CN113575411A - Breeding method for improving wheat scab resistance by using scab resistant germplasm SF7EL9 - Google Patents

Breeding method for improving wheat scab resistance by using scab resistant germplasm SF7EL9 Download PDF

Info

Publication number
CN113575411A
CN113575411A CN202110885145.4A CN202110885145A CN113575411A CN 113575411 A CN113575411 A CN 113575411A CN 202110885145 A CN202110885145 A CN 202110885145A CN 113575411 A CN113575411 A CN 113575411A
Authority
CN
China
Prior art keywords
parent
sf7el9
seeds
scab
wheat
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110885145.4A
Other languages
Chinese (zh)
Inventor
戴毅
陈建民
李海凤
石俊涛
高勇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yangzhou University
Original Assignee
Yangzhou University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yangzhou University filed Critical Yangzhou University
Priority to CN202110885145.4A priority Critical patent/CN113575411A/en
Publication of CN113575411A publication Critical patent/CN113575411A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
    • A01H1/021—Methods of breeding using interspecific crosses, i.e. interspecies crosses
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Botany (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Animal Husbandry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention relates to a breeding method for improving wheat scab resistance by utilizing a scab resistant germplasm SF7EL9, 1 7EL specific molecular marker Th7EL-46 can effectively identify whether a thinopyrum elongatum 7EL chromosome segment is contained, and molecular marker-assisted selective breeding is facilitated. After the product amplified by the marker is subjected to gel electrophoresis, a 450bp band is a 7EL chromosome fragment specific band. In addition, the identification combined with fluorescence in situ hybridization can effectively distinguish whether the translocation chromosome is homozygous or heterozygous, and if only 1 translocation chromosome is contained, the material is a heterozygous translocation line; if the material contains 2 translocation chromosomes with the same FISH karyotype, the material is a homozygous translocation line. Mainly utilizes a distant hybridization means to hybridize the scab resistant wheat-elytrigia elongata 7EL small fragment translocation line SF7EL9 with cultivated wheat, and breeds the scab resistant wheat germplasm in the hybridization offspring. The Th7E-46 provided by the invention can be used as a biomarker to be applied to real-time identification of the elytrigia elongata 7EL chromosome segment contained in disease-resistant germplasm.

