saline buffer of 2ug/ml antibody is formed by 100ul, pH value.
3, a kind of A liquid that is used for HPV virus antigen and ligand pipe PCR detection kit as claimed in claim 2 is characterized in that: the detection aglucon of described artificial sequence modification is meant strand loop-stem structure and two the complementary two strandss that artificially add known array at 3 ' and 5 ' end of aglucon respectively or simultaneously.
4, a kind of B liquid that is used for HPV virus antigen as claimed in claim 1 and ligand pipe PCR detection kit is characterized in that: it is made up of the hot resistant DNA polymerase and the water of 1ul upstream primer, 1ul downstream primer, 8ul 4 * dNTP, 10ul 10 * PCR damping fluid, 2～5 units; Wherein the upstream primer sequence is 1:5 '-TCTAACGTGAATGATAG-3 '; The downstream primer sequence is 2:5 '-TATGGTCGAATAAGTTAA-3 '.
5, a kind of B liquid that is used for HPV virus antigen and ligand pipe PCR detection kit as claimed in claim 4, it is characterized in that: this B liquid also contains molecular beacon.
6, a kind of B liquid that is used for HPV virus antigen and ligand pipe PCR detection kit as claimed in claim 5 is characterized in that: described molecular beacon be stem toroidal molecule beacon, SYBRGreen 1 fluorescence dye of modification sequence and have fluorescence molecule and the probe molecule beacon of quencher molecule in any one.
7, a kind of method for preparing HPV virus antigen as claimed in claim 1 and ligand pipe PCR detection kit may further comprise the steps:
(1) under 37 ± 1 ℃, be that 1～20% glutaraldehyde is handled the PCR pipe with volumetric concentration, glutaraldehyde is managed attached to PCR;
(2) clean the PCR pipe with ultrapure water;
(3) will catch the aglucon/antibody sandwich of HPV target molecule on the PCR pipe;
(4) be that the PCR pipe is closed in 7.4 the sodium bicarbonate buffer fluid-tight that contains the smart DNA of 5% skim-milk, glycine, bovine serum albumin and tortoise with the pH value, drying gets the PCR pipe;
(5) preparation detection reagent A liquid: will detect the antibody of HPV virus and in pH value is 7.4 phosphate buffered saline buffer, hatch and pass through ultraviolet-crosslinkable, or dissolve aglucon with phosphate buffered saline buffer and get final product through the special oligonucleotide aglucon of the antibody of sequence modification;
(6) preparation detection reagent B liquid: will add water promptly after each component mixing of B liquid;
(7) with dried PCR pipe, detection reagent A liquid and B liquid and standard detection sample, feminine gender and positive control sample assembling, put into test kit and get final product.
8, the method for preparing HPV virus antigen and ligand pipe PCR detection kit as claimed in claim 7, it is characterized in that: the aglucon in the described step (3) is coated on and is meant on the PCR pipe that elder generation is coated on streptavidin on the PCR pipe, add the part that has vitamin H again and catch aglucon, by the combination of streptavidin and vitamin H, the seizure aglucon is anchored on the PCR pipe.
9, the method for preparing HPV virus antigen and ligand pipe PCR detection kit as claimed in claim 7 is characterized in that: the antibody sandwich in the described step (3) is that 9.6 sodium bicarbonate buffer liquid is coated on the PCR pipe being meant on the PCR pipe monoclonal anti body and function pH value.
10, a kind of HPV virus antigen as claimed in claim 1 and the ligand pipe PCR detection kit application in the special oligonucleotide ligand that detects acquired human immunodeficiency HPV virus may further comprise the steps:
1. be provided with feminine gender and and the positive criteria curve;
2. the preparation of testing sample;
3. in the PCR pipe, add testing sample regulating YIN and YANG control sample, hatched 45～120 minutes at 37 ± 1 ℃;
4. the effective washing lotion flushing of PCR after step being hatched in 3.;
5. in the PCR pipe, add A liquid, hatched 45～120 minutes at 37 ± 1 ℃;
6. the effective washing lotion flushing of PCR after step being hatched in 5.;
7. add standard substance again after in the PCR pipe, adding B liquid, adopt real-time quantitative-PCR to detect go forward side by side line data collection and processing.
11, HPV virus antigen as claimed in claim 10 and the ligand pipe PCR detection kit application in detecting the special oligonucleotide ligand of acquired human immunodeficiency HPV virus is characterized in that: described step 4. and the washing lotion 6. be meant that the pH value is 7.4, contains the phosphate buffered saline buffer of 0.05% tween 20.
