CN113322308B - Fluorescence sensor for detecting HBV (hepatitis B virus), and preparation and application thereof - Google Patents

Abstract

The invention discloses a fluorescence sensor for detecting HBV and preparation and application thereof, wherein the sensor comprises a signal identification part: target substance triggered foothold mediated strand displacement reaction and signal transduction moiety: converting the target substance into double-stranded DNA containing a PAM sequence recognizable by Cas12 a; the principle is as follows: the target substance is combined with the footing in the HP probe, the HP probe is opened through TMSDR, and the footing points which can be identified by crRNA are exposed; cas12a/crRNA hybridizes to the exposed foothold through the crRNA and displaces the target substance, and forms a Cas12a agonist; the replaced target substance is combined with other HP probes to trigger the next cycle reaction, so that a large amount of Cas12a activated bodies are generated; the Cas12a excited body trans-cutting report probe generates a fluorescence signal, and the content of the target substance can be obtained by detecting the fluorescence signal. The fluorescence sensor has the advantages of low cost, high sensitivity, high reaction speed and good reproducibility.

Description

Fluorescence sensor for detecting HBV (hepatitis B virus), and preparation and application thereof

Technical Field

The invention relates to the technical field of HBV detection, in particular to a fluorescence sensor for detecting HBV and preparation and application thereof.

Background

Hepatitis B Virus (HBV) is the main pathogenic cause of diseases such as hepatitis B and the like, is mainly transmitted through blood and has larger harmfulness, so that the screening of hepatitis B virus in human blood is strengthened, and the method has important significance for controlling the hepatitis B disease. In the past, the hepatitis B virus is screened clinically by adopting an enzyme-linked immunosorbent assay, the detection method has the advantages of low cost, simple and convenient operation and the like, but because the hepatitis B virus has a window period and relatively high concealment, certain missed diagnosis exists during detection by adopting the method. In recent years, a nucleic acid detection method is clinically used for detecting hepatitis B virus, the detection mode belongs to a molecular biology detection method, the DNA content of the hepatitis B virus can be directly detected, and then whether hepatitis B infection exists or not is judged, and the diagnosis sensitivity is high. In recent years, with the development of medical technology, nucleic acid detection is becoming popular in blood screening work. The nucleic acid detection is utilized in the hepatitis B virus screening, and the content of the hepatitis B virus DNA can be determined, so that whether a patient blood specimen is infected with the hepatitis B virus or not can be further known. Research shows that when the hepatitis B virus is detected by nucleic acid detection, the window period can be shortened, and the detection rate of the hidden hepatitis B virus infection is higher. The nucleic acid detection is mainly carried out by nucleic acid amplification technologies such as PCR (polymerase chain reaction) and the like, can carry out early quantitative detection on viral nucleic acid in a blood sample, can directly react on the infection condition of hepatitis B virus, has reliable diagnosis result, high sensitivity and easy automation, and is suitable for detection and screening work of a large number of blood samples. They typically require complex systems and cumbersome sample/reagent handling, which relies on sophisticated laboratories or trained operators with specialized instruments; has the disadvantages of low sensitivity, time-consuming method, false positive, expensive equipment and the like. Therefore, there is an urgent need to develop new highly sensitive strategies to monitor HBV nucleic acid levels, particularly those that can be used for rapid and universal point-of-care diagnostic applications.

Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) is derived from an adaptive immune system aiming at invasive nucleic acid components in bacteria and archaea, and has become an important tool in the aspects of transcriptional regulation, genome editing, nucleic acid detection and the like nowadays due to the programmability of the system. Particularly after the trans-cleavage activity of the CRISPR-associated proteins Cas12a and Cas13a is found, the application of the CRISPR-associated proteins Cas12a and Cas13a in nucleic acid detection is widened. CRISPR/Cas12 Sup>A, belonging to class II V-Sup>A CRISPR system, is capable of activating the trans-cleavage activity of Cas12 Sup>A without specifically cleaving single-stranded dnSup>A (ssdnSup>A) using CRISPR rnSup>A (crrnSup>A) to specifically recognize single-stranded dnSup>A (ssdnSup>A) or double-stranded dnSup>A (dsdnSup>A) containing Proto-spacer Adjacent Motif (PAM). Researchers such as Doudna have established the DETECTR method (DNA Endonuclease-Targeted Crispr Trans Reporter) based on this feature of Cas12 a. In addition, cas12a is also used for human genotyping and pathogen detection, cancer mutation testing, on-site instant detection and the like, and provides a new opportunity for rapid detection of HBV.