Description

Breeding method for improving wheat scab resistance by using scab resistant germplasm SF7EL9
Technical Field
The invention relates to a breeding method for improving wheat scab resistance by utilizing a scab resistant germplasm SF7EL9, belonging to the technical field of plant breeding.
Background
Wheat scab (FHB) is a major worldwide disease caused by pathogenic bacteria such as Fusarium asiaticum and Fusarium graminearum, and seriously affects wheat yield and quality. After wheat is infected with gibberellic disease, besides the yield is obviously reduced, toxin Deoxynivalenol (DON) is accumulated in grains, and great hidden danger is brought to food safety. With the change of global climate warming and cultivation system and mode, the growing area of wheat scab in China has a tendency of continuously expanding, the growing area of wheat scab in 2005 + 2010 is about 6196 ten thousand mu, the growing area of wheat scab in 2011 + 2018 is increased to 8632 ten thousand mu, and the growing area of wheat scab in 2019 + 2020 is increased to about 9000 ten thousand mu. How to prevent and control gibberellic disease is a major challenge facing wheat production at present. The breeding of disease-resistant variety by using wheat scab-resistant gene is one of the most economic and effective ways to control the damage of wheat scab. However, wheat is relatively deficient in genetic resources for resisting gibberellic disease, and only 4 sites are defined as wheat scab resistance genes (Fhb1, Fhb2, Fhb4 and Fhb5) at present and are used in wheat genetic breeding. The scab resistant gene is also found in wheat closely related species, such as Fhb3 from grass galileo, Fhb6 from Japanese elymus japonicus, and Fhb7 from decaploid elytrigia elongata. Therefore, the gene for resisting the gibberellic disease in the wheat kindred species is transferred into the wheat, which is beneficial to enriching and expanding the genetic basis of resisting the gibberellic disease of the wheat and is one of effective ways for improving the resistance of the wheat to the gibberellic disease.
Thinopyrum elongatum (Thinopyrum elongatum) is an important closely related species of wheat, and contains a plurality of genes which are extremely useful for improving wheat, such as disease resistance, cold resistance, drought resistance, salt and alkali resistance, aphid resistance and the like, wherein 1E and 7E chromosomes carry gibberellic disease resistance genes (see the reference: Liu-Dan, Zheng Liang, Wang Shi, Hou Yong, Lanxiu jin, Wei Youmiming, Lophopyrum elongatum chromosome location which influences the gibberellic disease resistance of wheat, university of Sichuan university, 2001,19: 200-.
Through years of research, a common wheat-diploid elytrigia elongata substitution line is hybridized with common wheat, and a wheat-elytrigia elongata 7EL brachial integral translocation line (T7BS.7EL) is obtained by an ionizing radiation method, and is identified to have excellent gibberellic disease resistance (see references: xylonite, Chenopodium, Lihaofeng, Liuhui duckweed, Dayi, heroic, Chenjian. wheat-elytrigia elongata 7E gibberellic disease resistance translocation line cultivation. Chinese agricultural science 2016, 49 (18): 3477-. However, the materials are all of the whole-arm translocation line, the agronomic characters of the materials are not outstanding, and the materials are not directly applied to breeding. In order to further transfer and utilize scab-resistant genes on a long-spike elytrigia repens 7EL chromosome, T7BS.7EL pollen after ionizing radiation is awarded to Yangmai 158, multiple backcrosses are carried out on the Yangmai 158, 7EL chromosome molecular markers and genome fluorescence in situ hybridization (GISH) identification are utilized in a radiation backcross progeny, and a large number of wheat-long-spike elytrigia repens 7EL small fragment translocation lines are created. Through the identification of the resistance to gibberellic disease for many years, the translocation line SF7EL9 is found to have excellent resistance to gibberellic disease, and a new germplasm is provided for wheat scab resistance breeding. The invention discloses a breeding method for improving the resistance of wheat scab by using the translocation line on the basis.
Disclosure of Invention
The invention aims to solve the problems, and provides a breeding method for improving the scab resistance of wheat by utilizing a scab resistant germplasm SF7EL9, namely, taking SF7EL9 as one of parents, identifying a translocation chromosome by utilizing a elytrigia elongata 7EL chromosome specific molecular marker Th7EL-46 and genome fluorescence in situ hybridization (GISH) on the basis of rolling backcross, and obtaining a new scab resistant wheat germplasm through a scab resistance test. Application of the gibberellic disease resistant germplasm SF7EL9 in molecular breeding for improving wheat scab resistance.
The purpose of the invention is realized by the following technical scheme: a breeding method for improving wheat scab resistance by using a scab resistant germplasm SF7EL9 is characterized by comprising the following steps:
step 1), breeding with the gibberellic disease resistant germplasm SF7EL9 as parent, namely male parent or female parentHybridization of a variety with good middle-high yield, F1Backcrossing the generation or hybridizing with another variety with better yield to obtain BC1F1100 seeds;
step 2), planting BC by single plant1F1In seedling stage, molecular marker Th7EL-46 is used to pair BC1F1Selecting plants, reserving plants containing the Th7EL-46 marker, and harvesting seeds from the plants to obtain BC1F2Seeds;
step 3), planting BC by single plant1F2Selecting by using molecular marker Th7EL-46 and genome fluorescence in situ hybridization GISH at seedling stage, and obtaining seeds of plants containing Th7EL-46 marker and translocation chromosome by dividing the plants to obtain BC1F3Seeds;
step 4), planting BC by single plant1F3Line, every 10 BC1F3The strain is planted with a contrast parent 1 and a parent 2, wherein the parent 1 is SF7EL9 or Yangmai 23 or Annong 8455, and the parent 2 is Yangmai 23 or SF7EL9 Annong 8455; selecting plants containing Th7EL-46 marker and translocation chromosome in seedling stage, selecting plants with plant height, plant type and gibberellic disease resistance superior to those of control parent in grain filling stage and yellow falling stage, and harvesting seeds to obtain BC1F4Seeds;
step 5), planting BC by single plant1F4Line, every 10 BC1F4The strain is planted with a contrast parent 1 and a parent 2, wherein the parent 1 is SF7EL9 or Yangmai 23 or Annong 8455, and the parent 2 is Yangmai 23 or SF7EL9 Annong 8455; selecting plants containing Th7EL-46 marker and a pair of translocation chromosomes in seedling stage, selecting plant lines with plant height, plant type and gibberellic disease resistance superior to those of control parents in grain filling stage and yellow falling stage, and harvesting seeds by single plant to obtain BC1F5Seeds;
step 6), planting BC by single plant1F5Line, every 10 BC1F5The strain is planted with a contrast parent 1 and a parent 2, wherein the parent 1 is SF7EL9 or Yangmai 23 or Annong 8455, and the parent 2 is Yangmai 23 or SF7EL9 Annong 8455; selecting the composition at seedling stageTh7EL-46 marker and a pair of translocated chromosome plants, selecting plant lines with plant height, plant type and gibberellic disease resistance superior to those of a control parent in grain filling stage and yellow falling stage, and harvesting seeds in a mixed manner to obtain BC1F6Seeds;
step 7), planting BC in different districts1F6Seeds and three cells, and simultaneously planting a control parent 1 and a parent 2, wherein the parent 1 is SF7EL9 or Yangmai 23 or Annong 8455, and the parent 2 is Yangmai 23 or SF7EL9 Annong 8455; identification of gibberellic disease resistance at flowering time, Mixed harvest of BC1F6And (3) drying the seeds, weighing, and keeping the yield to be obviously higher than that of the control parent 1 and the parent 2, so as to obtain the new scab resistant wheat strain with high yield.
1 specific marker Th7EL-46 for tracing thinopyrum elongatum 7EL chromosome segment in a new scab-resistant wheat strain, wherein the molecular marker primer is Th7 EL-46F: TTACACTAACCCATGGTGTT, Th7 EL-46R: GCAGAGAATGAAGCAAAATC, the primer is used to perform PCR amplification on the filial generation line, a specific band of 7EL 450bp can be amplified, and the marker can effectively trace the 7EL translocation chromosome.
The method is advanced and scientific, and through the method, the breeding method for improving the scab resistance of the wheat by utilizing the scab resistant germplasm SF7EL9 takes SF7EL9 as a parent (a male parent or a female parent) to be hybridized with a variety with better high yield in breeding, F1Backcrossing the generation or hybridizing with another variety with better yield to obtain BC1F1About 100 seeds are planted in a single plant BC1F1In seedling stage, molecular marker Th7EL-46 is used to pair BC1F1Selecting plants, reserving the plants containing the Th7EL-46 marker, and harvesting seeds of the individual plants; planting BC in single plant1F2Selecting by using molecular marker Th7EL-46 and genome fluorescent in situ hybridization (GISH) in seedling stage, and harvesting seeds by individual plants to obtain BC1F3Seeds; planting BC in single plant1F3Line, every 10 BC1F3Plant line planting is carried out by respectively selecting plant height, plant type and gibberellic disease resistance in grain filling stage and yellow falling stage according to the control parents 1 and 2Selecting plants containing Th7EL-46 marker and translocation chromosome from the lines of the control parents 1 and 2, and harvesting seeds of the plants individually to obtain BC1F4Seeds; planting BC in single plant1F4Line, every 10 BC1F4Planting the control parents 1 and 2 in the strain, selecting the strains with plant height, plant type and gibberellic disease resistance superior to those of the control parents 1 and 2 in the grain filling stage and the yellow falling