CN112852921B - Nucleic acid detection method, detection probe and kit based on instant detection test strip - Google Patents
Nucleic acid detection method, detection probe and kit based on instant detection test strip Download PDFInfo
- Publication number
- CN112852921B CN112852921B CN202110279931.XA CN202110279931A CN112852921B CN 112852921 B CN112852921 B CN 112852921B CN 202110279931 A CN202110279931 A CN 202110279931A CN 112852921 B CN112852921 B CN 112852921B
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- detection
- stranded dna
- hcg
- dna probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/708—Specific hybridization probes for papilloma
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention relates to the technical field of nucleic acid detection, in particular to a nucleic acid detection method based on an instant detection test strip, a detection probe and a kit thereof. The nucleic acid detection method is based on the CRISPR/Cas12a system and the early pregnancy test paper, and the non-specific hCG detection probe is combined with the crRNA sequence of the specific recognition test sequence to detect the nucleic acid, so that the detection cost is greatly reduced, the detection target universality is obvious, the sensitivity is high, the specificity is good, the detection sensitivity is comparable with the fluorescence end point characterization method, and the detection sensitivity can be detected to 2 molecular copy numbers at the lowest.
Description
Technical Field
The invention relates to the technical field of nucleic acid detection, in particular to a nucleic acid detection method based on an instant detection test strip, a detection probe and a kit thereof.
Background
Sudden and a series of serious acute and chronic infections have been the most serious illness with the greatest risk to human health and the greatest number of deaths. In particular, some infectious viruses with various genotypes and complex structural proteins have long research and development period of vaccines, so that Point-of-care testing (POCT) is an important premise for effectively checking and controlling various serious acute and chronic infectious pathogens while searching for new medicines. Currently, two methods are available for detecting sudden viral infectious diseases, one is to detect viral nucleic acid, and the other is to detect antigen and antibody. Because the window period of the two methods is different after the infection is detected, the window period of the nucleic acid detection is obviously shorter than the antigen-antibody detection, so that the early screening of the infection is facilitated. Thus, achieving sensitive, specific, portable nucleic acid detection of infectious diseases remains a constantly perfected and evolving goal.
In recent years, with the vigorous development of the molecular diagnosis field, scientists have opened up a new sensing concept for developing a portable diagnosis system, namely, detecting non-original objects to be detected by using commercial POCT products; the method can not only reduce the development cost of the instrument, but also truly realize the portable detection of the nucleic acid. This method is currently widely accepted as one of the most promising portable detection methods. To date, metal ions, small molecule compounds, trans-DNA, proteins, and even cancer cells can be transduced into existing POCT commercial devices by means of different recognition elements (nucleic acid aptamers, dnases, etc.). Among these innovative detection methods, the test strip-based portable detection method is rapidly developed in qualitative or quantitative analysis applications for analyzing an analyte due to a simple operation method and visual detection results. At present, the existing commercial early pregnancy test strip detection technology (Angew.chem.int.ed., 2017,56,992-996) needs to add a plurality of nucleic acid probes, and finally uses magnetic beads for separation, so that the experimental process is complex and can not reach higher signal ratio.
The CRISPR/Cas system is an immune system present in bacteria and archaea for combating the invasion of foreign substances. In recent years, the CRISPR/Cas system has become an important tool in genetic engineering and is widely applied to gene editing, gene expression regulation, gene detection and the like. Wherein the CRISPR/Cas12a system is a novel CRISPR/Cas system having RNA-guided dnase cleavage activity capable of activating the non-specific single-stranded DNA (ssDNA) cleavage activity of Cas12a while specifically cleaving double-stranded DNA (dsDNA). By utilizing the characteristics, crRNA (CRISPR-delayed RNA) can be designed for target DNA artificially and is complementary with DNA near a PAM (protospacer-adjacent motif) region in the target DNA, so that direct detection of different target DNAs is realized. The labeled ssDNA is introduced, by activating the nonspecific DNA of Cas12 a. The Doudna task group (Science 2018,360,436-439) uses the CRISPR/Cas12a system to achieve detection of Human Papillomaviruses (HPV); when the DNA to be detected exists, the crRNA can specifically recognize the DNA to be detected and the Cas12a protein to form a ternary complex, so that the nonspecific cleavage activity of the Cas12a is activated, and fluorescence detection is realized by cleaving single-stranded DNA with fluorescent and quenching groups at two ends respectively. In addition to the use of fluorophores as the final output format, electrochemical signals (Angew.chem.int.ed.2019, 58, 17399-17405) and dipsticks (NatBiotechnol.2020, 38, 870-874) and the like can be used as characterization.
