CN113563453A

CN113563453A - Preparation and application of chicken interleukin 17B recombinant lactobacillus immune preparation

Info

Publication number: CN113563453A
Application number: CN202110838325.7A
Authority: CN
Inventors: 高荣; 郭绍华; 彭俊杰; 肖永乐; 刘岩岩; 杨鑫; 王红宁
Original assignee: Sichuan University
Current assignee: Sichuan University
Priority date: 2021-07-23
Filing date: 2021-07-23
Publication date: 2021-10-29

Abstract

The invention discloses a preparation method and application of a chicken interleukin 17B recombinant lactobacillus immune preparation. The invention provides application of specific protein, which is (a1) or (a 2): (a1) preparing an immunopotentiator; (a2) as an immune enhancer; the specific protein is (b1) or (b2) or (b3) as follows: (b1) protein consisting of amino acid residues from 28 th to 199 th in a sequence 1 of a sequence table; (b2) 1 to 199 amino acid residues in a sequence 1 of a sequence table; (b3) a protein shown in a sequence 1 in a sequence table. The invention also protects the specific protein. The specific protein of the invention can promote lymphocyte proliferation, inhibit the growth of pathogenic microorganisms, promote the secretion of specific antibodies, promote the secretion of mucosal antibodies and improve the immunocompetence and survival rate of animals.

Description

Preparation and application of chicken interleukin 17B recombinant lactobacillus immune preparation

Technical Field

The invention belongs to the technical field of biology, and particularly relates to preparation and application of a chicken interleukin 17B recombinant lactobacillus immune preparation.

Background

Livestock and poultry intensive breeding plants are the main sources of livestock products in the market. With the global population growth, the demand for livestock and poultry products has also increased year by year. The annual chicken consumption worldwide accounts for about 40% of all meat products, with direct economic benefits of hundreds of billions of dollars.

Chickens are usually kept in an intensive environment conducive to infection by opportunistic pathogens. A major problem facing the poultry industry is that due to the reduced productivity caused by disease, large amounts of resources must be utilized to maintain the health of the animals. Vaccines and antibiotics (particularly antibiotics) are mainly used to control diseases. Conventional inactivated vaccines and live attenuated vaccines are not effective in inactivating certain pathogenic bacteria, including conventional IBV vaccines due to their variability, etc. Therefore, novel vaccines such as DNA vaccines, RNA vaccines, and polyepitope vaccines have become hot spots for vaccine research.

However, conventional adjuvants do not significantly enhance the humoral and cellular immunity of these novel vaccines. The most common veterinary vaccine adjuvants currently licensed on the market are aluminium gel adjuvants and oil emulsion adjuvants. Due to their safety, aluminum hydroxide (aluminum) adjuvants have been commonly used in many veterinary and human vaccines; the few cell-mediated immunity, particularly cytotoxic T cell responses, induced by the aluminous gel adjuvant, however, is a significant drawback for its use as a vaccine against intracellular parasites and certain viruses; in addition, the alumina gel adjuvant has a tendency to induce IgE-mediated immune response and may promote IgE-mediated allergic response. The use of oil emulsion adjuvants is limited by the side and adverse effects they produce; for example, the oil emulsion adjuvant CFA can cause inflammation, ulceration, and fever and allergic reactions at the injection site. The appearance quality of poultry meat is very important for poultry breeding industry, and the adverse reactions of vaccine injection points of immunized chickens caused by the aluminum gel adjuvant and the oil emulsion adjuvant can affect the appearance quality of the meat, cause discomfort of animals and are not beneficial to the welfare of the animals. The poultry vaccine industry therefore needs effective adjuvants that meet the need for an adjuvant that will not cause pain to the poultry nor cause a reduction in the quality of the poultry meat. Moreover, the abuse of antibiotics in livestock and poultry farming poses a great threat to the environment and human survival. In china, the government prohibited the addition of antibiotics to feed since 1 month 1 of 2020. Therefore, the additive or the therapeutic drug is urgently needed to be found to replace antibiotics for livestock and poultry breeding. Cytokine (CK) is a low molecular weight soluble protein that is synthesized and secreted by immune cells and some non-immune cells. After the cell factor is combined with the specific receptor, the gene expression of the cell factor network can be activated, and the immune function can be regulated. Thus, cytokines are considered to be highly potent and present only few side effects.

Disclosure of Invention

The invention aims to provide preparation and application of a chicken interleukin 17B recombinant lactobacillus immune preparation.

The invention provides application of specific protein, which is (a1) or (a 2):

(a1) preparing an immunopotentiator;

(a2) as an immune enhancer;

the specific protein is (b1) or (b2) or (b3) as follows:

(b1) protein consisting of amino acid residues from 28 th to 199 th in a sequence 1 of a sequence table;

(b2) 1 to 199 amino acid residues in a sequence 1 of a sequence table;

(b3) a protein shown in a sequence 1 in a sequence table.

The invention also provides an application of the specific recombinant bacterium, which is (a1) or (a 2):

(a1) preparing an immunopotentiator;

(a2) as an immune enhancer;

the specific recombinant strain is a recombinant strain for expressing the specific protein.

The specific recombinant bacteria are obtained by introducing specific DNA molecules or recombinant plasmids with the specific DNA molecules into a spawn-running bacteria; the specific DNA molecule is a DNA molecule for expressing the specific protein.

The starting bacterium can be lactobacillus plantarum.

The starting bacterium can be lactobacillus plantarum NC 8.

The specific recombinant bacterium can be specifically a recombinant lactobacillus plantarum NC8 obtained by introducing a recombinant plasmid pMG36e-rChIL17B into the lactobacillus plantarum NC8, and is named as a recombinant bacterium NC8-ChIL 17B. And replacing small fragments in SalI and SphI enzyme digestion recognition sequences in the pMG36e vector with double-stranded DNA molecules shown in a sequence 2 in a sequence table to obtain a recombinant plasmid pMG36e-rChIL 17B.