12, HPV virus antigen as claimed in claim 10 and the ligand pipe PCR detection kit application in detecting the special oligonucleotide ligand of acquired human immunodeficiency HPV virus is characterized in that: the marker that described step real-time quantitative-PCR in 7. detects is selected from one or more in chemiluminescent substance, enzyme, fluorescence and the isotropic substance.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008102323187A CN101503737A (en) | 2008-10-30 | 2008-10-30 | HPV viral antigen, ligand tube-type PCR detection kit, preparation and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008102323187A CN101503737A (en) | 2008-10-30 | 2008-10-30 | HPV viral antigen, ligand tube-type PCR detection kit, preparation and use thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101503737A true CN101503737A (en) | 2009-08-12 |
Family
ID=40976112
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008102323187A Pending CN101503737A (en) | 2008-10-30 | 2008-10-30 | HPV viral antigen, ligand tube-type PCR detection kit, preparation and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101503737A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017181339A1 (en) * | 2016-04-19 | 2017-10-26 | 廖世奇 | Method and kit for simultaneous detection of protein ligand and gene |
| CN113462695A (en) * | 2021-08-11 | 2021-10-01 | 吴冬 | Nucleic acid aptamer HPV3501 of HPV35 virus particles and application thereof |
| CN113502290A (en) * | 2021-08-19 | 2021-10-15 | 吴冬 | Aptamer HPV3901 of HPV39 virus particles and application thereof |
| CN113584040A (en) * | 2021-08-11 | 2021-11-02 | 吴冬 | Nucleic acid aptamer HPV3301 of HPV33 virus-like particles and application thereof |
| CN113621615A (en) * | 2021-07-30 | 2021-11-09 | 吴冬 | Aptamer HPV3101 of HPV31 virus particles and application thereof |
| CN116640830A (en) * | 2023-05-04 | 2023-08-25 | 河北国高生物科技有限公司 | immuno-PCR working solution and preparation method and application thereof |
| CN117126966A (en) * | 2023-09-01 | 2023-11-28 | 弗雷米德生物医药技术（天津）有限公司 | Kit based on HPV mRNA expression quantity and application |
-
2008
- 2008-10-30 CN CNA2008102323187A patent/CN101503737A/en active Pending
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017181339A1 (en) * | 2016-04-19 | 2017-10-26 | 廖世奇 | Method and kit for simultaneous detection of protein ligand and gene |
| CN113621615A (en) * | 2021-07-30 | 2021-11-09 | 吴冬 | Aptamer HPV3101 of HPV31 virus particles and application thereof |
| CN113621615B (en) * | 2021-07-30 | 2023-08-11 | 福建博奥医学检验所有限公司 | Aptamer HPV3101 of HPV31 virus particle and application thereof |
| CN113462695A (en) * | 2021-08-11 | 2021-10-01 | 吴冬 | Nucleic acid aptamer HPV3501 of HPV35 virus particles and application thereof |
| CN113584040A (en) * | 2021-08-11 | 2021-11-02 | 吴冬 | Nucleic acid aptamer HPV3301 of HPV33 virus-like particles and application thereof |
| CN113502290A (en) * | 2021-08-19 | 2021-10-15 | 吴冬 | Aptamer HPV3901 of HPV39 virus particles and application thereof |
| CN113502290B (en) * | 2021-08-19 | 2023-08-11 | 福建博奥医学检验所有限公司 | Aptamer HPV3901 of HPV39 virus particle and application thereof |
| CN116640830A (en) * | 2023-05-04 | 2023-08-25 | 河北国高生物科技有限公司 | immuno-PCR working solution and preparation method and application thereof |
| CN117126966A (en) * | 2023-09-01 | 2023-11-28 | 弗雷米德生物医药技术（天津）有限公司 | Kit based on HPV mRNA expression quantity and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | A serological aptamer-assisted proximity ligation assay for COVID-19 diagnosis and seeking neutralizing aptamers | |
| US10908157B2 (en) | Assay methods | |
| CN101503737A (en) | HPV viral antigen, ligand tube-type PCR detection kit, preparation and use thereof | |
| WO2021222832A1 (en) | Viral serology ace2 competition assays | |
| WO2017181339A1 (en) | Method and kit for simultaneous detection of protein ligand and gene | |
| US7074586B1 (en) | Quantitative assay for low abundance molecules | |
| CN112852921B (en) | Nucleic acid detection method, detection probe and kit based on instant detection test strip | |
| CN101403016A (en) | HBV viral antigen, ligand pipe PCR detection kit, preparation and uses thereof | |
| CN114107019B (en) | Microfluidic chip for simultaneously detecting nucleic acid and protein, detection method and application | |
| Liu et al. | A graphene oxide and exonuclease-aided amplification immuno-sensor for antigen detection | |
| CN111575406A (en) | Novel coronavirus rapid screening method and kit based on nucleic acid isothermal amplification | |
| CN110923361B (en) | Primer, probe and kit for blood source screening based on digital PCR | |
| CN113684317B (en) | Ultra-sensitive rapid detection and identification system for B type and C type hepatitis B virus based on CRISPR-Cas12B | |
| CN113702641A (en) | One-pot nucleic acid-antibody co-detection method and application | |
| CN101429547A (en) | Antigen of pneumococcus, ligand pipe type PCR detection kit, preparation and application thereof | |
| Wu et al. | A simple fluorescence biosensing strategy for ultrasensitive detection of the BCR–ABL1 fusion gene based on a DNA machine and multiple primer-like rolling circle amplification | |
| CN101503739B (en) | HCV viral antigen, ligand tube-type PCR detection kit, preparation and use thereof | |
| WO2020125295A1 (en) | Primers, probes, kit and detection method for detecting human immunodeficiency virus nucleic acids | |
| CN101503738A (en) | HIV viral antigen, ligand tube-type PCR detection kit, preparation and use thereof | |
| CN100495035C (en) | Antigen and ligand PCR pipe detecting reagent kit, its manufacturing method and application | |
| CN110846439A (en) | HCMV detection product and application thereof | |
| CN112210624B (en) | LAMP primer and kit for efficiently detecting three pathogens of trionyx sinensis in triple mode | |
| CN104313179A (en) | Isothermal amplification detection kit and detection method for Zaire type Ebola virus | |
| US20170335382A1 (en) | Isothermal Amplification Assay for the Detection of Short Nucleic Acid Sequences | |
| CN113567685A (en) | HGFR (human liver factor receptor) identification method based on nucleic acid aptamer probe and kit for detecting HGFR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20090812 |