stage, selecting the plants containing Th7EL-46 marker and a pair of translocation chromosomes, and harvesting the grains by separating the plants to obtain BC1F5Seeds; planting BC in single plant1F5Line, every 10 BC1F5The plants were grown as control parents 1 and 2, and BC was taken before sowing1F5Plant root tips are identified by genome fluorescence in situ hybridization (GISH), strains containing a pair of elytrigia elongata 7EL translocation chromosome segments are reserved, seeds are harvested in a mixed manner, and BC is obtained1F6Seeds; planting BC in subdistrict1F6Seeds, triplicate, and simultaneous planting of control parents 1 and 2, mixed harvest of BC1F6And (3) drying the seeds in the sun, weighing, and keeping the yield to be obviously higher than that of the 1 and 2 families of the control parent, so as to obtain the new scab-resistant wheat strain with high yield.
1 specific marker Th7EL-46 for tracing the elytrigia elongata 7EL chromosome segment in the new scab-resistant wheat strain is a molecular marker primer which is a primer consisting of Th7 EL-46F: TTACACTAACCCATGGTGTT, Th7 EL-46R: GCAGAGAATGAAGCAAAATC, the primer is used to perform PCR amplification on the filial generation line, so that a specific band of about 450bp of 7EL can be amplified, and the marker can effectively trace the 7EL translocation chromosome. In addition, fluorescent in situ hybridization (GISH and FISH) identification can effectively distinguish whether the translocation chromosome is homozygous or heterozygous, thereby facilitating molecular marker-assisted selective breeding.
The invention has the beneficial effects that: the common wheat-elytrigia elongata 7EL translocation line SF7EL9 is a gibberellic disease resistant small-fragment translocation line, is stable in heredity, carries elytrigia elongata 7EL chromosome fragments, has outstanding gibberellic disease resistance (figure 1), can obviously improve the gibberellic disease resistance of common wheat when being used for molecular breeding, and is convenient for culturing a new gibberellic disease resistant wheat strain.
The 1 Th7EL specific molecular marker Th7EL-46 disclosed by the invention can effectively identify whether the thinopyrum elongatum 7EL chromosome fragment is contained, thereby facilitating molecular marker-assisted selective breeding. After gel electrophoresis of the product amplified by the marker, the 450bp band was a 7EL chromosome fragment-specific band (FIG. 2). In addition, the identification combined with fluorescence in situ hybridization (GISH and FISH) can effectively distinguish whether the translocation chromosome is homozygous or heterozygous, and if only 1 translocation chromosome is contained, the material is a heterozygous translocation line; if 2 translocation chromosomes with the same FISH karyotype are contained, the material is shown to be a homozygous translocation line (FIG. 3).
In conclusion, the invention discloses a breeding method for improving the resistance of wheat scab. Mainly utilizes a distant hybridization means to hybridize the scab resistant wheat-elytrigia elongata 7EL small fragment translocation line SF7EL9 with cultivated wheat, and breeds the scab resistant wheat germplasm in the hybridization offspring. The Th7E-46 provided by the invention can be used as a biomarker to be applied to real-time identification of the elytrigia elongata 7EL chromosome segment contained in disease-resistant germplasm.
Drawings
FIG. 1 shows the field phenotype and gibberellic disease resistance of the small fragment translocation line SF7EL 9;
a: phenotype of small fragment translocation line SF7EL9 following field heading; b: single-flower inoculation of scytha graminearum on the basis of 21-day after-ear phenotype was performed on small-fragment translocation line SF7EL9, susceptible variety Annong 8455(AN8455), Roblin, and disease-resistant variety Sumai No. 3 (SU 3).
FIG. 2 shows the PCR amplification result of the specific molecular marker Th7EL-46 in the small fragment translocation line SF7EL 9; m: DNA Marker; 1: the 7EL small fragment metathesis system SF7EL 9; 2: 7EL Whole-arm metathesis system T7 BS.7EL; 3: the attachment system DA 7E; 4: 2X of diploid thinopyrum elongatum; 5: common wheat, Chinese Spring (CS); 6: wheat, triticum aestivum 158.
FIG. 3 shows the results of in situ hybridization (GISH) of mitotic metaphase chromosomal genomes of small fragment translocation lines SF7EL9 root tip cells; the green fluorescence signal is the thinopyrum elongatum 7EL chromosome fragment, and the wheat chromosome is red.
FIG. 4 shows the results of PCR and GISH identification of the backcross progeny of SF7EL9 and Annon 8455;
a, PCR amplification results of a specific molecular marker Th7EL-46 in filial backcross progeny. M: DNA Marker; 1: the 7EL small fragment metathesis system SF7EL 9; 2: 7EL Whole-arm metathesis system T7 BS.7EL; 3: filial backcross progeny; 4: 2X of diploid thinopyrum elongatum; 5: common wheat, Chinese Spring (CS); 6: common wheat Annong 8455.b, in-situ hybridization (GISH) of root tip cell mitosis metaphase chromosome genome of a hybridization backcross progeny. In the figure, a red arrow emits a green fluorescence signal, the red arrow is a thinopyrum elongatum 7EL chromosome fragment, and the wheat chromosome is red.