The fermentation product of the specific recombinant bacterium or the total thallus protein of the specific recombinant bacterium is applied as follows (a1) or (a 2):

(a1) preparing an immunopotentiator;

(a2) can be used as immunopotentiator.

The invention also provides the application of the vaccine and the immunopotentiator in the preparation of products;

the immunopotentiator is (c1), (c2), (c3) or (c4) as follows:

(c1) the specific protein;

(c2) the specific recombinant bacteria;

(c3) the fermentation product of the specific recombinant bacteria;

(c4) the total thallus protein of the specific recombinant bacteria.

In particular, the vaccine may be an IBV H120 vaccine.

The product has the function of preventing and/or treating infectious bronchitis of chicken.

The invention also protects specific proteins, which are (b1), (b2) or (b 3):

(b2) 1 to 199 amino acid residues in a sequence 1 of a sequence table;

(b3) a protein shown in a sequence 1 in a sequence table.

The invention also protects a specific DNA molecule, an expression cassette containing the specific DNA molecule, a recombinant vector containing the specific DNA molecule or a recombinant microorganism containing the specific DNA molecule; the specific DNA molecule is a DNA molecule for coding the specific protein.

The specific DNA molecule can be specifically a DNA molecule shown in a sequence 2 of a sequence table.

The recombinant vector can be specifically a double-stranded DNA molecule shown in a sequence 2 of a sequence table, which is obtained by replacing small fragments in SalI and SphI enzyme digestion recognition sequences in a pMG36e vector, so as to obtain a recombinant plasmid pMG36e-rChIL 17B.

The recombinant microorganism is obtained by introducing the specific DNA molecule or a recombinant plasmid having the specific DNA molecule into a starting microorganism.

The starting microorganism can be specifically lactobacillus plantarum.

The starting microorganism can be lactobacillus plantarum NC 8.

The recombinant microorganism can be specifically a recombinant lactobacillus plantarum NC8 obtained by introducing a recombinant plasmid pMG36e-rChIL17B into the lactobacillus plantarum NC8, and is named as recombinant bacterium NC8-ChIL 17B.

The invention also protects the fermentation product of the recombinant microorganism.

The invention also protects the total protein of the recombinant microorganism.

The invention also protects the product A. The product A contains the specific protein, the specific DNA molecule, the expression cassette, the recombinant vector, the recombinant microorganism, a fermentation product of the recombinant microorganism or the total protein of the recombinant microorganism. The product is an immunopotentiator.

The invention also protects the product B. The product B contains vaccine and immunopotentiator; the immune enhancer is the specific protein, the specific DNA molecule, the expression cassette, the recombinant vector, the recombinant microorganism, a fermentation product of the recombinant microorganism or the total protein of the recombinant microorganism. In particular, the vaccine may be an IBV H120 vaccine. The product has the function of preventing and/or treating infectious bronchitis of chicken.

The application of the immunopotentiator is specifically to improve the animal immunity. The animal is a non-human animal or a human.

The immune promoter is used for promoting the expression of immune related genes. The immune related gene can be any one or combination of the following genes: NF-kappa B, MyD88, SOCS-1, STAT1, IL-1 beta, IL-12p40, IL-4, IL-6, IL-10, INF-alpha, IFN-beta, TGF-beta 4, CCL-3, CCL-20, and LITAF.

The animal immunity improving effect is at least one of the following M1-M5:

m1, inhibiting the growth of pathogenic microorganisms;

m2, promoting increase of immune cells;

m3, promoting vaccine-induced immune responses;

m4, promoting cellular and/or humoral immunity;

m5, improving animal development and growth weight gain.

The pathogenic microorganism is specifically avian infectious bronchitis virus.

The animal may in particular be an avian species, such as a chicken.

The fusion protein rChIL17B molecule and the fermentation product of the recombinant bacteria expressing the rChIL17B gene provided by the invention have the following functions: promoting the proliferation of animal lymphocyte, the lymphocyte content in the animal body which is applied with rChIL17B can be increased by more than 10 percent; obviously inhibit the growth of pathogenic microorganisms, and the amount of the pathogenic microorganisms applied with rChIL17B can be reduced by more than 20 percent; promoting the secretion of specific antibodies (IgG and IgA) and non-specific sIgA, and increasing the content of specific antibodies and disease-specific antibodies in the animal body to which rChIL17B is applied by 40-60%; promote the expression of immune related genes, further improve the immune anti-infection capacity of animals, obviously improve the virus-attacking survival rate of the animals which are applied with rChIL17B by at least 60 percent, and increase the growth and weight percentage by more than 10 percent. Experiments prove that the rChIL17B can promote lymphocyte proliferation, inhibit the growth of pathogenic microorganisms, promote the secretion of specific antibodies, promote the secretion of mucosal antibodies, and improve the immunocompetence and survival rate of animals.

Drawings

FIG. 1 is a schematic structural diagram of recombinant plasmid pMG36e-rChIL 17B.

FIG. 2 is an electrophoretogram of mRNA level detection in example 1.

FIG. 3 is an electrophoretogram of the protein level detection in example 1.

FIG. 4 shows the results of the fluorescent quantitative PCR in example 2.

FIG. 5 shows the result of step one in example 3.

FIG. 6 shows the result of the measurement of the humoral immune index in example 4 (measured by IBV-specific antibody ELISA kit).

FIG. 7 shows the result of the measurement of the humoral immune index of example 4 (measured by ELISA kit corresponding to the chicken-derived cytokines IL-2, IL-4, IL-6 and IFN-. gamma.).

FIG. 8 shows the results of mucosal immunity index test in example 4.

FIG. 9 shows the results of the measurement of cellular immunity index in example 4 (change of CD4+ T cells and CD8+ T cells in peripheral blood lymphocytes).

FIG. 10 shows the results of the cellular immunity index test (expression change of immunity-related gene) in example 4.

