CN113528685A - PCR primer for distinguishing Brucella canis from other Brucella and detection method - Google Patents

PCR primer for distinguishing Brucella canis from other Brucella and detection method Download PDF

Info

Publication number
CN113528685A
CN113528685A CN202110906518.1A CN202110906518A CN113528685A CN 113528685 A CN113528685 A CN 113528685A CN 202110906518 A CN202110906518 A CN 202110906518A CN 113528685 A CN113528685 A CN 113528685A
Authority
CN
China
Prior art keywords
brucella
primer
distinguishing
canis
detection method
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110906518.1A
Other languages
Chinese (zh)
Inventor
刘宝山
陈泽良
沈国顺
刘金玲
韩小虎
张欢
叶银波
杜方原
刘梦志
杨国丽
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenyang Agricultural University
Original Assignee
Shenyang Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenyang Agricultural University filed Critical Shenyang Agricultural University
Priority to CN202110906518.1A priority Critical patent/CN113528685A/en
Publication of CN113528685A publication Critical patent/CN113528685A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a PCR primer for distinguishing brucella canis from other brucella and a detection method, belonging to the technical field of biological detection. The primer comprises: BSU: 5 '-GCAGGTCGTTACCGTCGATC-3'; BCD: 5 '-CAATATCCGCAACGCCTCTTG-3'; BSD: 5 '-CATCAAGCCGCATCGCAGC-3'. The PCR detection method for detecting the Brucella canicola and other Brucella is constructed by utilizing the specific primers, can specifically detect the Brucella canicola and other Brucella, is favorable for distinguishing the Brucella canicola infection types, and can purify, prevent and control brucellosis more effectively.