FIG. 5 shows the resistance of gibberellic disease of the progeny of the backcross of small-fragment translocation line SF7EL9 and Annong 8455;
the ear phenotype of the small fragment translocation line SF7EL9, susceptible variety Annong 8455(AN8455), Roblin cross backcross progeny (xAN 8455), and disease-resistant variety Sumai No. 3 (SU3) after 21 days by single flower instillation of fusarium graminearum.
FIG. 6 shows PCR identification and gibberellic disease resistance of backcross progeny of small fragment translocation line SF7EL9 and Yangmai 23;
a, PCR amplification results of a specific molecular marker Th7EL-46 in filial backcross progeny; m: DNA Marker; 1: the 7EL small fragment metathesis system SF7EL 9; 2: 7EL Whole-arm metathesis system T7 BS.7EL; 3: filial backcross progeny; 4: 2X of diploid thinopyrum elongatum; 5: common wheat, Chinese Spring (CS); 6: common wheat Yangmai 23.b, small fragment translocation line SF7EL9, susceptible variety Annong 8455(AN8455), Roblin, parent Yangmai 23(Y23), filial backcross progeny (YZU-7EL049) and disease-resistant variety Sumai No. 3 (SU3) are inoculated with fusarium graminearum in a single flower mode for 21 days to obtain ear phenotype.
Detailed Description
The present invention will now be described in further detail with reference to the following examples, figures and accompanying illustrations, which are intended to be illustrative, but not limiting, of the invention.
Example 1
In order to understand the effect of a small-fragment translocation line SF7EL9 on scab resistance and to clarify the utilization value of the line, SF7EL9 is used as a male parent, an susceptible variety Annong 8455 is used as a female parent for hybridization, then the Annong 8455 is used as the female parent for backcross for 1 generation and then selfing is carried out, and a molecular marker Th7EL-46 and genome fluorescence in situ hybridization (GISH) are used for identification (figure 4), so that improved new germplasm is obtained. The resistance identification of the gibberellic disease for many years shows that the obtained new germplasm is highly resistant to the gibberellic disease (figure 5).
Example 2
Using SF7EL9 as one of parents (male parent or female parent) to hybridize with the high-yield variety Yangmai 23. First, SF7EL9 was hybridized with Yangmai 23, F1Backcrossing the generation with Yangmai 23 to obtain BC1F1Seed, Individual planting BC1F1Selecting by using a molecular marker Th7EL-46 at the seedling stage, reserving plants containing the Th7EL-46 marker, and harvesting the plants individually to obtain BC1F2Seeds; planting BC in single plant1F2Selecting each single plant by using molecular markers and GISH, reserving the single plant containing a Th7EL-46 marker plant and a thinopyrum elongatum chromosome, simultaneously carrying out gibberellic disease resistance identification by using a single-flower drip method in the flowering period, and harvesting the plants with good gibberellic disease resistance to obtain BC by using the single plant1F3Seeds; planting BC in single plant1F3Selecting each single plant by using molecular markers and GISH, reserving plants containing Th7EL-46 markers and a pair of translocation chromosomes, performing gibberellic disease resistance identification by using a single flower drip method in the flowering period, performing agronomic character statistics, and harvesting plants with good gibberellic disease resistance and agronomic characters from the single plants to obtain BC (plant block C)1F4Seeds; planting BC in single plant1F4Selecting each individual plant by using molecular markers and GISH, reserving plants containing Th7EL-46 marker plants and a pair of translocation chromosomes, performing gibberellic disease resistance identification by using a single flower drip method in the flowering period, performing agronomic character statistics, and harvesting plants with good gibberellic disease resistance and agronomic characters in a mixed mode to obtain BC (plant block c) by using each individual plant to breed 6 rows and 5 plants in each row1F5Seeds; planting BC in subdistrict1F5And 23, 3 times of repetition of the parent Yangmai, and counting the agronomic characters to finally obtain the new gibberellic disease resistant germplasm YZU-7EL049 (table 1, figure 6).
TABLE 1 comparison of the novel germplasm YZU-7EL049 with its background parent Yangmai 23 for major agronomic traits
Figure BDA0003193797570000061
Figure BDA0003193797570000071
Note: different letters in the table indicate a significant level of difference of 0.05.
Sequence listing
<110> Yangzhou university
<120> a breeding method for improving wheat scab resistance by using a scab resistant germplasm SF7EL9
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ttacactaac ccatggtgt 19
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
cagagaatga agcaaaatc 19