FIG. 11 shows the results of the challenge protection test of example 4.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. Unless otherwise stated, the quantitative tests in the following examples were performed in triplicate, and the results were averaged.

rChIL17B concentration (protein concentration) was measured using His-Tag ELISA Kit (His Tag ELISA Detection Kit, King Biotech Co., Ltd., Cat. No.: L00436). pMG36e vector: biovector Inc., cat # Biovector MG36 e. HD11 cell (chicken macrophage): shanghai ze leaf Biotech Co., Ltd. DF-1 cells (chicken fibroblasts): wuhan Punuoise Life technologies, Inc.

DMEM growth solution: fetal bovine serum containing 10% of 56 ℃ inactivated complement and 0.1% of a cyan chain double antibody were used in a DMEM basal medium. Maintenance liquid: fetal bovine serum containing 2% of 56 ℃ inactivated complement and 0.1% of a cyan chain double antibody were used in a DMEM basal medium.

Lactobacillus plantarum NC8, described in the following documents: comparing the effect of lactobacillus plantarum NC8 on chick T lymphocytes by nasal drip and oral administration; liuyuyin, Yang waves, Zhao Liang, Yang Guilian, Wang Chun Feng; china veterinary journal 2017 (volume 53), phase 1.

Infectious bronchitis virus B strain (IBV B strain) (IBV Beaudette strain) is described in the following documents: infections bronchis Virus Infection introduction Replication in Chicken macro HD11 Cells; xiaooxino Han, Yiming Tian, Ru Guan, Wenqian Gao, Xin Yang, Long Zhou, honging Wang. [ J ]. Virus, 2017,9(8): 198.

Infectious bronchitis virus M41 strain (IBV M41 strain), described in the following documents: constructing reverse genetic strains of the avian infectious bronchitis virus M41 strain; plum, xu xin, wu dong, ji gao, yangxin and wanghong ning; basic science, Chinese veterinary Abstract, 2015, volume 31, phase 5.

When the expression quantity of the gene is detected by fluorescence quantitative PCR, the reference gene adopted by animal experiments is beta-actin, and the reference gene adopted by cell experiments is GAPDH.

TABLE 1 primer sequences for real-time quantitative PCR

Example 1 preparation of recombinant bacterium

First, fusion protein rChIL17B and design of coding gene thereof

Chicken interleukin 17B, added signal peptide and His₆The label is named as fusion protein rChIL 17B. The fusion protein rChIL17B is shown as a sequence 1 in a sequence table. In the sequence 1 of the sequence table, the 1 st-27 th amino acid residues form a signal peptide, the 28 th-199 th amino acid residues form interleukin 17B, and the 200 th-205 th amino acid residues form His₆And (4) a label.

The gene encoding the fusion protein rChIL17B was named rChIL17B gene.

The DNA molecule shown in the sequence 2 of the sequence table codes the protein shown in the sequence 1 of the sequence table. In the sequence 2 of the sequence table, the 1 st to 81 th sites encode signal peptide, the 82 nd to 597 th sites encode interleukin 17B of chicken, the 598 th site and 615 th sites encode His₆And (4) a label.

Second, construction of recombinant plasmid

And replacing small fragments in SalI and SphI enzyme digestion recognition sequences in the pMG36e vector with double-stranded DNA molecules shown in a sequence 2 in a sequence table to obtain a recombinant plasmid pMG36e-rChIL 17B. The recombinant plasmid pMG36e-rChIL17B was sequence verified. The structural schematic diagram of the recombinant plasmid pMG36e-rChIL17B is shown in figure 1.

Thirdly, preparing recombinant bacteria

The recombinant plasmid pMG36e-rChIL17B is introduced into lactobacillus plantarum NC8 to obtain recombinant lactobacillus plantarum named as recombinant bacterium NC8-ChIL 17B.

The pMG36e vector is introduced into Lactobacillus plantarum NC8 to obtain recombinant Lactobacillus plantarum named as recombinant bacterium NC 8-P.

Fourth, mRNA level detection

1. Selecting a test bacterium (a recombinant bacterium NC8-ChIL17B or a recombinant bacterium NC8-P or lactobacillus plantarum NC8) single colony, inoculating the single colony to 1mL of liquid MRS culture medium containing 10 mug/mL of erythromycin, and standing and culturing at 37 ℃ overnight; then inoculating the strain to a liquid MRS culture medium containing 10 mug/mL of erythromycin at the inoculation amount of 1%, and standing and culturing for 12-16 h; then, the mixture was centrifuged at 4000g for 10min at 4 ℃ to collect the pellet.

2. mRNA level detection

Taking the thalli obtained in the step 1, extracting RNA, and then carrying out reverse transcription to obtain cDNA; taking cDNA as a template, adopting a primer pair consisting of Pe-F and Pe-R to carry out PCR amplification, and then carrying out agarose gel electrophoresis. The electrophoretogram is shown in FIG. 2, lane M represents Marker, lane 1 represents Lactobacillus plantarum NC8, lane 2 represents recombinant bacteria NC8-P, and lane 3 represents recombinant bacteria NC8-ChIL 17B. Only lane 3 shows the specific amplified band.

Pe-F：ATGAAAAAAAAGATTATCTCAGC；

Pe-R：TTAGTGGTGGTGGTGGTGG。

Fifth, protein level detection

1. Inoculating the activated test bacterium (recombinant bacterium NC8-ChIL17B or recombinant bacterium NC8-P) bacterium liquid to a liquid MRS culture medium containing 10 mug/mL of erythromycin at a volume ratio of 1:100, and performing shaking culture at 37 ℃ and 180rpm for 24 hours; centrifuging at 10000g for 5min, and collecting thallus; then treated with lysozyme (working concentration of lysozyme is 1 mg/ml); then carrying out ultrasonic disruption, centrifuging and collecting supernatant fluid, namely the total protein solution. The total protein solution obtained by the recombinant strain NC8-ChIL17B is named as NC8-rChIL17B protein solution. The total protein solution obtained by the recombinant strain NC8-P is named as NC8-P protein solution.