The presently reported method for gene diagnosis by using early pregnancy test paper is limited to loop-mediated isothermal amplification (LAMP) products of nucleic acid to be detected, and utilizes a three-way nucleic acid probe (which is respectively represented by P1, P2 and P3 for the convenience of explanation), wherein the 3' end of P1 is marked with pre-expressed hCG protein, the 5' end of P2 is marked with a magnetic sphere, and the 3' end is marked with a foothold sequence. The three single-stranded nucleic acids P1, P2 and P3 form a three-way structure. When LAMP products of the target to be detected exist, the single-stranded loop sequence LP1 of the LAMP product can be combined with the foothold sequence in P2 to trigger a chain substitution reaction, the single-stranded loop sequence LP3 can be combined with P3, and the structure of the three-way probe is damaged; finally, hCG which is free in the solution can be separated from the magnetic ball by utilizing the magnetic force of the magnet, and early pregnancy test paper shows positive. In contrast, when the LAMP product of the target to be detected does not exist, the probe keeps a three-way structure, and in theory, the solution has no free hCG protein, and early pregnancy test paper shows negative. The method has the defects that: 1. the probe sequence design is complex, the combination enthalpy needs to be calculated and balanced, and the smooth proceeding of the chain substitution reaction is ensured; 2. the concentration of the system is required to be optimized for three single-stranded DNA forming the three-way probe, so that the low background of the detection reaction is ensured; 3. the double-marked probes increase the complexity of experimental operation, and the stability of the magnetic balls in different batches is different, so that the conditions are re-optimized when the magnetic balls are replaced each time; 4. the whole design of the experiment limits the amplification mode of the gene to be detected, and can be only used for loop-mediated isothermal amplification reaction. 5. The method can only detect nucleic acid, and is not suitable for detection of small molecules or proteins and the like.
At present, a test strip method is generally adopted to characterize the nucleic acid detection based on a CRISPR/Cas12a system, wherein FAM and Biotin groups are respectively marked at two ends of a detection probe; although the test strip used by the method can be commercialized and can realize final portable detection, the price of the test strip is too high, the cost of the whole detection is increased intangibly, and the sample detection is not carried out in a large batch.
Disclosure of Invention
In view of the above, in order to overcome the defects and shortcomings of the existing nucleic acid detection technology, the invention provides a nucleic acid detection method, a detection probe and a kit based on an instant detection test strip. The detection method has obvious target universality, can realize early nucleic acid screening of various infectious diseases, has good specificity and high sensitivity, and greatly reduces the detection cost.
The invention provides a nucleic acid detection method based on an instant detection test strip, which comprises the following steps:
dissolving a nucleic acid sample to be detected, an hCG marked single-stranded DNA probe, crRNA and Cas12a protein in a buffer solution, and reacting to obtain a first reaction solution;
adding a substrate material into the first reaction solution for incubation to obtain a second reaction solution;
dripping the second reaction liquid onto a sample pad of the early pregnancy test strip, waiting for 5-8min, observing the color development conditions of the detection line and the quality control line, and judging whether the sample pad contains nucleic acid to be detected;
the crRNA is a crRNA sequence which specifically binds to nucleic acid to be detected;
the substrate material is a macromolecular material capable of binding to hCG-labeled single-stranded DNA probes.