Description

PCR primer for distinguishing Brucella canis from other Brucella and detection method
Technical Field
The invention relates to the technical field of biological detection, in particular to a PCR primer for distinguishing brucella canis from other brucella and a detection method.
Background
Brucellosis is a zoonosis infectious disease caused by brucella, and quarantine, killing, purification and other measures are mostly implemented in prevention and control of brucellosis, and the quarantine is the key. At present, a plurality of detection methods for detecting brucella and a detection method for distinguishing brucella canis exist, but the methods generally have the problems of complex operation, time consumption and high cost, and are not convenient for quick detection to guide clinic. Therefore, by utilizing a molecular biological method, specific primers are designed according to genome difference base sequences of the Brucella canis and other Brucella strains, identification of the Brucella canis is realized by methods such as PCR (polymerase chain reaction) and the like, and technical support is provided for prevention and control of the Brucella canis in pets. At present, a plurality of detection methods for detecting brucella exist, such as limited fragment length polymorphism (PCR-RFLP), Rep-PCR and ERIC-PCR, rpoB gene polymorphism, multi-site sequencing and typing (MLST), sequencing methods and the like, but the methods generally have the problems of complex operation, time consumption and high cost, and are not convenient for quick detection to guide clinic. Therefore, by utilizing a molecular biological method, specific primers are designed according to genome difference base sequences of the Brucella canis and other Brucella strains, identification of the Brucella canis is realized by methods such as PCR (polymerase chain reaction) and the like, and technical support is provided for prevention and control of the Brucella canis in pets.
Disclosure of Invention
The invention aims to provide a PCR primer and a detection method for distinguishing brucella canis from other brucella, so as to solve the problems in the prior art, specifically detect brucella canis and other brucella, facilitate distinguishing the type and source of brucella canis infection and effectively purify, prevent and control brucella.
In order to achieve the purpose, the invention provides the following scheme:
the invention provides a PCR primer for distinguishing brucella canis from other brucella, which comprises the following sequences:
BSU：5'—GCAGGTCGTTACCGTCGATC—3'；
BCD：5'—CAATATCCGCAACGCCTCTTG—3'；
BSD：5'—CATCAAGCCGCATCGCAGC—3'。
the invention also provides a kit for distinguishing the Brucella canis from other Brucella, which comprises the primer.
The invention also provides a PCR detection method for distinguishing the Brucella canis from other Brucella, which comprises the following steps:
step 1: extracting DNA of a sample to be detected;
step 2: carrying out amplification reaction by using the primer of claim 1 by using the obtained DNA as a template to obtain an amplification product;
and step 3: and detecting the amplification product by using agarose gel electrophoresis, and distinguishing the brucella canis from other brucella according to the electrophoresis detection result.
The sample to be detected can be blood, milk sample, tissue sample, aerosol sample, etc.
Preferably, the amplification reaction system comprises the following components: 2 XTaq Master Mix 10. mu.l, 1. mu.l each of BSU primer/BCD primer/BSD primer, 1. mu.l of sample DNA to be tested, and 6. mu.l of ddH2O 6.
Preferably, the reaction procedure is: pre-denaturation at 95 ℃ for 3min, reaction at 95 ℃ for 20s, at 65 ℃ for 20s, and at 72 ℃ for 30s for 35 cycles.
The invention also provides application of the primer or the kit or the detection method in distinguishing the Brucella canicola from other Brucella.
The invention discloses the following technical effects:
(1) in the past, most of brucella canis needs to be subjected to bacterial culture or sequencing after amplification, so that the time consumption is long.
(2) The method provided by the invention can specifically detect other Brucella besides Brucella canis, so that missed diagnosis in the diagnosis process is avoided.
(3) The sequence is designed based on a specific 127bp sequence on the chromosome 1 of the brucella canicola, and the sequence is in inverted repeat in other brucella.
(4) When the detection method is used for detecting the brucella infection of the dog, the infection source can be prompted, the prevention and control measures can be guided, and the human health can be better guaranteed.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.
FIG. 1 shows the results of PCR specificity analysis; m, DL2000 DNAmarker; 1, brucella canis RM 6/66; 2, a 19; 3, S2; 4, M5; 5,2308, respectively; 6,1330, respectively; 7, 16M; 8, a dianweijia 5 vaccine; 9, a maoxiangsanduo vaccine; 10, escherichia coli; 11, salmonella; 12, shigella; 13, pasteurella; 14, hemolytic streptococcus; clostridium perfringens 15; 16, staphylococcus; 17, proteus; 18, candida species; 19, streptococcus pyogenes; 20, pneumococcus; 20, campylobacter jejuni; 21, listeria; 22, pseudomonas aeruginosa; 23, negative control;
FIG. 2 shows the detection results of Brucella in abortive secretions of dogs in example 4; m, DL2000 DNAmarker; 1-20, 20 dog abortion secretion samples; negative control; 6/66 Brucella canis RM 6/66; a19, brucella canis a 19.
Detailed Description
Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.
It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The specification and examples are exemplary only.
As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.
Example 1 PCR detection method for discriminating Brucella canis from other Brucella
1. Primer design
Logging in NCBI website, downloading Brucella canis and other Brucella gene sequences in GenBank, analyzing and comparing, designing primers (shown in Table 1) based on specific gene sequence (SEQ ID NO:4) on Brucella canis No. 1 chromosome, wherein the sequence is in inverted repeat in other Brucella.
TABLE 1 primer sequences
Name (R) Gene sequences
BSU(SEQ ID NO：1) 5'—GCAGGTCGTTACCGTCGATC—3'
BCD(SEQ ID NO：2) 5'—CAATATCCGCAACGCCTCTTG—3'
BSD(SEQ ID NO：3) 5'—CATCAAGCCGCATCGCAGC—3'
The gene sequence shown in SEQ ID NO. 4:
CGCCGGAGGGCAGGTCGTTACCGTCGATCTTGTTCCAGAATTCCACCTGATAAATCTGCGTGGCGGTTGCCTGCGTCAGTTCCTTCACATCCTGCGGCGATACCTGCCGTCCTTCCCATGCGGACAATGTATTGATGGTAATCCCCATATTCGTCGCCCCGCCAGGATCAGCAGGATTGTCGGCATAGCCGCCTTCTTCACTGAAAATATAAGGCATAACCGTCTGGAAATTCCGTTTCATAATTTGCCCCTACTTTAGATTTTGATAAATTATTGAATACTACCGCAGCGCGCCGCGCAAGAGGCGTTGCGGATATTGTCCGCTTTTTTCCGAATTACCTGCCCTGCCGAGGCCGTTGGGAACACCCCTATTCCCTTGCCGGAGCGCCGTGCTACCATACACGTATAGGTAGGGCTTGATGCGTTTATCTCTGGACGGCTTACAGGCAGGCAATCGTGAATTCGGAAATCTTCGGCTATGCGCCGGACGGGCAGGTGGTCCACCGCCTCACTATCTCCAACGGGCCTTTGACCGCAAAGATCATCAATTGGGGCGCAGCCATTCAGGATCTGCGTATGGAAGGCCACCCGGCGCCACTGGTGATCGGCTATCGCGATTTTGCCGATTATCCGGCACATTCCCCGCATCTGGGTGCGATTGCGGGCCGCTCGGCCAACCGTATCTGCAATGCGCGCTTTGATCTTGATGGAACGGTTTACGAGGTGGAGCCGAACTTCCTTGGCTGCCACAATCTGCATGGCGGCAGCAAGGGGCTCGGACACCATGTCTGGAAGATCAC