2. The total protein solution obtained in step 1 was subjected to polyacrylamide gel electrophoresis, followed by Western Blot (the primary antibody used was HIS-tag mouse IgG monoclonal antibody), and the results are shown in FIG. 3. Electrophoresis of NC8-rChIL17B protein solution showed a positive protein band of about 20.17kDa, consistent with the predicted size of rChIL 17B. NC8-P protein solution did not show the positive protein band.

Example 2 biological Activity Studies of the fusion protein rChIL17B on Chicken fibroblast cell line

1. The DF-1 cells grown in a T75 cell flask are dispersed by trypsinization and then uniformly spread on 6-well cellsIn the board (about 1.0X 10 for each board)⁶Individual cells) were cultured with DMEM growth medium to a confluency of 70% -80%.

2. After completion of step 1, protein dilutions (to give a system protein concentration of 0.5. mu.g/mL, based on total protein provided by the protein dilutions) were added per well and incubation continued for 2h with supplemented maintenance medium. Cells were harvested at 48h exposure (timed from addition of protein diluent). An equal volume of PBS buffer was used as a PBS control group instead of the protein diluent. At least 3 duplicate wells were set for each treatment at each time point.

And diluting the test protein solution by using PBS buffer solution to obtain a protein diluent. The test protein solution was either the NC8-rChIL17B protein solution prepared in step five of example 1 or the NC8-P protein solution prepared in step five of example 1.

3. And (3) taking the cells obtained in the step (2), extracting total RNA, and then carrying out reverse transcription to obtain cDNA. And (3) carrying out fluorescence quantitative PCR by taking the cDNA as a template to detect the expression regulation and control conditions of each immune related gene. The primer sequences for detecting the respective genes are shown in Table 1. The expression level of each gene was calculated by the geometric mean method and the following formula: relative mRNA expression level 2^-ΔΔCt。

The results of the fluorescent quantitative PCR are shown in FIG. 4. In FIG. 4, PBS represents the PBS control group, NC8-chIL17B represents the NC8-rChIL17B treatment group, and NC8 represents the NC8-P treatment group. Statistical and one-way analysis of variance (ANOVA-Tukey) was performed on the data using GraphPad Prism 6(GraphPad software), with p <0.05, or p < 0.01. Stimulation of DF-1 cells by rChIL17B resulted in significantly higher expression levels of NF-. kappa. B, MyD88, SOCS-1, STAT1, IL-1. beta., IL-12P40, IL-4, IL-6, IL-10, INF-. alpha., IFN-. beta., TGF-. beta.4, CCL-3, CCL-20, and LITAF than in PBS control and NC8-P treated groups (P <0.05 or P < 0.01).

Example 3 Effect of the fusion protein rChIL17B on the proliferation of infectious bronchitis Virus in chickens

First, the effect of fusion protein rChIL17B on the activity of macrophage system of chicken infected by chicken infectious bronchitis virus

1. HD11 cells, which had filled T75 flasks, were dispersed by trypsinization and then inoculated into 96-well plates at approximately 1.0X 10 cells/plate⁶The individual cells were cultured with DMEM growth medium to 70% -80% confluency.

2. The test protein solution was diluted with PBS buffer to give each protein dilution such that the protein concentration was 800ng/mL, 400ng/mL, or 200ng/mL, respectively. The test protein solution was either the NC8-rChIL17B protein solution prepared in step five of example 1 or the NC8-P protein solution prepared in step five of example 1.

3. After completion of step 1, the cells were washed 2 times with PBS buffer, then IBV B strain (MOI 2) was added and the culture was continued for 1.5h with DMEM growth medium, then the protein dilution obtained in step 2 was added and the culture was continued for 24h (protein concentration in the system was 200ng/ml, 100ng/ml or 50ng/ml, respectively, based on the total protein provided by the protein dilution). An IBV control group was set up with an equal volume of PBS buffer instead of protein diluent.

4. After completion of

step

3, 20. mu.L of CCK-8 solution was added to each well and incubation was continued for 0.5-4 hours. Blank control wells were set with no cells added and CCK8 only.

5. After completion of step 4, the absorbance was measured at a wavelength of 450nm with a microplate reader. According to OD₄₅₀Values calculate the percent inhibition of cells in each well, with lower ratios indicating better cell activity. Percent (%) inhibition of cell activity (PBS control OD)₄₅₀Experimental group OD₄₅₀) /(PBS control OD₄₅₀Blank group OD₄₅₀)×100。

At least 3 multiple wells were set for each treatment.

The results are shown in FIG. 5. In FIG. 5, IBV represents the IBV control group, NC8-P + IBV represents the NC8-P test group, and NC8-rChIL17B + IBV represents the NC8-rChIL17B test group. The total protein concentration in the system was 200ng/ml (wherein rChIL17B concentration was 220pg/ml) compared to the IBV control group, resulting in a significant reduction in the inhibition of cell activity, with a very significant difference (p < 0.01). The inhibition of cell activity increased with decreasing protein concentration, indicating that the inhibition of IBV by the fusion protein rChIL17B is dose-dependent.

Second, the effect of the fusion protein rChIL17B on the proliferation titer of IBV on HD11 cells

1. The HD11 cells which had filled the T75 flask were digested and dispersed with pancreatin, and the whole wasUniformly inoculated into 6-well plates, approximately 1.0X 10 per plate⁶The individual cells were cultured with DMEM growth medium to 70% -80% confluency.

2. After completion of step 1, the cells were washed 2 times with PBS buffer, then IBV B strain (MOI 2) was added and the culture was continued for 1.5h with DMEM growth medium, then protein diluent was added and the culture was continued for 24h (protein concentration in the system was 200ng/ml, based on total protein provided by the protein diluent). A PBS control group was set up with an equal volume of PBS buffer instead of IBV strain B. An IBV control group was set up with an equal volume of PBS buffer instead of protein diluent.