In the invention, the nucleic acid sample to be tested is: the whole length or fragment of the DNA of the nucleic acid to be tested, the PCR product of the nucleic acid to be tested or the isothermal amplification product of the nucleic acid to be tested.
The detection method can be applied to early nucleic acid screening of various infectious diseases, does not need expensive instruments and equipment and a professional standard laboratory, and has important significance for early monitoring diagnosis, prevention and control of the infectious diseases.
In some specific embodiments, the detection method of the invention is used for detecting HPV16 and new coronavirus samples, has higher sensitivity, and the detection limit can reach 2 molecular copy numbers.
In the present invention, the hCG-labeled single-stranded DNA probe is simply referred to as hCG probe. The hCG probe consists of two parts, one part is hCG protein and the other part is single-stranded DNA probe sequence. In some embodiments, the amino acid sequence of the hCG protein is modified at the 5' end of the single stranded DNA probe by NH2C 6. Specifically, the composition of the hCG marked single-chain DNA probe from the 5 'end to the 3' end is as follows: hCG DNA fragment-NH 2C 6-Single-stranded DNA Probe.
In some embodiments, the nucleotide sequence of the single stranded DNA probe is set forth in SEQ ID NO:1 is shown as follows:
SEQ ID NO：1：5-TTATTTTATTTTATTCTCTCTGGATGATG-3′。
the 5 end NH2C6 of the single-stranded DNA probe is the end connected with HCG protein, the 1 st to 15nt of the 5' end is a Cas12a non-specific cutting region, and the rear 14nt (16 th to 29 nt) is a LAMP substrate binding region.
In some embodiments, the substrate material is a large molecular weight single-stranded DNA of any sequence that binds to a single-stranded DNA probe by base complementarity, or a large molecular material that binds to a single-stranded DNA probe by chemical bonding.
In some embodiments, the substrate material is the entire product substrate after LAMP amplification of any nucleic acid sequence.
In some embodiments, the buffer comprises 50-200mM NaCl, 10-40mM Tris-HCl, 10-40mM MgCl 2 And 100-400 μg/mL BSA.
In some embodiments, the buffer comprises 200mM NaCl,40mM Tris-HCl,40mM MgCl 2 And 400 μg/mL BSA.
In some embodiments, the reaction is specifically carried out at 25℃to 37℃for 30 to 60min; the incubation is carried out at 25 ℃ for 20-40min.
In some embodiments, the reaction is specifically a reaction at 37℃for 30min or at 25℃for 40-60min; the incubation is specifically incubation at 25 ℃ for 40min.
The invention also provides a single-stranded DNA probe marked by hCG signal for nucleic acid detection, the nucleotide sequence of which is shown as SEQ ID NO: 1.
The invention also provides a nucleic acid detection kit comprising the hCG marked single-stranded DNA probe.
The nucleic acid detection kit also comprises at least one of crRNA, cas12a protein, buffer solution, RNase inhibitor, LAMP product substrate and early pregnancy test paper strip.
Wherein the buffer solution comprises 50-200mM NaCl, 10-40mM Tris-HCl, and 10-40mM MgCl 2 And 100-400 μg/mL BSA.
In some embodiments, the buffer comprises 200mM NaCl,40mM Tris-HCl,40mM MgCl 2 And 400 μg/mL BSA.