Claims (2)

1. A breeding method for improving wheat scab resistance by using a scab resistant germplasm SF7EL9 is characterized by comprising the following steps:
step 1), taking the scab resistant germplasm SF7EL9 as a parent, namely a male parent or a female parent, hybridizing with a variety with better high yield in breeding, and F1Backcrossing the generation or hybridizing with another variety with better yield to obtain BC1F1100 seeds;
step 2), planting BC by single plant1F1In the seedling stage, molecular marker Th7EL is used-46 pairs of BC1F1Selecting plants, reserving plants containing the Th7EL-46 marker, and harvesting seeds from the plants to obtain BC1F2Seeds;
step 3), planting BC by single plant1F2Selecting by using molecular marker Th7EL-46 and genome fluorescence in situ hybridization GISH at seedling stage, and obtaining seeds of plants containing Th7EL-46 marker and translocation chromosome by dividing the plants to obtain BC1F3Seeds;
step 4), planting BC by single plant1F3Line, every 10 BC1F3The strain is planted with a contrast parent 1 and a parent 2, wherein the parent 1 is SF7EL9 or Yangmai 23 or Annong 8455, and the parent 2 is Yangmai 23 or SF7EL9 Annong 8455; selecting plants containing Th7EL-46 marker and translocation chromosome in seedling stage, selecting plants with plant height, plant type and gibberellic disease resistance superior to those of control parent in grain filling stage and yellow falling stage, and harvesting seeds to obtain BC1F4Seeds;
step 5), planting BC by single plant1F4Line, every 10 BC1F4The strain is planted with a contrast parent 1 and a parent 2, wherein the parent 1 is SF7EL9 or Yangmai 23 or Annong 8455, and the parent 2 is Yangmai 23 or SF7EL9 Annong 8455; selecting plants containing Th7EL-46 marker and a pair of translocation chromosomes in seedling stage, selecting plant lines with plant height, plant type and gibberellic disease resistance superior to those of control parents in grain filling stage and yellow falling stage, and harvesting seeds by single plant to obtain BC1F5Seeds;
step 6), planting BC by single plant1F5Line, every 10 BC1F5The strain is planted with a contrast parent 1 and a parent 2, wherein the parent 1 is SF7EL9 or Yangmai 23 or Annong 8455, and the parent 2 is Yangmai 23 or SF7EL9 Annong 8455; selecting plants containing Th7EL-46 marker and a pair of translocation chromosomes in seedling stage, selecting plant lines with plant height, plant type and gibberellic disease resistance superior to those of control parents in grain filling stage and yellow falling stage, and harvesting seeds in a mixed manner to obtain BC1F6Seeds;
step 7), planting in different districtsBC1F6Seeds and three cells, and simultaneously planting a control parent 1 and a parent 2, wherein the parent 1 is SF7EL9 or Yangmai 23 or Annong 8455, and the parent 2 is Yangmai 23 or SF7EL9 Annong 8455; identification of gibberellic disease resistance at flowering time, Mixed harvest of BC1F6And (3) drying the seeds, weighing, and keeping the yield to be obviously higher than that of the control parent 1 and the parent 2, so as to obtain the new scab resistant wheat strain with high yield.
2. The breeding method for improving the scab resistance of wheat by using the scab resistant germplasm SF7EL9, according to claim 1, wherein 1 specific marker Th7EL-46 is used for tracking the thinopyrum elongatum 7EL chromosome segment in the new scab resistant wheat line, and the molecular marker primers are Th7 EL-46F: TTACACTAACCCATGGTGTT, Th7 EL-46R: GCAGAGAATGAAGCAAAATC, the primer is used to perform PCR amplification on the filial generation line, a specific band of 7EL 450bp can be amplified, and the marker can effectively trace the 7EL translocation chromosome.
CN202110885145.4A 2021-08-03 2021-08-03 Breeding method for improving wheat scab resistance by using scab resistant germplasm SF7EL9 Pending CN113575411A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110885145.4A CN113575411A (en) 2021-08-03 2021-08-03 Breeding method for improving wheat scab resistance by using scab resistant germplasm SF7EL9