At least 3 multiple wells were set for each treatment.

3. After the step 2 is finished, repeatedly freezing and thawing twice at minus 80 ℃, collecting cells and supernatant after freezing and thawing, namely the virus solution to be tested, and testing TCID₅₀And (4) poison price.

The specific method for determining the toxic price comprises the following steps: virus solution was diluted in 10-fold gradient and seeded into 96-well cell plates full of approximately 70% HD11 cells, 6 replicates per dilution; culturing at 37 deg.C, recording lesion hole number every day, culturing for 72 hr, determining final lesion hole number, and measuring TCID by Reed-Muench method₅₀(ii) a After repeating the measurement 3 times, statistics were performed by One-way ANOVA multiple comparisons.

The results are shown in Table 2. IBV stands for IBV control group, PBS stands for PBS control group, NC8-P + IBV stands for NC8-P test group, NC8-rChIL17B + IBV stands for NC8-rChIL17B test group. TCID of PBS control group₅₀Is 0; TCID of IBV control group₅₀6.58, the difference was significant (P + IBV group) compared with NC8-P +<0.05), indicating that NC8-P protein solution can inhibit IBV proliferation on HD11 cells. NC8-rChIL17B + IBV group, total protein concentration in system 200ng/ml (wherein rChIL17B concentration is 220pg/ml), TCID₅₀The values were lower, and the difference was very significant compared to the NC8+ IBV group (p)<0.01), indicating that the fusion protein rChIL17B can obviously inhibit the proliferation of IBV B strain on HD11 cells.

TABLE 2 variation of the proliferative Titers of IBV on HD11 cells under different treatment conditions

	Lg TCID₅₀/ml
		PBS
	0
		IBV	6.58±0.11^c
NC8-P+IBV	6.08±0.11^B
		NC8-ChIL17B+IBV	4.65±0.05^A

The different capitalized letters show significant differences, p < 0.01; different lower case letters indicate significant difference, p < 0.05.

Example 4 immunomodulating Effect of recombinant bacteria NC8-ChIL17B on avian infectious bronchitis Virus vaccines

Firstly, preparation of NC8-ChIL17B bacterial liquid

Inoculating the activated recombinant strain NC8-ChIL17B into 50ml of liquid MRS culture medium, standing and culturing at 37 ℃ for 24h, then centrifuging at 4000g for 10min, and collecting thalli; the cells were washed 2 times with cold sterile PBS buffer and resuspended in 5X 10 cell concentration in cold sterile PBS buffer⁹CFU/mL, obtaining NC8-ChIL17B bacterial liquid, and storing on ice for later use.

Secondly, preparing NC8-P bacterial liquid

Inoculating the activated recombinant strain NC8-P into 50ml of liquid MRS culture medium, standing and culturing at 37 ℃ for 24h, then centrifuging at 4000g for 10min, and collecting thalli; the cells were washed 2 times with cold sterile PBS buffer and resuspended in 5X 10 cell concentration in cold sterile PBS buffer⁹CFU/mL to obtain NC8-P bacterial liquid, and storing on ice for later use.

Grouping and immunizing SPF chickens

SPF chicks were hatched from SPF white leghorn chick embryos purchased from Beijing Burlinger Invrigjon Biotechnology, Inc. The SPF chicks were transferred to SPF isolators for feeding and immunization. IBV vaccines are collectively known as IBV H120 vaccines (IBV H120 oral attenuated vaccines, lyophilisates): sichuan China derivative engineering group, Inc.; the using method comprises the following steps: diluting to 10% with sterile PBS buffer⁸EID₅₀mL, now ready for use, stored on ice, with a single use dose of 200 μ L per chicken.

The test bacterial liquid is NC8-ChIL17B bacterial liquid prepared in the first step or NC8-P bacterial liquid prepared in the second step.

Immunization procedure: at 7 days of age, simultaneously orally taking test bacteria liquid and IBV H120 vaccine; when the strain is 14 days old, the test bacterial liquid is orally taken; at the age of 21 days, simultaneously orally taking test bacteria liquid and IBV H120 vaccine; at 28 days of age, the test bacterial liquid is orally taken; at the age of 34 days, the test bacterial liquid is orally taken.

The grouping is shown in table 3. Each group of 10 feather SPF chicks is divided into 4 groups equally by adopting a random grouping mode.

TABLE 3 grouping of SPF chickens

Numbering	Packet description	Immunization dose
			A	NC8-ChIL17B + IBV group	NC8-ChIL17B bacterial liquid (1X 10)⁹CFU)/feather/time +200 μ L IBV H120 vaccine/feather/time
B	NC8-P + IBV group	NC8-P bacterial liquid (1X 10)⁹CFU)/feather/time +200 μ L IBV H120 vaccine/feather/time
			C1	IBV control group	200 μ L PBS buffer/feather/time +200 μ L IBV vaccine/feather/time
C2	PBS control group	200 μ L PBS buffer/feather/min

Evaluation was performed according to the index in table 4.

TABLE 4 evaluation index of immunopotentiating effect

Fourth, evaluation results of respective indices

1. Change in weight gain

Net weight gain was calculated from time 0 body weight (body weight before immunization on day of prime) and 28 days after prime. The results are shown in Table 5. Chicks in the NC8-ChIL17B + IBV group gained more weight than chicks in the NC8-P + IBV group 28 days after priming (P < 0.0001).