The nucleic acid detection method is based on the CRISPR/Cas12a system and the early pregnancy test paper, and the nucleic acid is detected through the nonspecific hCG detection probe and the crRNA sequence of the specific recognition sequence to be detected, so that the detection cost is greatly reduced, the detection specificity can be ensured, and meanwhile, the portability of the whole detection is increased. The detection principle is as shown in fig. 1: when the nucleic acid to be detected is present, a ternary complex can be formed with the Cas12a protein and the crRNA, and the RuvC domain of Cas12a in the complex exerts dnase activity and cleaves dsDNA of the nucleic acid to be detected. The activated Cas12a also has non-specific ssDNA cleavage activity, cleaving the single-stranded DNA probe labeled with the human chorionic gonadotrophin (hCG) signal. The uncleaved single-stranded DNA probe is specifically combined with a single-stranded loop of a substrate (such as LAMP product) with a complex structure and large volume, and hCG cannot pass through early pregnancy test paper through chromatographic action due to the fact that the substrate is too large; in contrast, the cleaved single-stranded DNA probe, because hCG is already completely free in solution, is able to pass the early pregnancy test paper by chromatography even if the substrate is present. Judging whether the sample contains target nucleic acid according to the color development condition of early pregnancy test paper. The specific judging method comprises the following steps:
comparing with the color development condition of the negative sample, if the red strip of the detection area of the sample to be detected is darker than the red strip of the detection area of the negative sample, the detection result is positive, and the sample to be detected contains target nucleic acid; otherwise, the color of the sample is consistent with or lighter than that of the negative sample detection area, and the detection result is negative, which indicates that the sample does not contain the nucleic acid to be detected.
Compared with the traditional test strip method for representing the CRISPR/Cas12a system nucleic acid detection system, the detection method provided by the invention has the advantages that the commercial early pregnancy test strip with low market price is used for replacing the detection test strip with high price, so that the detection cost is greatly reduced; meanwhile, the method has obvious universality of detection targets, high sensitivity and good specificity, the detection sensitivity is comparable to that of a fluorescence end point characterization method, and the number of copies of the molecules can be detected to be 2 at the lowest. In addition, the hCG probe and the LAMP substrate used in the system can be subjected to dry powder treatment, so that the system is convenient to store and transport.
Drawings
FIG. 1 is a schematic diagram showing the detection of a nucleic acid detecting method of the present invention;
FIG. 2 shows the results of the detection method of the present invention on HPV-16-L1 mimetic double-stranded DNA at different concentrations;
FIG. 3 is a schematic diagram showing the non-specific ssDNA cleavage process initiated by the amplification product after isothermal amplification reaction (herein, the RPA reaction is exemplified) of the test gene after activation of the CRISPR/Cas12a system;
FIG. 4 shows the detection results of HPV-16-L1 by early pregnancy test paper of example 2;
FIG. 5 shows the results of the test for novel coronaviruses using the early pregnancy test paper of example 3.
Detailed Description
The invention provides a nucleic acid detection method based on an instant detection test strip, a detection probe and a kit thereof. Those skilled in the art can, with the benefit of this disclosure, suitably modify the process parameters to achieve this. It is expressly noted that all such similar substitutions and modifications will be apparent to those skilled in the art, and are deemed to be included in the present invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the relevant art that the invention can be practiced and practiced with modification and alteration and combination of the methods and applications herein without departing from the spirit and scope of the invention.
The test materials adopted by the invention are all common commercial products and can be purchased in the market.