Compared with the traditional nucleic acid detection technology, the novel detection technology developed based on the CRISPR/Cas system has the following advantages: (1) simple and convenient; (2) the cost is low; (3) the time consumption is short; (4) the sensitivity is high; (5) the specificity is high; (6) multiplex detection, etc. Although CRISPR/Cas12a has great potential in nucleic acid detection, certain limitations still exist. First, CRISPR effectors present sequence limitations that severely require a PAM characteristic over the dsDNA target sequence, thereby limiting the versatility of nucleic acid analysis. Secondly, most current methods rely on PCR or RPA to amplify the target substance, and require strict reaction conditions such as multiple enzymes, complicated primer design and thermal cycling, which is very unfavorable for bedside detection or difficult condition popularization. Most importantly, cas proteins bind to other enzymatic systems, and reaction efficiency is affected due to incompatible reactions of different systems.

Disclosure of Invention

In view of the above drawbacks of the prior art, the present invention aims to provide a fluorescent sensor for detecting HBV and preparation and application thereof, and the present invention provides a biosensor for HBV response to CRISPR/Cas12a, which generates double-stranded DNA containing PAM site that can be recognized by Cas12a-crRNA complex by constructing a foothold-mediated strand displacement reaction (TMSDR), and causes the cascade strand displacement to release a free target, and successfully constructs a novel isothermal nucleic acid detection platform with high sensitivity, high specificity, universality and suitability for on-site timely detection by utilizing the programmability of strand displacement and the function of Cas12a, so as to solve the technical problems of a novel detection technology developed based on CRISPR/Cas system in nucleic acid detection.

To achieve the above and other related objects, a first aspect of the present invention provides a fluorescence sensor for detecting HBV, comprising a signal recognizing portion: target substance-triggered toehold-mediated strand displacement reaction (TMSDR), signal transduction moiety: the target substance is converted into double stranded DNA containing a PAM sequence recognizable by Cas12 a.

Further, the signal recognition moiety comprises a target substance and an HP probe that forms a hairpin structure by denaturing annealing, the HP probe comprising a moiety complementary to the target substance, the crRNA, respectively, and a PAM sequence; and adding the signal recognition part into a fluorescence reaction system, enabling the target substance to be combined with the foothold of the HP probe, opening the HP probe through a foothold mediated strand displacement reaction, exposing a foothold region which can be identified by the crRNA, hybridizing the crRNA strand with the exposed foothold region under the assistance of the Cas12A, displacing to release the target substance, forming a Cas12A excited body, and then enabling the displaced target substance to be combined with other HP probes to trigger the next cycle reaction, thereby generating a large amount of the Cas12A excited body.

Further, the signal converting moiety comprises a Cas12a activator and a single-stranded reporter probe (RP probe) labeled with a fluorescent group and a fluorescence quenching group, and the Cas12a activator is capable of cleaving the single-stranded reporter probe in trans to generate a measurable amount of fluorescent signal.

Further, the nucleotide sequence of the HP probe is as follows:

5'-TGGGGGAGGAGATTAGGTTAAAGGTCGGATTTGACCGGGAACCTAATCTCCT

CCCCCAACTCCTCC-3' （SEQ ID NO.1）。

further, the nucleotide sequence of the T chain of the target substance is:

5'-TGGGAGGAGTTGGGGGAGGAGATTAGGTTAAAGGT-3'（SEQ ID NO.2）。

further, the nucleotide sequence of the single-stranded reporter probe (RP probe) is as follows:

5'- TTATT-3'（SEQ ID NO.3）。

furthermore, the single-stranded reporter probe is labeled with a fluorescent group at the 5 'end and a fluorescence quenching group at the 3' end, wherein the fluorescent group is selected from at least one of FAM, cy3 and Cy5, and the fluorescence quenching group is selected from at least one of BHQ1, BHQ2 and BHQ 3.

Further, the nucleotide sequence of the crRNA is as follows:

5'-UAAUUUCUACUAAGUGUAGAUGUCCUUUAACCUAAUCUCCUCCCCCA-3' （SEQ ID NO.4）。

in a second aspect, the present invention provides a method for preparing a fluorescence sensor for detecting HBV according to the first aspect, comprising the steps of:

(a) Preparation of HP probes: performing denaturation annealing by adopting a synthetic DNA single-stranded probe to form an HP probe with a hairpin structure, wherein the HP probe comprises a part which is respectively complementary with a target substance and crRNA and a PAM sequence;

(b) And (b) mixing the target substance T chain to be detected and the HP probe obtained in the step (a) with the Cas12a, the crRNA and the single-chain report probe (RP probe), incubating, and constructing to obtain the fluorescent reaction system.