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110885145.4A CN113575411A (en) 2021-08-03 2021-08-03 Breeding method for improving wheat scab resistance by using scab resistant germplasm SF7EL9

Publications (1)

Publication Number Publication Date
CN113575411A true CN113575411A (en) 2021-11-02

Family

ID=78254253

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110885145.4A Pending CN113575411A (en) 2021-08-03 2021-08-03 Breeding method for improving wheat scab resistance by using scab resistant germplasm SF7EL9

Country Status (1)

Country Link
CN (1) CN113575411A (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104585018A (en) * 2015-01-14 2015-05-06 扬州大学 Cultivating method of wheat-agropyron elongatum FHB (Fusarium head blight)-resistant 7E chromosome long arm translocation line
CN107148908A (en) * 2017-06-14 2017-09-12 江苏强农农业技术服务有限公司 A kind of scab resistance wheat breeding new method

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104585018A (en) * 2015-01-14 2015-05-06 扬州大学 Cultivating method of wheat-agropyron elongatum FHB (Fusarium head blight)-resistant 7E chromosome long arm translocation line
CN107148908A (en) * 2017-06-14 2017-09-12 江苏强农农业技术服务有限公司 A kind of scab resistance wheat breeding new method

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
张璐璐等: "小麦-长穗偃麦草7E抗赤霉病易位系培育", 《中国农业科学》 *
李海凤等: "小麦-长穗偃麦草T7BS.7EL易位系鉴定及7EL小片段易位诱导", 《麦类作物学报》 *
陈士强等: "分子标记和辐射技术在小麦-长穗偃麦草抗赤霉病易位系创建中的应用", 《核农学报》 *

Similar Documents

Publication Publication Date Title
Wang et al. Identification and molecular mapping of a dwarfing gene in barley (Hordeum vulgare L.) and its correlation with other agronomic traits
CN107201404B (en) Molecular biological identification method for sex of asparagus hermaphrodite plants and application thereof
CN111011131B (en) Breeding method combining rapid development technology, molecular marker technology and conventional breeding of wheat
US20190191645A1 (en) Method for cultivating perennial rice using asexual propagation characteristic of oryza longistaminata
CN111793710B (en) SNP marker linked with cauliflower ball-bottom flower stalk branch angle, method and application
CN114793886B (en) Method for breeding drought-tolerant male parent germplasm based on maize PB group
CN113179945A (en) Breeding method of high-yield lodging-resistant disease-resistant new wheat variety
Pereira et al. Twenty-two-year papaya breeding program: from breeding strategy establishment to cultivar development
Weerasooriya et al. Genetic diversity and population structure among sorghum (Sorghum bicolor, L.) germplasm collections from Western Ethiopia
CN110463599A (en) A kind of Direct-seeding Rice selection
CN113016603B (en) Molecular breeding method of primary high-quality long-grain broad-spectrum rice blast-resistant normal recovery line
CN103834647B (en) Wheat Dwarfing gene Rht dC20closely linked SSR marker Xgwm537 and uses thereof
CN105331689B (en) Wheat-elytrigia elongata powdery mildew resistant translocation line breeding method and molecular marker thereof
NL2031181B1 (en) Method for cultivating scab - resistant and high - yield wheat in Huanghuai wheat area based on multi - gene polymerization
CN108048599B (en) Molecular marker closely linked with rape lateral root number major QTL site RtA07-2 and application
CN111073991A (en) Rice blast resistance gene Pi67(t), codominant molecular marker closely linked with same and application
Nakano et al. Quantitative trait loci (QTL) controlling plant architecture traits in a Solanum lycopersicum× S. pimpinellifolium cross
CN113575411A (en) Breeding method for improving wheat scab resistance by using scab resistant germplasm SF7EL9
CN114277175A (en) Rapid and efficient wheat scab-resistant molecular design breeding method
Smitchger Quantitative trait loci associated with lodging, stem strength, yield, and other important agronomic traits in dry field peas
CN114931092B (en) Wheat scab resistant molecular breeding method capable of polymerizing multiple traits and facilitating allelic variation
CN114752593B (en) SSR (simple sequence repeat) marker for predicting white wax heterosis and application thereof
Wu Classic genetics and breeding of bioenergy related traits in switchgrass
CN109576387A (en) From the SNP marker of the fibre length major gene resistance of the early 24 and Lu Mianyan 28 in new land
Taitano Exploring genetic diversity underlying fruit diversity in tomato and pepper

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20211102