Table 5 average weight gain statistics for immunized 28d chickens (n 10)

Grouping	Initial body weight (g)	Final body weight (g)	Net weight gain (g)
				PBS control group	62.0±0.761^b	360.0±5.791	298.0±2.631^c
IBV control group	61.0±0.955^b	350.0±5.924	294.0±3.166^c
				NC8-P + IBV group	67.0±0.494^a	375.0±4.292	309.0±2.252^b
NC8-IL17B + group IBV	66.0±0.471^a	380.0±7.263	314.0±2.974^a

2. Humoral immunity index

Blood was collected through the infrawinged vein at time 0 (day before immunization of the prime) and 7, 14, 21 and 28 days after the prime, left to stand at 37 ℃ for 1h, and then left overnight at 4 ℃ and centrifuged to take serum, which was frozen at-20 ℃.

The detection was carried out using an IBV-specific antibody ELISA detection kit (IDEXX, cat. No. 99-09262). The results are shown in FIG. 6. The results were statistically calculated as the average S/P value + s.d for each group. The threshold value is 0.2. S/P ═ sample a (650) -NC a (650) ]/[ sample a (650) -NC a (650) ]. Tukey's multiple comparison test for statistics; p <0.05, p < 0.01. The S/P values of the IBV specific antibodies of the IBV control group, NC8-P + IBV group and NC8-ChIL17B + IBV group are all greater than 0.2 starting on day 7 after the first immunization, which indicates that the IBV vaccine induces the body to produce the antibodies. During the immunization period, the IBV-specific antibody titer of the NC8-ChIL17B + IBV group was significantly higher than that of the IBV control group and the NC8-P + IBV group, with P <0.05 at days 7 and 28 and P <0.01 at days 14 and 21. IBV-specific antibody levels were highest 14 days after first immunization.

The concentration changes of the cytokines IL-2, IL-4, IL-6 and IFN-gamma in serum samples at the time 0 (before the day of immunization of the prime) and at the days 14 and 28 after the prime are detected by ELISA kits corresponding to the chicken-derived cytokines IL-2, IL-4, IL-6 and IFN-gamma (Shanghai prefers Biotechnology Co., Ltd., IL-2 is YX-091202C, IL-4 is YX-091204C, IL-6 is YX-091206C and IFN-gamma is YX-090617C). The results are shown in FIG. 7. In fig. 7, concentrations are shown as mean + s.d for each group; p <0.05, p < 0.01. At time 0, there was no significant difference in the concentrations of IL-2, IL-4, IL-6 and IFN- γ for each group. At 14 and 28 days post prime: the IL-2 concentration of NC8-ChIL17B + IBV group was significantly higher than that of the IBV control group and NC8-P + IBV group (P < 0.05); the IL-2 concentrations in the IBV control group and NC8-P + IBV group were also significantly higher than in the PBS control group. In addition, the NC8-ChIL17B group had significantly elevated IL-4, IL-6 and IFN- γ concentrations at 14 and 28 days post priming compared to the IBV control, NC8-P + IBV and PBS control groups.

3. Index of mucosal immunity

28 days after first immunization, some experimental chickens were killed by taking blood from the heart, respectively taking fresh trachea and intestinal tract (containing Peyers' patch) each 8cm, placing on ice, repeatedly irrigating with 1mL of cold PBS buffer solution containing protease inhibitor, centrifuging at 4 ℃ and 10000g for 10min, and collecting supernatant, namely the lavage solution containing mucosal antibody. Storing at-20 deg.C for use.

And (3) detecting the content of the total sIgA antibody in the lavage fluid by adopting a chicken sIgA antibody detection kit (based on a direct sandwich ELISA principle).

The method for detecting the titer of the IBV specific mucosal antibody sIgA comprises the following steps: adding the obtained lavage fluid into an ELISA plate (Shanghai preferably Biotech Co., Ltd., product number YX-090814C) coated with IBV specific antigen (each well is 100 mu L), repeating 3 wells for each sample, incubating at 37 ℃ for 1h, washing for 5 times, drying for the last time, adding HRP-labeled goat anti-chicken IgA antibody (each well is 100 mu L) diluted at 1:2000, incubating at 37 ℃ for 1h, washing for 5 times, drying, adding substrate developing solution, incubating at room temperature for 10min, and reading absorbance OD at 630nm wavelength with an ELISA reader₆₃₀。

The results are shown in FIG. 8. In fig. 8, total sIgA concentrations (a, b), IBV-specific sIgA titers (c, d); mucosal antibody concentrations and titers are shown as mean + s.d for each group; statistics were multiplexed by Tukey, # p <0.05, # p < 0.01. In the trachea, the total sIgA and IBV specific sIgA of NC8-ChIL17B + IBV group are significantly higher than those of the IBV control group and NC8-P + IBV group. In the intestinal tract, the total sIgA and the IBV specific sIgA of the NC8-ChIL17B + IBV group are obviously higher than those of the control group. There was no significant difference in tracheal and intestinal total sIgA and IBV-specific sIgA concentrations between the IBV control group and NC8-P + IBV group.

4. Cellular immunity index

(1) Changes in CD4+ T cells and CD8+ T cells in peripheral blood lymphocytes

After priming, 14d and 28d, respectively, were treated with a 1: 9 the injection syringe added with anticoagulant sodium citrate is used for collecting the blood of the infrawing veins of experimental chickens, the mixture is placed on ice after being mixed evenly, and the Peripheral Blood Lymphocytes (PBLC) are separated by adopting a chicken peripheral blood lymphocyte separation kit of TBD company.

Peripheral blood lymphocytes were taken and analyzed by FACScan flow cytometry (the experimental data obtained were analyzed by flowjo7.6.1 software) to obtain the content of CD4+ T cells and CD8+ T cells in peripheral blood lymphocytes. The results are shown in FIG. 9. In fig. 9: (a) the percentage of experimental chicken peripheral blood CD4+ T cells, (b) the percentage of experimental chicken peripheral blood CD8+ T cells; (c) CD4+/CD8+ ratio; carrying out statistics on Tukey's multiple comparison; p <0.05, p < 0.01. Chicks of the NC 8-chll 17B + IBV group were significantly upregulated in both CD4+ T cells and CD8+ T cells (P <0.001) compared to the IBV control group and NC8-P + IBV group at 14 and 28 days post-priming.