Further, in the step (a), the reaction solution for preparing the HP probe includes: 18 μ L of 10 XNEBuffer 3.0 buffer, 2 μ L of 100 μ M HP probe.

Alternatively, the HP probe was dissolved in enzyme-free water and configured as a 100. Mu.M HP probe.

Further, in the step (a), the denaturation temperature is 65-95 ℃, preferably 95 ℃; the denaturation time is 5 to 10 minutes, preferably 5min.

Further, in the step (b), the mole ratio of the HP probe, the Cas12a and the crRNA is 1: (1-1.5): (1-2), preferably 1:1: 1. 1:1.5:1.5, 1:1.5:2, more preferably 1:1.5:2.

further, in the step (b), the reaction solution includes: RNase Inhibitor, 10 XNEBuffer 3.0 buffer, HP probe, cas12a, crRNA, single-stranded reporter probe (RP probe), target T-strands of different concentrations, DEPC water.

Preferably, in the step (b), the reaction solution includes: mu.L of 10U/. Mu.L RNase inhibitor, 10. Mu.L of 10 XNEBuffer 3.0 buffer, 5. Mu.L of 1. Mu.M HP probe, 5. Mu.L of 1. Mu.M Cas12a, 5. Mu.L of 1. Mu.M crRNA, 2. Mu.L of 10. Mu.M single-stranded reporter probe (RP probe), 20. Mu.L of T-strands of the target substance at different concentrations, and 48. Mu.L of DEPC water.

Further, in the step (b), the incubation is performed under the condition of keeping out light, and the incubation reaction conditions are as follows: incubation time is 20-100min, preferably 60min at 37 ℃.

In a third aspect of the present invention, a fluorescence signal is detected by a fluorescence spectrophotometer to obtain the content of a target substance, using the fluorescence sensor of the first aspect and/or the fluorescence sensor prepared by the method of the second aspect.

Further, the method comprises the steps of:

(1) Cleaning a quartz cuvette: soaking quartz cuvette in ethanol, and adding ddH ₂ O cleaning;

(2) Setting parameters: setting the excitation wavelength to 492nm, the slit width to 3nm and the emission wavelength range to 500-600nm;

(3) Zero setting: adding ddH to the Quartz cuvette ₂ O, carrying out zero setting;

(4) And (3) detection: and adding the reaction solution into a fluorescent cuvette, and performing click detection to obtain a fluorescent signal.

As mentioned above, the fluorescence sensor for detecting HBV, the preparation and the application thereof of the invention have the following beneficial effects:

the invention innovatively provides an HBV (hepatitis B virus) response CRISPR/Cas12a biosensor, generates double-stranded DNA (deoxyribonucleic acid) containing a PAM (polyacrylamide) site and capable of being recognized by a Cas12a-crRNA (ribonucleic acid) complex by constructing a foothold mediated strand displacement reaction, and causes the strand displacement of a cascade to release a free target. The invention successfully constructs a novel isothermal nucleic acid detection platform by combining the programmability of strand displacement with the function of Cas12 a. The invention has the following advantages: (1) The sensitivity is high, the reaction can recycle the target substance and amplify the target signal; the CRISPR/Cas12a has high turnover rate, and the double amplification improves the detection sensitivity; (2) High-fidelity recognition, reaction recognition has specificity, and the detection of the target with high specificity can be ensured; (3) has universality: an auxiliary chain containing a PAM site is artificially added, the PAM sequence limitation of the Cas12a is overcome, and the detection range and the universality are expanded; and (4) isothermal reaction, which is suitable for on-site instant detection.

Drawings

FIG. 1 shows a schematic diagram of the detection of the method of the present invention.

FIG. 2 is a graph showing a comparison of fluorescence signals for verifying the feasibility of the fluorescence sensor in example 2.

FIG. 3 shows the results of the optimization of the mole ratio of HP probe, cas12a, and crRNA in example 3.

FIG. 4 is a graph showing the results of fluorescence obtained by optimizing the number of bases of the foothold of the HP probe in example 4.