2. PCR detection method
(1) And extracting the genome of the sample to be detected, wherein the sample to be detected can be blood, milk sample, tissue sample, aerosol sample and the like.
(2) Adding the extracted sample genome as a template into a reaction tube of a system containing reaction liquid and polymerase, and amplifying according to optimized reaction conditions, wherein the specific reaction conditions comprise pre-denaturation at 95 ℃ for 3min, pre-denaturation at 95 ℃ for 20s, pre-denaturation at 65 ℃ for 20s, and pre-denaturation at 72 ℃ for 30s, and 35 cycles.
(3) Amplification was performed using the primers shown in Table 1 to obtain amplification products.
The amplification reaction system is shown in table 2 below:
TABLE 2 reaction System
Components Volume of
2×Ace Taq Master Mix(Dye Plus) 10μl
10 μ M BSU primer 1μl
10 μ M BCD primer 1μl
10 μ M BSD primer 1μl
DNA of sample to be tested 1μl
dd H2O 6μl
Reaction procedure: placing the thin-wall PCR tube containing the reaction solution into a PCR instrument, performing pre-denaturation at 95 ℃ for 3min, and performing reaction at 95 ℃ for 20s, 65 ℃ for 20s and 72 ℃ for 30s for 35 cycles.
The 5ul amplification product obtained above is taken and detected by 1.5% agarose gel electrophoresis, a band with the size of 310bp is amplified by brucella canis, and a band with the size of 413bp is amplified by other brucella.
Example 2 specific identification of Brucella Canitis strains in the laboratory
1. Test sample
Brucella canis RM6/66, Brucella A19, Brucella S2, Brucella M5, Brucella 2308, Brucella 1330, Brucella 16M, Canadian Weijia 5 vaccine, Miaosan vaccine, Escherichia coli, Salmonella, Shigella, Pasteurella, hemolytic streptococcus, Clostridium perfringens, Staphylococcus, Proteus, Candida, Streptococcus pyogenes, pneumococcus, Campylobacter jejuni, Listeria, Pseudomonas aeruginosa. The above strains are from Shenyang agricultural university college of animal science and medicine.
2. Test method
(1) The colonies on the culture plate were picked up, put into 50ul of physiological saline, shaken and mixed well.
(2) Mu.l of the bacterial solution was used as a template to prepare 20. mu.l of a reaction system containing 10. mu.l of 2 × Ace Taq Master Mix (Dye Plus), 1. mu.l of 10. mu.M BSU primer, 1. mu.l of 10. mu.M BCD primer, 1. mu.l of 10. mu.M BSD primer, and ddH2O6 mul, placing the thin-wall PCR tube containing the reaction solution into a PCR instrument, performing pre-denaturation at 95 ℃ for 3min, at 95 ℃ for 20s, at 65 ℃ for 20s, and at 72 DEG C30s reaction for 35 cycles.
(3) Add 5. mu.l of product into the loading hole of 1.5% agarose gel for electrophoresis detection, and use DL1000DNAmarker as molecular weight standard. Observing under an ultraviolet lamp after electrophoresis is finished, and if a band with the size of 310bp appears in a detection sample, indicating that the bacterial colony is brucella canis; if a band of 310bp size did not appear, the colony was not a Brucella canis strain.
As shown in FIG. 1, the Brucella canis showed a bright band at 310bp, the other Brucella showed a significant band at 413bp, and the other conventional bacterial strains showed no band. Therefore, the primer designed by the invention can accurately distinguish the Brucella canis, other Brucella and conventional bacterial strains, has extremely high accuracy, and shows that the primer designed by the invention has specificity.
EXAMPLE 3 determination of sensitivity
Dilution with gradient to 104And (3) amplifying the Brucella canicola RM6/66 strain nucleic acid sample with 1 copy as a template under the amplification condition by using the amplification primers shown in example 1, and finding that the method can detect 100 copies of the template, which indicates that the method has good sensitivity.
Example 4 detection of Brucella in Canine miscarriage secretions
(1) The abortion secretion of dog was dipped with cotton swab and put into trizol to extract DNA.
(2) Mu.l of the extracted DNA was used as a template to prepare 20. mu.l of a reaction system containing 10. mu.l of 2 × Ace Taq Master Mix (Dye Plus), 1. mu.l of 10. mu.M BSU primer, 1. mu.l of 10. mu.M BCD primer, 1. mu.l of 10. mu.M BSD primer, ddH2O6 mul, putting the thin-wall PCR tube containing the reaction solution into a PCR instrument, performing pre-denaturation at 95 ℃ for 3min, and performing reaction at 95 ℃ for 20s, 65 ℃ for 20s and 72 ℃ for 30s for 35 cycles.
(3) 5ul of the product was added to a 1.5% agarose gel loading well for electrophoresis detection, while DL1000DNA Marker was used as a molecular weight standard. Observing under an ultraviolet lamp after electrophoresis is finished, and if a band with the size of 413bp appears in a detected sample, indicating that the abortion secretion does not contain brucella canicola but contains other brucella; if the band with the size of 413bp does not appear, the secretion does not contain brucella.
The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.
Sequence listing
<110> Shenyang agriculture university
<120> PCR primer for distinguishing Brucella canis from other Brucella canis and detection method
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gcaggtcgtt accgtcgatc 20
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
caatatccgc aacgcctctt g 21
<210> 3
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
catcaagccg catcgcagc 19
<210> 4
<211> 800
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cgccggaggg caggtcgtta ccgtcgatct tgttccagaa ttccacctga taaatctgcg 60
tggcggttgc ctgcgtcagt tccttcacat cctgcggcga tacctgccgt ccttcccatg 120
cggacaatgt attgatggta atccccatat tcgtcgcccc gccaggatca gcaggattgt 180
cggcatagcc gccttcttca ctgaaaatat aaggcataac cgtctggaaa ttccgtttca 240
taatttgccc ctactttaga ttttgataaa ttattgaata ctaccgcagc gcgccgcgca 300
agaggcgttg cggatattgt ccgctttttt ccgaattacc tgccctgccg aggccgttgg 360
gaacacccct attcccttgc cggagcgccg tgctaccata cacgtatagg tagggcttga 420
tgcgtttatc tctggacggc ttacaggcag gcaatcgtga attcggaaat cttcggctat 480
gcgccggacg ggcaggtggt ccaccgcctc actatctcca acgggccttt gaccgcaaag 540
atcatcaatt ggggcgcagc cattcaggat ctgcgtatgg aaggccaccc ggcgccactg 600
gtgatcggct atcgcgattt tgccgattat ccggcacatt ccccgcatct gggtgcgatt 660
gcgggccgct cggccaaccg tatctgcaat gcgcgctttg atcttgatgg aacggtttac 720
gaggtggagc cgaacttcct tggctgccac aatctgcatg gcggcagcaa ggggctcgga 780
caccatgtct ggaagatcac 800