(2) Change of expression of immune-related Gene in tissues of immunized Chicken (QPCR)

On day 28 after prime, 4 experimental chickens were sacrificed by heart blood sampling, the state of the organs and tissues of the chickens was observed to evaluate safety, and Thymus (Thymus) and Cecum tonsil (Cecum tonsil) were immediately frozen in liquid nitrogen.

0.1g of tissue was taken and added to 1mL of precooled PBS buffer, and after grinding and homogenization, 200. mu.L of tissue homogenate was added to Trizol solution, RNA was extracted, and then reverse transcription was performed to obtain cDNA. And (3) carrying out real-time quantitative PCR by taking the cDNA as a template so as to analyze the immunoregulation effect of the test bacteria on the IBV vaccine at the cellular immunity level.

In FIG. 10, Tukey' multiple comparisons are used for statistics; p <0.05, p < 0.01. The results show that the expression of the cytokines IL-1 beta, IL-6 and BCL-6 of the NC8-ChIL17B + IBV group is significantly higher than that of the other groups, with p <0.05 or p < 0.01. The expression of IL-22 is of great significance for the formation of mucosal barriers. In the thymus, IL-22 was significantly elevated (P <0.05) in NC8-ChIL17B + IBV, NC8-P + IBV and IBV control groups compared to PBS control group, but there was no significant difference between the three groups. In the caecum tonsils, the expression of NC8-ChIL17B + IBV group IL-22 was significantly higher than that of the 3 control groups (p < 0.05). The expression levels of TLR-3 and TLR-7 in thymus and caecum tonsils of NC8-ChIL17B + IBV group were significantly higher than those of the other 3 control groups (p <0.05 or p < 0.01). The expression of the cytokine TGF-beta 4 involved in maintaining immune balance in the NC8-ChIL17B + IBV group was also significantly higher than in the three control groups (thymic p <0.05, caecal tonsil p < 0.01). Compared with a control group, the NC8-ChIL17B + IBV group memory CD8+ T cell marker CD127 is obviously up-regulated (thymic p is less than 0.01, and cecum tonsil p is less than 0.05), and the thymic gene expression fold is higher than that of the cecum tonsil.

5. Challenge protection test

At 35 days of age, strain IBV M41 was challenged. The immunized chicken flocks are weighed and then treated with IBV M41 strain by nasal drip, eye drip and mouth dripThe medicine is taken to counteract toxic substance (one third of the volume is administered in nose, one third of the volume is administered in eye, and one third of the volume is administered orally), and the dose of counteracting toxic substance is 1mL EID per feather₅₀Is 10^5.8IBV M41 strain (1). The conditions of the chicken flocks including the conditions of food intake and drinking and whether IBV infection symptoms such as cough, asthma and the like exist are observed in the morning and at night every day. After 10 days of virus challenge, weighing all chickens, killing all chickens, observing whether the IBV target organs have histopathological changes or not, and collecting tissue samples. Tissue samples included lung, liver, spleen, kidney, bursa of Fabricius, and Tracheal Lymph Nodes (TLNs).

Immediately after tissue collection, the tissue was frozen in liquid nitrogen, and 0.1g of tissue sample was added to 0.5. mu.L of cold PBS buffer and homogenized. 200. mu.L of homogenate was added to 800. mu.L of Trizol solution to extract RNA, and cDNA was obtained by reverse transcription. Taking 1 mu L of cDNA (one tenth of total RNA) as a template, simultaneously finding a gene segment with more base difference between the IBV M41 strain and the vaccine IBV H120 according to genome sequences of IBV M41(GenBank accession number AY851295.1) and IBV H120(GenBank accession number FJ888351.1), designing primers capable of identifying M41 and H120 according to the difference gene segment, and using the primers for RT-QPCR. Primer P_IBV-F/P_IBV-R is biosynthesized by Chengdu Onystoloni.

P_IBV-F 5’-ACGGATTCAGGTGATGCTGAGG-3’；

P_IBV-R 5'-TTTGTTACTTGCCGGGTCTTGTGT-3'。

The standard plasmid is obtained by inserting a DNA molecule shown in a sequence 3 of a sequence table into a pMD18-T vector. Standard curve equations were prepared using standard plasmids. The standard curve equation is that y is 3.2771x +37.947, E is 102.0%, R²＝0.9971。

The IBV M41 viral load in each tissue was measured and six replicates were run for each sample.

Statistics were performed using multiple t-tests, p <0.05, p < 0.01.

The results are shown in FIG. 11. The mean IBV M41 copy number of the immunized groups IBV, NC8-P + IBV and NC8-ChIL17B + IBV was significantly reduced compared to the PBS control group (P < 0.01). The average IBV M41 copy number of the trachea, the lung, the spleen, the kidney and the bursa of Fabricius in the NC8-ChIL17B + IBV group is extremely remarkably or extremely remarkably reduced compared with that of a control group.

Under challenge with virulent IBV strains, the PBS control group of chickens developed significant cough and asthma in the morning. However, no significant symptoms were observed in the IBV group, the NC8-P + IBV group and the NC8-ChIL17B + IBV group.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> Sichuan university

<120> preparation and application of chicken interleukin 17B recombinant lactobacillus immune preparation

<130> GNCYX212278

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 205

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Lys Lys Lys Ile Ile Ser Ala Ile Leu Met Ser Thr Val Ile Leu