Detailed Description

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

The invention innovatively provides an HBV (hepatitis B virus) response CRISPR/Cas12a fluorescence sensor, which generates double-stranded DNA (deoxyribonucleic acid) containing a PAM (polyacrylamide) site and capable of being recognized by a Cas12a-crRNA (ribonucleic acid) complex by constructing a foothold mediated strand displacement reaction and causes the release of a free target by cascade strand displacement. The fluorescence sensor combines the foothold-mediated cascade strand displacement reaction and the CRISPR/Cas12a for the first time, uses the detection of HBV, and realizes the double amplification of cascade signals by combining the foothold-mediated cascade strand displacement reaction with the signal amplification effect of a CRISPR system, thereby realizing the high-sensitivity detection of HBV.

A Toehold-mediated Strand Displacement Reaction (TMSDR) is an accelerated hybridization Reaction that reversibly displaces double-stranded structures through invading strands. The method avoids the involvement of any enzyme used for target cycle amplification and has the property of reducing background noise. The rate constant of the TMSDR can span several orders of magnitude, which helps to build a robust, low-cost and autonomous detection platform without the need for specific reaction conditions. Therefore, the problems in the prior art can be solved by using the TMSDR and the CRISPR/Cas together, and an efficient system can be constructed for detecting HBV.

The fluorescent sensor constructed by the invention has the advantages of simple preparation and detection method, low cost, effective prevention of nonspecific reaction, good stability and reproducibility, and is expected to be popularized and used in the aspects of HBV detection analysis and application research.

Example 1

Preparation of fluorescent sensor and detection of miRNA

1. Materials and methods

1.1 materials

The HPLC purified oligonucleotides were synthesized from Shanghai. EnGen Lba Cas12a and NEBuffer3.0 solutions were purchased from New England Biolabs. DEPC water, enzyme-free water and RNase inhibitor were purchased from Shanghai.

1.2 detection Instrument

Edinburgh integrated steady state transient state fluorescence spectrometer FS5.

1.3 detection principle

As shown in FIG. 1, in a homogeneous system, the target substance binds to the foothold in the HP probe, and the HP probe is opened by a foothold-mediated strand displacement reaction, thereby exposing the closed foothold located in the HP probe. Subsequently, the pre-assembled Cas12a/crRNA hybridizes to the exposed toehold domain through the crRNA, displacing the target with base-pairing extension and forming a Cas12a agonist. Subsequently, the displaced free target substance rapidly binds to other HP hairpins to trigger the next cycle reaction, thereby generating a large amount of Cas12a kinase. The resulting large amount of Cas12a activator-non-specific cleavage reporter probe generates a fluorescent signal. The content of the target substance can be obtained by detecting the fluorescence signal.

1.4 construction of Cas12 a-assisted, foothold-mediated, strand displacement reaction:

(1) Preparation of HP probes: HP was prepared at 10. Mu.M using NEBuffer3.0 buffer, denatured at 95 ℃ for 5 minutes, slowly cooled to room temperature and left at 4 ℃ until use.

The nucleotide sequence of the HP probe is:

5'-TGGGGGAGGAGATTAGGTTAAAGGTCGGATTTGACCGGGAACCTAATCTCCT

CCCCCAACTCCTCC-3'（SEQ ID NO.1）。

preparation of HP Probe: 20 μ L

HP Probe 2. Mu.L 100. Mu.M

NEBbuffer3 .0 18μL 10×

(2) Constructing a chain replacement reaction of a CRISPR/Cas12a reaction system assisted street foothold for CTSDR: the target substance T chain, HP probe, crRNA, single-chain report probe (RP probe) and Cas12a protein to be detected are dissolved in a buffer solution together, and the light-shielding reaction is carried out for 60min at the temperature of 37 ℃.

The nucleotide sequence of the target substance T chain is:

5'-TGGGAGGAGTTGGGGGAGGAGATTAGGTTAAAGGT-3’ （SEQ ID NO.2）。

the nucleotide sequence of the RP probe is:

5'- FAM-TTATT-BHQ1-3'（SEQ ID NO.3）。

the nucleotide sequence of crRNA is:

5’-UAAUUUCUACUAAGUGUAGAUGUCCUUUAACCUAAUCUCCUCCCCCA-3’ （SEQ ID NO.4）。

(3) And (3) detecting a fluorescence signal: and adding the reaction product into a quartz cuvette, and measuring by using a fluorescence spectrophotometer.