Claims (6)

1. A PCR primer for distinguishing Brucella canis from other Brucella canis is characterized by comprising the following sequences:
BSU：5'—GCAGGTCGTTACCGTCGATC—3'；
BCD：5'—CAATATCCGCAACGCCTCTTG—3'；
BSD：5'—CATCAAGCCGCATCGCAGC—3'。
2. a kit for distinguishing Brucella canis from other Brucella canis comprising the primer of claim 1.
3. A PCR detection method for distinguishing Brucella canis from other Brucella canis is characterized by comprising the following steps:
step 1: extracting DNA of a sample to be detected;
step 2: carrying out amplification reaction by using the primer of claim 1 by using the obtained DNA as a template to obtain an amplification product;
and step 3: and detecting the amplification product by using agarose gel electrophoresis, and distinguishing the brucella canis from other brucella according to the electrophoresis detection result.
4. The detection method according to claim 3, wherein the amplification reaction system comprises the following components: 2 XTaq Master Mix 10. mu.l, 1. mu.l each of BSU primer/BCD primer/BSD primer, 1. mu.l of sample DNA to be tested and ddH2O 6μl。
5. The detection method according to claim 3, wherein the reaction procedure is: pre-denaturation at 95 ℃ for 3min, reaction at 95 ℃ for 20s, at 65 ℃ for 20s, and at 72 ℃ for 30s for 35 cycles.
6. Use of the primer of claim 1 or the kit of claim 2 or the detection method of any one of claims 3 to 5 for distinguishing brucella canis from other brucella.
CN202110906518.1A 2021-08-09 2021-08-09 PCR primer for distinguishing Brucella canis from other Brucella and detection method Pending CN113528685A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110906518.1A CN113528685A (en) 2021-08-09 2021-08-09 PCR primer for distinguishing Brucella canis from other Brucella and detection method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110906518.1A CN113528685A (en) 2021-08-09 2021-08-09 PCR primer for distinguishing Brucella canis from other Brucella and detection method