1 5 10 15

Ser Ala Ala Ala Pro Leu Ser Gly Val Tyr Ala Met Val Leu Val Pro

20 25 30

Glu Ala Lys Asp Glu Ser Arg Ala Ala Lys Gly Arg Arg Arg Gly Pro

35 40 45

Ser Arg Leu Pro Thr Ala Ala Ser Ala Leu Ala Trp Ala Pro Asp Asp

50 55 60

Pro Tyr Thr Pro Met Glu Asp Tyr Glu Arg Ser Ile Gln Asp Met Val

65 70 75 80

His Gln Leu Arg Asn Gly Ser Glu Pro Gly Asp Thr Lys Cys Gln Val

85 90 95

Asn Leu Arg Leu Trp Arg Ser Asn Arg Arg Ser Leu Ser Pro Trp Ala

100 105 110

Tyr Ser Ile Asn His Asp Ala Thr Arg Ile Pro Ala Asp Ile Pro Glu

115 120 125

Ala Arg Cys Leu Cys Thr Gly Cys Ile Asn Pro Phe Thr Met Gln Glu

130 135 140

Asp Arg Thr Met Ala Ser Ile Pro Ile Tyr Ser Arg Leu Pro Val Arg

145 150 155 160

Arg Leu Leu Cys Gln Ala Pro Gly Lys Val Gly His Lys Ala Ser Gly

165 170 175

Arg Lys Lys Cys His Lys Lys Tyr Gln Thr Val Met Glu Thr Ile Ala

180 185 190

Val Gly Cys Thr Cys Ile Phe His His His His His His

195 200 205

<210> 2

<211> 618

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgaaaaaaa agattatctc agctatttta atgtctacag tgatactttc tgctgcagcc 60

ccgttgtcag gtgtttacgc tatggtttta gttccagaag ccaaggatga aagccgtgca 120

gccaagggtc gtcgtcgtgg cccttcacgg ttaccaacgg ccgcttcagc cttagcctgg 180

gccccagatg acccatacac tccaatggaa gactacgaac gcagcatcca agacatggtt 240

caccaattac gtaatggctc agaaccaggc gacaccaagt gccaagtcaa cttacggtta 300

tggcgttcaa accgccgtag cttatcacca tgggcctaca gcatcaacca cgatgccacg 360

cggatcccag cagacatccc agaagcccgg tgcttatgca ctggctgcat caacccattc 420

accatgcaag aagaccgcac catggccagc atcccaatct acagccggtt acctgtccgc 480

cgtttattat gccaagctcc aggcaaggtt ggtcacaagg cctcaggtcg taagaagtgt 540

cacaagaagt accaaacggt catggaaacc atcgctgttg gctgcacttg catcttccac 600

caccaccacc accactaa 618

<210> 3

<211> 403

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cgatgatgac atcgaggaag aagatgcaga agaatgtgac acggattcag gtgatgctga 60

ggagtgtgac actaatttag aatgtgaaga agaagatgag gatactaaag tgttggctct 120

tatacaagac ccggcaagta acaaatatcc tctgcctctt gatgatgatt atagcgtcta 180

taatggatgt attgttcata aggacgctct cgatgttgtg aatttaccat ctggtgaaga 240

aacctttgtt gtcaataact gctttgaagg ggctgttaaa gctcttccgc agaaagttat 300

tgatgttcta ggtgactggg gtgaggctgt tgatgcgcaa gaacaattgt gtcaacaaga 360

atcaactcgg gtcatatctg agaaatcagt tgagggtttt act 403

Claims

1. The specific protein is used as (a1) or (a 2):

(a1) preparing an immunopotentiator;

(a2) as an immune enhancer;

the specific protein is (b1) or (b2) or (b3) as follows:

(b2) 1 to 199 amino acid residues in a sequence 1 of a sequence table;

(b3) a protein shown in a sequence 1 in a sequence table.

2. The specific recombinant bacteria are applied as follows (a1) or (a 2):

(a1) preparing an immunopotentiator;

(a2) as an immune enhancer;

the specific recombinant bacterium is a recombinant bacterium for expressing the specific protein in claim 1.

3. Use according to claim 2, characterized in that:

the specific recombinant bacteria are obtained by introducing specific DNA molecules or recombinant plasmids with the specific DNA molecules into a spawn-running bacteria; the specific DNA molecule is a DNA molecule expressing the specific protein described in claim 1.

4. The use of the fermentation product of the specific recombinant bacterium of claim 2 or 3 or the total protein of the recombinant bacterium of claim 2 or 3 as follows (a1) or (a 2):

(a1) preparing an immunopotentiator;

(a2) can be used as immunopotentiator.

5. The application of vaccine and immunopotentiator in preparing product;

the immunopotentiator is (c1), (c2), (c3) or (c4) as follows:

(c1) the specific protein of claim 1;

(c2) the specific recombinant bacterium according to claim 2 or 3;

(c3) a fermentation product of the specific recombinant bacterium described in claim 2 or 3;

(c4) total protein of a recombinant bacterium according to claim 2 or 3.

6. The use of claim 5, wherein:

the vaccine is IBV H120 vaccine;

7. The specific protein is (b1) or (b2) or (b3) as follows:

(b2) 1 to 199 amino acid residues in a sequence 1 of a sequence table;

(b3) a protein shown in a sequence 1 in a sequence table.

8. A specific DNA molecule, an expression cassette containing the specific DNA molecule, a recombinant vector containing the specific DNA molecule, or a recombinant microorganism containing the specific DNA molecule; the specific DNA molecule is a DNA molecule encoding the specific protein according to claim 7.

9. A fermentation product or total protein of the recombinant microorganism of claim 8.

10. Product A or product B;

the product A contains the specific protein of claim 7, the specific DNA molecule of claim 8, the expression cassette of claim 8, the recombinant vector of claim 8, the recombinant microorganism of claim 8, the fermentation product of the recombinant microorganism of claim 8, or the total protein of the recombinant microorganism of claim 8;

the product B contains vaccine and immunopotentiator; the immune enhancing agent is the specific protein of claim 7, the specific DNA molecule of claim 8, the expression cassette of claim 8, the recombinant vector of claim 8, the recombinant microorganism of claim 8, the fermentation product of the recombinant microorganism of claim 8, or the total protein of the recombinant microorganism of claim 8.