The invention is further illustrated by the following examples:
example 1 detection of HPV Gene Using the detection method of the present invention
And (3) detecting the HPV-16-L1 simulated DNA fragment sequence by a test strip, and comparing the fluorescent signals, wherein the simulated DNA sequence is as follows:
ATTGGTTACAACGAGCACAGGGCCACAATAATGGCATTTGTTGGGGTAACCAACTATTTGTTACTGTTGTTGATACTACACGCAGTACAAATATGTCATTATGTGCTGCCATATCTACTTCAGAAACTACATATAAAAATACTAACTTTAAGGAGTACCTACGACATGGGGAGGAATATGATTTACAGTTTATTTTTCAACTGTGCAAAATAACCTTAACTGCAGACGTTATGACATACATACATTCTATGAATTCCAC。
crRNA specifically binding to the above-mentioned mimetic DNA sequence, the nucleotide sequence of which is: 5'-UAAUUUCUACUAAGUGUAGAUUGAAGUAGAUAUGGCAGCAC-3' (SEQ ID NO: 2)
The reaction system is as follows: 1 μM Cas12a,2 μM crRNA,20U RNase Inhibitor (Murine), 14nM hCG probe, 5nM/1nM/500pM/100pM/50pM/10pM/5pM/0pM HPV-16-L1 mimic DNA duplex, total 10 μL of the cocktail. Dissolving the above mixture in 200mM NaCl,40mM Tris-HCl,40mM MgCl 2 In 400 mug/mL BSA solution, the reaction is carried out for 30min at 37 ℃, 30 mug of LAMP product substrate is added, the LAMP product substrate is placed at 25 ℃ for incubation for 40min, all 40 mug of reaction liquid drops are taken to be placed at the bottom of the early pregnancy test strip, and the reaction liquid drops are observed after standing for 5 min.
As can be seen from the detection results shown in fig. 2B, the test strip detection line strip is significantly deepened after Cas12a cleavage is induced by adding nucleic acid analytes of different concentrations; compared with the lowest detection concentration of the output mode of the fluorescent marker in FIG. 2A, the early pregnancy test strip can also detect the 5pM gene to be detected, and simultaneously the detection line strip deepens along with the deepening of the concentration of the nucleic acid to be detected.
Example 2 detection of trace HPV Gene Using the detection method of the present invention
The amplification of the 16-L1 gene of an artificially synthesized HPV virus is carried out by using a isothermal amplification reaction (such as RPA or LAMP amplification) by taking RPA amplification as an example, and the amplified product is added into the detection system, and is specifically shown in FIG. 3.
The RPA amplification primer sequences used were as follows:
HPV-16-L1 forward primer TTGTTGGGGTAACCAACTATTTGTTACTGTT (SEQ ID NO: 3).
HPV-16-L1 reverse primer CCTCCCCATGTCGTAGGTACTCCTTAAAG (SEQ ID NO: 4).
The RPA amplification is combined with the CRISPR/Cas12a system, and the reaction system is as follows: 1 μM Cas12a,2 μM crRNA,20U RNase Inhibitor (Murine), 14nM hCG probe, 2 μL of RPA amplification product of different copy number templates, 10 μL of the mixture. Dissolving the above mixture in 200mM NaCl,40mM Tris-HCl,40mM MgCl 2 Adding 30 μL of LAMP product substrate into 400 μg/mL BSA solution, reacting for 30min at 37deg.C, incubating at 25deg.C for 40min, collecting all 40 μL of reaction liquid drop at the bottom of early pregnancy test strip, standing for 5min, and observingAnd (5) inspecting.
FIG. 4 is a color chart of a pregnancy test strip with non-specific ssDNA cleavage induced after activation of the CRISPR/Cas12a system by the RPA product. The negative control is the template concentration of 0 molecular copy number in the RPA reaction, and the positive control is the template concentration of 2, 20, 200, 2,000 and 20,000 molecular copy number respectively, so that the lowest detectable molecular copy number of the invention is 2.
Example 3 detection of Trace amount of New coronavirus Using the detection method of the present invention
In order to demonstrate the versatility of the detection method of the present invention, trace amounts of novel coronavirus (SAR-Cov-2) reverse transcribed dsDNA were detected using the detection method of the present invention.
Firstly, performing isothermal amplification on ORF1ab genes in novel coronaviruses by using an RPA amplification method, and directly triggering a CRISPR/Cas12a system by an amplification product.