Example 2

Verification of feasibility of detecting miRNA fluorescent sensor

1. Validation of the foothold-mediated strand displacement reaction and cleavage of Cas12a was performed as follows:

1) Preparation of HP probes: HP was prepared as a 20. Mu.L solution at a concentration of 10. Mu.M using NEBuffer3.0 buffer, denatured at 95 ℃ for 5 minutes, slowly cooled to room temperature and left at 4 ℃ until use. 2) The fluorescence spectrophotometer verifies the experimental feasibility:

adding the above liquids to obtain 100 μ L of working solution, mixing on a shaker, centrifuging rapidly for a short time with a palm centrifuge, and reacting in an incubator at 37 deg.C for 1 hr. And (3) after the reaction is finished, measuring the fluorescence intensity of the solution by using a fluorescence spectrophotometer. The results are shown in FIG. 2. In fig. 2, the red curve is the experimental group; black curves are control lacking target substance; blue curve without HP probe; the pink curve is a control without Cas12a and the green curve is a control without crRNA. As can be seen from fig. 2, the method constructed by the present invention can cascade-start the trans-cleavage activity of Cas12a by target-triggered foothold-mediated strand displacement, cleave the RP probe, and release the fluorescence of FAM.

Example 3

Molar ratio of HP Probe, cas12a, crRNA

To examine the effect of the mole ratio of HP probe, cas12a, crRNA on the stability and reaction speed of the developed fluorescence sensor, this example further investigated the optimal mole ratio of HP probe, cas12a, crRNA.

As can be seen from fig. 4, when the molar ratio is 1:1.5: at 2, the signal-to-noise ratio is optimal. Thus, 1:1.5: the molar ratio of 2 is chosen as the optimum ratio.

Example 4

Optimizing the number of the base of the standing point of the HP probe

In order to examine the influence of the number of the base at the foothold of the HP probe on the stability and reaction rate of the developed fluorescence sensor, the optimum number of the foothold base was further investigated in this example.

As can be seen from FIG. 4, the signal-to-noise ratio was the best when the number of the base at the foothold was 6. Therefore, the number of bases of 6 footholds was selected as the optimum number of bases.

In conclusion, the fluorescence sensor for detecting HBV is successfully constructed, and the sensor shows the capabilities of high sensitivity and good reproducibility in the determination of HBV. Compared with the prior art, the sensor has the advantages of low cost, high sensitivity and high reaction speed. Is expected to be applied to the measurement of practical samples and clinical specimens and is developed into a sensor with clinical application value.

The foregoing embodiments are merely illustrative of the principles and utilities of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.

SEQUENCE LISTING

<110> university of Chongqing medical science

<120> fluorescence sensor for detecting HBV, preparation and application thereof

<130> PCQYK2110471-HZ

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 66

<212> DNA

<213> Artificial

<220>

<223> HP Probe

<400> 1

tgggggagga gattaggtta aaggtcggat ttgaccggga acctaatctc ctcccccaac 60

tcctcc 66

<210> 2

<211> 35

<212> DNA

<213> Artificial

<220>

<223> target substance T chain

<400> 2

tgggaggagt tgggggagga gattaggtta aaggt 35

<210> 3

<211> 5

<212> DNA

<213> Artificial

<220>

<223> RP Probe

<400> 3

ttatt 5

<210> 4

<211> 47

<212> RNA

<213> Artificial

<220>

<223> crRNA

<400> 4

uaauuucuac uaaguguaga uguccuuuaa ccuaaucucc uccccca 47

Claims (8)

1. A fluorescence sensor for detecting HBV, comprising: the signal identification section: a foothold mediated strand displacement reaction triggered by a target substance T strand, a signal conversion part: converting the target substance T chain into double-stranded DNA which can be identified by Cas12a and contains a PAM sequence;

the signal recognition part comprises a target substance T chain and an HP probe, the HP probe forms a hairpin structure through denaturation annealing, and the HP probe comprises a part complementary with the target substance T chain and the crRNA and a PAM sequence; adding the signal recognition part into a fluorescence reaction system, enabling a target substance T chain to be combined with the foothold of an HP probe, opening the HP probe through a foothold mediated chain displacement reaction, exposing a foothold area which can be identified by crRNA, hybridizing the crRNA chain with the exposed foothold area under the assistance of Cas12a, displacing to release the target substance T chain, forming a Cas12a activated body, and triggering the next cycle reaction by combining the displaced target substance T chain with other HP probes, so that a large amount of Cas12a activated bodies are generated;

the signal conversion part comprises a Cas12a activating body and a single-stranded report probe marked with a fluorescent group and a fluorescence quenching group, wherein the Cas12a activating body can reversely cut the single-stranded report probe to generate a large amount of measurable fluorescent signals;

the nucleotide sequence of the HP probe is as follows:

5'-TGGGGGAGGAGATTAGGTTAAAGGTCGGATTTGACCGGGAACCTAATCTCCTCCCCC

AACTCCTCC-3'（SEQ ID NO.1）；

the nucleotide sequence of the target substance T chain is as follows:

5'-TGGGAGGAGTTGGGGGAGGAGATTAGGTTAAAGGT-3'（SEQ ID NO.2）；

the nucleotide sequence of the single-stranded report probe is as follows:

5'- TTATT-3'（SEQ ID NO.3）；

the single-stranded reporter probe is characterized in that a 5 'end is labeled with a fluorescent group, a 3' end is labeled with a fluorescence quenching group, the fluorescent group is selected from at least one of FAM, cy3 and Cy5, and the fluorescence quenching group is selected from at least one of BHQ1, BHQ2 and BHQ 3;

the nucleotide sequence of the crRNA is as follows:

5'-UAAUUUCUACUAAGUGUAGAUGUCCUUUAACCUAAUCUCCUCCCCCA-3'（SEQ ID NO.4）。

2. the method for preparing a fluorescence sensor for detecting HBV as claimed in claim 1, comprising the steps of:

(a) Preparation of HP probes: performing denaturation annealing by using a DNA single-stranded probe to form an HP probe with a hairpin structure, wherein the HP probe comprises a part which is complementary with a target substance T chain and crRNA and a PAM sequence;

(b) And (b) taking a target substance T chain to be detected and the HP probe obtained in the step (a), mixing with the Cas12a, the crRNA and the single-stranded reporter probe, incubating, and constructing to obtain a fluorescence reaction system.

3. The production method according to claim 2, characterized in that: in the step (a), the reaction solution for preparing the HP probe includes: 18. Mu.L of 10 XNEBuffer 3.0 buffer, 2. Mu.L of 100. Mu.M HP probe;

in the step (a), the denaturation temperature is 95 ℃ and the denaturation time is 5min.

4. The method of claim 2, wherein: in the step (b), the mole ratio of the HP probe, the Cas12a and the crRNA is 1:1.5:2;

in the step (b), the incubation is carried out under the condition of keeping away from light, and the incubation reaction conditions are as follows: incubation time was 60min at 37 ℃.

5. The production method according to claim 2, characterized in that: in the step (b), the reaction solution for constructing the fluorescence reaction system includes: RNase Inhibitor, 10 XNEBuffer 3.0 buffer solution, HP probe, cas12a, crRNA, single-stranded reporter probe, target substance T strands with different concentrations and DEPC water.

6. The method of claim 5, wherein: in the step (b), the reaction solution includes: mu.L of 10U/. Mu.L RNase Inhibitor, 10. Mu.L of 10 XNEBuffer 3.0 buffer, 5. Mu.L of 1. Mu.M HP probe, 5. Mu.L of 1. Mu.M Cas12a, 5. Mu.L of 1. Mu.M crRNA, 2. Mu.L of 10. Mu.M single-stranded reporter probe, 20. Mu.L of T-strands of target substances at different concentrations, and 48. Mu.L of DEPC water.

7. A method for detecting HBV for non-disease diagnostic or therapeutic purposes, comprising: detecting a fluorescence signal by using the fluorescence sensor according to claim 1 and/or the fluorescence sensor prepared by the method according to any one of claims 2 to 6, and obtaining the content of the target substance T chain by using a fluorescence spectrophotometer.

8. The HBV detection method according to claim 7, comprising the steps of:

(1) Cleaning a quartz cuvette: soaking quartz cuvette in ethanol, and adding ddH ₂ O cleaning;

(2) Setting parameters: setting the excitation wavelength to 492nm, the slit width to 3nm and the emission wavelength range to 500-600nm;

(3) Zero setting: adding ddH to the Quartz cuvette ₂ O, carrying out zero setting;

(4) And (3) detection: and adding the reaction solution into a fluorescent cuvette, and performing click detection to obtain a fluorescent signal.

Images