Publications (1)

Publication Number Publication Date
CN113528685A true CN113528685A (en) 2021-10-22

Family

ID=78122177

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110906518.1A Pending CN113528685A (en) 2021-08-09 2021-08-09 PCR primer for distinguishing Brucella canis from other Brucella and detection method

Country Status (1)

Country Link
CN (1) CN113528685A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105018628A (en) * 2015-08-07 2015-11-04 山东省农业科学院奶牛研究中心 Kit for recognizing Brucella A19 vaccine strain and wild strain
CN111394489A (en) * 2020-05-13 2020-07-10 沈阳农业大学 DNA fragment, primer and detection method for identifying Brucella A19/S19 strain and other strains
CN111500754A (en) * 2020-05-29 2020-08-07 山东省健牧生物药业有限公司 Primer and kit for identifying four Brucella in dog and application of primer and kit

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105018628A (en) * 2015-08-07 2015-11-04 山东省农业科学院奶牛研究中心 Kit for recognizing Brucella A19 vaccine strain and wild strain
CN111394489A (en) * 2020-05-13 2020-07-10 沈阳农业大学 DNA fragment, primer and detection method for identifying Brucella A19/S19 strain and other strains
CN111500754A (en) * 2020-05-29 2020-08-07 山东省健牧生物药业有限公司 Primer and kit for identifying four Brucella in dog and application of primer and kit

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
YINBO YE等: "A New Specific Sequence to Distinguish B.canis From Other Brucella by PCR", 《RESEARCH SQUARE》 *

Similar Documents

Publication Publication Date Title
CN108441565B (en) Fluorescence labeling multiplex amplification kit for 37 STR loci of human Y chromosome and application thereof
CN111979303A (en) Nucleic acid detection kit, method and application thereof
CN115029459A (en) Kit for visually detecting Pasteurella multocida based on CRISPR-Cas12a and application
CN112359125A (en) Method for rapidly detecting cryptococcus gatherensis
CN112739833A (en) Primer pair, probe and kit for detecting SARS-CoV-2 by utilizing nested RPA technology and application thereof
CN113186312B (en) Molecular marker for distinguishing Brucella A19 vaccine strain and wild strain
CN110734993A (en) nucleic acid detection test paper strip for distinguishing Brucella vaccine strain S19 from naturally infected strain
CN110607398B (en) RT-LAMP kit for fluorescent visual rapid detection of porcine epidemic diarrhea virus
CN111518931A (en) Multiple PCR diagnostic kit for 3 kinds of pathogenic bacteria in milk
CN115747361A (en) Real-time fluorescent MIRA and MIRA-LFD primer group for detecting streptococcus iniae and detection method
CN116121439A (en) Method and kit for detecting fungi by multiple quantitative PCR
CN113528685A (en) PCR primer for distinguishing Brucella canis from other Brucella and detection method
CN110894532A (en) RAA constant temperature fluorescence detection method and reagent for bacterial septicemia (FBS)
KR100984785B1 (en) Primer set and probe for detecting Salmonella typhimurium
CN112592989B (en) RPA primer for distinguishing proteus mirabilis and salmonella and detection method
CN108570510B (en) LAMP primer, kit and detection method for detecting haemophilus parasuis
CN109628621B (en) Real-time quantitative LAMP primer group and kit for detecting Klebsiella pneumoniae
EP2834369B1 (en) Compositions and methods for detection of mycobacterium avium paratuberculosis
CN112899406A (en) Nucleic acid composition, kit and detection method for detecting feline digestive tract infectious pathogens
CN111560445B (en) QPCR kit and method for vickers bacteria, elizabeth bacteria and Morganella
KR102546048B1 (en) Composition for detecting fungal infection and detection method using the same
CN116790771A (en) Method and primers for detection of mycoplasma in samples by PCR
CN110184371B (en) Specific primer for detecting acinetobacter cutaneus as well as method and application thereof
Nefedchenko et al. Detection and genotyping Pasteurella multocida of five capsular groups in real time polymerase chain reaction
CN116121409B (en) Probe primer group, kit and detection method for detecting bacteria by multiple qPCR

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20211022

RJ01 Rejection of invention patent application after publication