The sequence of the novel coronavirus ORF1ab gene amplification probe is as follows:
ORF1ab-F:CTTGAAATTCCACGTAGGAATGTGGCAACTTTAC(SEQ ID NO：5)；
ORF1ab-R:GTATGCCAGGTATGTCAACACATAAACCTTCAG(SEQ ID NO：6)。
FIG. 5 is a color chart of a pregnancy test strip showing non-specific ssDNA cleavage induced after activation of the CRISPR/Cas12a system by the RPA product of ORF1 ab. Wherein, the negative control is the template concentration of 0 molecular copy number in the RPA reaction, and the positive control is the template concentration of 2, 20, 200, 2,000 and 20,000 molecular copy numbers respectively.
The results show that the detection method has obvious universality of the detection target, and the end point detection of the test strip can detect 2 molecular copy numbers at the lowest. Meanwhile, the RPA amplification product of the HPV-16-L1 gene is added for comparison, and the system is found to be capable of specifically detecting the ORF1ab target gene, and false positive misdiagnosis can not be generated even under the interference of a large number of other gene RPA products.
The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.
Sequence listing
<110> national academy of sciences of China's Changchun application chemistry institute
<120> a nucleic acid detection method, a detection probe and a kit thereof based on an immediate detection test strip
<130> MP21004429
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
ttattttatt ttattctctc tggatgatg 29
<210> 2
<211> 41
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
uaauuucuac uaaguguaga uugaaguaga uauggcagca c 41
<210> 3
<211> 31
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
ttgttggggt aaccaactat ttgttactgt t 31
<210> 4
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
cctccccatg tcgtaggtac tccttaaag 29
<210> 5
<211> 34
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
cttgaaattc cacgtaggaa tgtggcaact ttac 34
<210> 6
<211> 33
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
gtatgccagg tatgtcaaca cataaacctt cag 33
Claims (11)
1. A method for detecting nucleic acid based on a test strip for non-disease diagnosis, comprising:
dissolving a nucleic acid sample to be detected, an hCG marked single-stranded DNA probe, crRNA and Cas12a protein in a buffer solution, and reacting to obtain a first reaction solution;
adding a substrate material into the first reaction solution for incubation to obtain a second reaction solution;
dripping the second reaction liquid onto a sample pad of the early pregnancy test strip, waiting for 5-8min, observing the color development conditions of the detection line and the quality control line, and judging whether the sample pad contains nucleic acid to be detected;
the crRNA is a crRNA sequence which specifically binds to nucleic acid to be detected;
the substrate material is a macromolecular material capable of being combined with the hCG marked single-chain DNA probe;
the nucleotide sequence of the single-stranded DNA probe is shown as SEQ ID NO: 1.
2. The method according to claim 1, wherein the nucleic acid sample to be tested is: the whole length or fragment of the DNA of the nucleic acid to be tested, the PCR product of the nucleic acid to be tested or the isothermal amplification product.
3. The method for detecting nucleic acid according to claim 1, wherein in the hCG-labeled single-stranded DNA probe, the amino acid sequence of the hCG protein is modified at the 5' end of the single-stranded DNA probe by NH2C 6.
4. The method for detecting nucleic acid according to claim 1, wherein the substrate material is a large molecular weight single-stranded DNA of an arbitrary sequence bound to a single-stranded DNA probe by base complementation,
or a macromolecular substance that is bound to the single-stranded DNA probe by a chemical bond.
5. The method of claim 4, wherein the substrate material is a total product substrate after LAMP amplification of any nucleic acid sequence.
6. The method for detecting nucleic acid according to claim 1, wherein the buffer comprises 50-200mM NaCl, 10-40mM Tris-HCl, 10-40mM MgCl 2 And 100-400 μg/mLBSA.
7. The method for detecting nucleic acid according to claim 1, wherein the reaction is specifically carried out at 25℃to 37℃for 30 to 60 minutes; the incubation is carried out at 25 ℃ for 20-40min.
8. An hCG signal marked single-chain DNA probe for nucleic acid detection, which has a nucleotide sequence shown in SEQ ID NO: 1.
9. A nucleic acid detection kit comprising the hCG-labeled single-stranded DNA probe according to claim 8.
10. The nucleic acid detection kit of claim 9, further comprising at least one of crRNA, cas12a protein, buffer, rnase inhibitor, LAMP product substrate, early pregnancy test strip.
11. The nucleic acid detection kit according to claim 10, wherein the buffer comprises 200mM NaCl,40mM Tris-HCl,40mM MgCl 2 And 400 μg/mLBSA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110279931.XA CN112852921B (en) | 2021-03-16 | 2021-03-16 | Nucleic acid detection method, detection probe and kit based on instant detection test strip |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110279931.XA CN112852921B (en) | 2021-03-16 | 2021-03-16 | Nucleic acid detection method, detection probe and kit based on instant detection test strip |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112852921A CN112852921A (en) | 2021-05-28 |
| CN112852921B true CN112852921B (en) | 2023-06-20 |
Family
ID=75994727
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110279931.XA Active CN112852921B (en) | 2021-03-16 | 2021-03-16 | Nucleic acid detection method, detection probe and kit based on instant detection test strip |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112852921B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113699148B (en) * | 2021-07-15 | 2024-01-09 | 四川大学 | Ultrasensitive antibody detection method |
| CN115806993B (en) * | 2022-12-27 | 2023-11-14 | 中国人民解放军军事科学院军事医学研究院 | Aptamer HCG-2 for specifically recognizing human chorionic gonadotrophin |
| CN115998341B (en) * | 2023-01-18 | 2024-04-12 | 珠海舒桐医疗科技有限公司 | HPV rapid detection system for non-disease treatment and diagnosis |
| CN116179511B (en) * | 2023-03-10 | 2023-12-22 | 之江实验室 | Application of Cpf1 protein in preparation of kit for nucleic acid detection |
| CN116656786A (en) * | 2023-03-14 | 2023-08-29 | 广州医科大学附属第一医院（广州呼吸中心） | CRISPR-lateral flow nucleic acid detection test paper based on chain hybridization and detection probe thereof |
| CN116990499B (en) * | 2023-08-03 | 2024-03-01 | 西安交通大学 | MBs-ssDNA-hCG probe, kit and application thereof in detection of IAP |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110184329A (en) * | 2019-05-31 | 2019-08-30 | 华南理工大学 | A kind of one-step method nucleic acid detection method and kit based on CRISPR/Cas and constant-temperature amplification |
| CN111560482A (en) * | 2020-06-11 | 2020-08-21 | 亚能生物技术（深圳）有限公司 | Detection method based on CRISPR/Cas and nucleic acid test paper and human papilloma virus detection kit |
| CA3132197A1 (en) * | 2019-03-07 | 2020-09-10 | The Trustees Of Columbia University In The City Of New York | Rna-guided dna integration using tn7-like transposons |
| CN111647642A (en) * | 2020-05-19 | 2020-09-11 | 深圳市众循精准医学研究院 | Nucleic acid detection method and nucleic acid detection kit based on detection test paper display |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20230193255A1 (en) * | 2018-11-16 | 2023-06-22 | The Regents Of The University Of California | Compositions and methods for delivering crispr/cas effector polypeptides |
| CN111187804A (en) * | 2020-02-20 | 2020-05-22 | 国家卫生健康委科学技术研究所 | Rapid detection kit and detection method for mycoplasma pneumoniae nucleic acid based on CRISPR/Cas12a |
| CN112342273B (en) * | 2020-11-11 | 2022-11-15 | 军事科学院军事医学研究院环境医学与作业医学研究所 | MOF-DNA hydrogel colorimetric detection kit and method based on CRISPR-Cas12a |
| CN112391498B (en) * | 2020-12-01 | 2022-08-09 | 中国科学院长春应用化学研究所 | Application of pregnancy test paper in on-site instant detection of hepatitis B virus drug-resistant mutant gene |
-
2021
- 2021-03-16 CN CN202110279931.XA patent/CN112852921B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA3132197A1 (en) * | 2019-03-07 | 2020-09-10 | The Trustees Of Columbia University In The City Of New York | Rna-guided dna integration using tn7-like transposons |
| CN110184329A (en) * | 2019-05-31 | 2019-08-30 | 华南理工大学 | A kind of one-step method nucleic acid detection method and kit based on CRISPR/Cas and constant-temperature amplification |
| CN111647642A (en) * | 2020-05-19 | 2020-09-11 | 深圳市众循精准医学研究院 | Nucleic acid detection method and nucleic acid detection kit based on detection test paper display |
| CN111560482A (en) * | 2020-06-11 | 2020-08-21 | 亚能生物技术（深圳）有限公司 | Detection method based on CRISPR/Cas and nucleic acid test paper and human papilloma virus detection kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112852921A (en) | 2021-05-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112852921B (en) | Nucleic acid detection method, detection probe and kit based on instant detection test strip | |
| JP4804691B2 (en) | Proximity probing method and kit | |
| Huang et al. | A CRISPR‐Cas12a‐derived biosensor enabling portable personal glucose meter readout for quantitative detection of SARS‐CoV‐2 | |
| US11125743B2 (en) | Detection of norovirus using norovirus-specific toehold switches | |
| WO2017181339A1 (en) | Method and kit for simultaneous detection of protein ligand and gene | |
| Xiong et al. | One-pot platform for rapid detecting virus utilizing recombinase polymerase amplification and CRISPR/Cas12a | |
| CN109652516A (en) | A kind of structure and purposes of double chain oligonucleotide nucleic acid probe | |
| Wang et al. | CRISPR-Cas13a cascade-based viral RNA assay for detecting SARS-CoV-2 and its mutations in clinical samples | |
| Gong et al. | An enhanced method for nucleic acid detection with CRISPR-Cas12a using phosphorothioate modified primers and optimized gold-nanopaticle strip | |
| CN112067802B (en) | H1N1 influenza virus detection kit | |
| WO2023284514A1 (en) | Ultrasensitive antibody detection method | |
| EP1431398A1 (en) | A method for detecting in a mixture an amount of analytes | |
| Liu et al. | Systematically investigating the fluorescent signal readout of CRISPR-Cas12a for highly sensitive SARS-CoV-2 detection | |
| Choi et al. | Point-of-care COVID-19 testing: colorimetric diagnosis using rapid and ultra-sensitive ramified rolling circle amplification | |
| CN115948614B (en) | Nucleic acid detection kit and detection method based on CRISPR/Cas12a system | |
| CN113481326B (en) | Isothermal nucleic acid amplification reaction reagent, isothermal nucleic acid amplification method and application thereof | |
| Zhang et al. | Diagnostic efficiency of RPA/RAA integrated CRISPR-Cas technique for COVID-19: A systematic review and meta-analysis | |
| RU2007108303A (en) | METHOD FOR DETECTING AND QUANTITATIVE EVALUATION OF HIV DNA IN VITRO USING QUANTITATIVE PCR | |
| CN113151495A (en) | Primer, probe, kit and method for universal visual detection of schistosoma japonicum and schistosoma mansoni nucleic acid by LFD-RPA | |
| CN109457051A (en) | Detect primer, probe, kit and the detection method of hepatitis C virus nucleic acid | |
| Wang et al. | A CRISPR/Cas12a-SERS platform for amplification-free detection of African swine fever virus genes | |
| CN113322308B (en) | Fluorescence sensor for detecting HBV (hepatitis B virus), and preparation and application thereof | |
| CN115058493B (en) | DNA probe for multiple nucleic acid detection, CRISPR-reverse dot hybridization nucleic acid detection system and application | |
| CN114621958B (en) | Single-stranded DNA aptamer sequence for specifically recognizing ATP and application thereof | |
| Atikana et al. | Detection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in clinical samples using real-time reverse transcription polymerase chain reaction (qRT-PCR) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |