CN113528678B

CN113528678B - gRNA, kit and carrier system for detecting pine wood nematode

Info

Publication number: CN113528678B
Application number: CN202111077375.4A
Authority: CN
Inventors: 王永林; 武瑾; 唐晨; 尹康权; 李学武
Original assignee: Beijing Forestry University
Current assignee: Beijing Forestry University
Priority date: 2021-09-15
Filing date: 2021-09-15
Publication date: 2021-12-24
Anticipated expiration: 2041-09-15
Also published as: CN113528678A

Abstract

The present invention discloses a gRNA for detecting bursaphelenchus xylophilus comprising a) a guide sequence, such as SEQ ID NO:1, capable of hybridizing to a target nucleotide sequence, and b) a framework nucleic acid fragment that interacts with a Cas nuclease. The invention also discloses a kit for detecting the bursaphelenchus xylophilus, which comprises the gRNA or DNA capable of being transcribed into the gRNA. The present invention also discloses a vector system comprising one or more vectors comprising: a first regulatory element operably linked to a nucleotide fragment encoding a Cas nuclease and a second regulatory element operably linked to a nucleotide fragment encoding the gRNA.

Description

gRNA, kit and carrier system for detecting pine wood nematode

Technical Field

The invention relates to the technical field of biological detection, and particularly relates to a gRNA, a kit and a carrier system for detecting pine wood nematodes.

Background

Pine wood nematode disease, namely pine wilt disease, is one of four forest diseases in the world at present and is called cancer of pine, and the pathogen causing the disease is the pine wood nematode, and belongs to a secondary quarantine object in China. Since the pine wood nematodes cannot be directly observed by naked eyes, the need to rely on specialized equipment and personnel, and distinguishing and identifying the pine wood nematodes is not only burdensome for quarantine personnel, but also a great challenge. The pine wood nematode is effectively identified, and plays a vital role in controlling the harm of the pine wood nematode and blocking the propagation and diffusion of the pine wood nematode in time. At present, the main means for identifying the species of the pine wood nematodes by the entry and exit port are morphological observation, biochemical detection and molecular biological detection, but the detection means can not meet the requirements of the port department on the high-efficiency and accurate detection of the pine wood nematode disease.

The detection of specific nucleic acid molecules established today usually requires two steps, the first step being the amplification of the nucleic acid of interest and the second step being the detection of the nucleic acid of interest. Although there are some specific detection and identification of bursaphelenchus xylophilus by molecular biological means in the prior art, such as: the specific primer PCR method, the ITS-PCR-RFLP method, the real-time fluorescence quantitative PCR method and the like have the advantages of high speed, high efficiency, low pollution and the like, but the specific primer PCR method and the ITS-PCR-RFLP method need a plurality of steps of electrophoresis, dyeing, imaging and the like, and the real-time fluorescence quantitative PCR method has the defects of large investment of instruments and equipment, high cost of a marking probe and a reagent, poor universality and quarantine identification application and can not meet the requirement of daily detection and screening of port and forest.

In recent years, with the advent of CRISPR gene editing technology, scientists developed a new nucleic acid diagnostic technology (SHERLOCK technology) targeting RNA centered on Cas13 based on RPA technology, and also developed a diagnostic technology centered on Cas12 enzyme. Nucleic acid detection techniques developed based on CRISPR technology are playing an increasingly important role.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

In view of the above, there is a need to provide a crRNA, a kit and a carrier system for detecting pine wood nematode in order to solve the problem of detecting pine wood nematode.

One of the objects of the present invention is to provide a gRNA for detecting bursaphelenchus xylophilus comprising a) a guide sequence of SEQ ID No. 1, which is capable of hybridizing to a target nucleotide sequence, and b) a framework nucleic acid fragment interacting with a Cas nuclease.

The other object of the present invention is to provide a kit for detecting bursaphelenchus xylophilus, comprising the gRNA or a DNA transcribable into the gRNA.

It is a further object of the present invention to provide a vector system comprising one or more vectors, said vectors comprising: a first regulatory element operably linked to a nucleotide fragment encoding a Cas nuclease and a second regulatory element operably linked to a nucleotide fragment encoding the gRNA.

The invention realizes the detection of the nucleic acid of the pine wood nematode by using the CRISPR/Cas technology, has good detection specificity and high sensitivity, can realize high-sensitivity and high-precision molecular detection at the room temperature of 25-37 ℃, has better specificity and compatibility, and has low detection cost and convenient and quick operation. The detection limit value can reach 2.8' 10³copies/. mu.L, which shows that the method of the invention has better sensitivity.

Drawings

FIG. 1 is a graph showing the results of sensitivity measurement according to an embodiment of the present invention, in which N represents a negative control, Bx represents Bursaphelenchus xylophilus, and Bm represents Bursaphelenchus mcronatus;

FIG. 2 is a diagram showing the results of specific detection according to an embodiment of the present invention, in which N1 represents a negative control, N2 represents a negative reaction of RAA amplification, and 1 represents 2.8' -10⁸copies/. mu.L, 2 denotes 2.8' -10⁷copies/. mu.L, 3 denotes 2.8' -10⁶copies/. mu.L, 4 denotes 2.8' -10⁵copies/. mu.L, 5 denotes 2.8' -10⁴copies/. mu.L, 6 denotes 2.8' -10³copies/. mu.L, 7 denotes 2.8' -10²copies/μL。

Detailed Description

To facilitate an understanding of the invention, the invention will now be described more fully with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

As used herein, the term "buffer" refers to an aqueous solution or composition that resists changes in pH when an acid or base is added to the solution or composition. This resistance to pH changes is due to the buffer properties of such solutions. Thus, a solution or composition that exhibits buffering activity is referred to as a buffer or buffer solution. Buffers generally do not have the unlimited ability to maintain the pH of a solution or composition. Rather, they are generally capable of maintaining a pH within a specific range, such as pH 7-9. Generally, Buffers are capable of maintaining a pH at their pKa and within the next logarithm (see, e.g., Mohan, Buffers, A guide for the preparation and use of Buffers in biological systems, CALBIOCHEM, 1999). Buffers and buffer solutions are generally prepared from buffered salts or preferably non-ionic buffer components such as TRIS and HEPES. The buffer which can be used in the method of the invention is preferably selected from the group consisting of phosphate buffer, phosphate buffered saline buffer (PBS), 2-amino-2 hydroxymethyl-1, 3-propanediol (TRIS) buffer, TRIS buffered saline solution (TBS) and TRIS/edta (te).

As used herein, the term "amplification" when co-occurring in the context of the term "nucleic acid" refers to the production of multiple copies of a polynucleotide, or portion of a polynucleotide, typically starting from a small amount of the polynucleotide (e.g., as little as a single polynucleotide molecule), wherein the amplification product or amplicon is typically detectable. Amplification of polynucleotides includes a variety of chemical and enzymatic methods. The generation of multiple copies of DNA from one or a few copies of a target or template DNA molecule during Polymerase Chain Reaction (PCR), Rolling Circle Amplification (RCA) or Ligase Chain Reaction (LCR) is an amplified form. Amplification is not limited to the strict replication of the starting molecule. For example, the use of reverse transcription RT-PCR to generate multiple cDNA molecules from a limited amount of RNA in a sample is an amplified version. In addition, the production of multiple RNA molecules from a single DNA molecule during the transcription process is also an amplified version.

As used herein, the term "amplification primer" refers to an oligonucleotide, whether naturally occurring in a purified restriction digest or produced synthetically, that is capable of acting as a point of initiation of synthesis when placed under conditions to induce synthesis of a primer extension product that is complementary to a nucleic acid strand (e.g., in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH). The primer is preferably single stranded for maximum efficiency of amplification, but may alternatively be double stranded. If double stranded, the primers are first treated to separate their strands before being used to prepare extension products. Preferably, the primer is an oligodeoxyribonucleotide. The primer should be long enough to prime the synthesis of extension products in the presence of the inducing agent. The exact length of the primer will depend on many factors, including temperature, source of primer, and use of the method. For example, in some embodiments, the primer ranges from 10 to 100 or more nucleotides (e.g., 10 to 300, 15 to 250, 15 to 200, 15 to 150, 15 to 100, 15 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50 nucleotides, etc.).

In some embodiments, the primer comprises an additional sequence that does not hybridize to the target nucleic acid. The term "primer" includes chemically modified primers, fluorescently modified primers, functional primers (fusion primers), sequence specific primers, random primers, primers with specific and random sequences, and DNA and RNA primers.

As used herein, a "target sequence" is a sequence of bases in a target nucleic acid, and may refer to the sense strand and/or antisense strand of a double-stranded target, and, unless the context dictates otherwise, also encompasses the same sequence of bases as an extension product or amplification product of the original target nucleic acid that is regenerated or replicated in amplified copy number.

As used herein, the term "gRNA" refers to a guide RNA that guides an RNA for which a Cas protein specifically binds a target DNA sequence.

As used herein, the term "Cas 12 a" (old referred to as "Cpf 1") refers to a crRNA-dependent endonuclease, which is a type V-a (type V-a) enzyme in the CRISPR system classification.

As used herein, the terms "Cas 12B", "C2C 1" are used interchangeably and refer to crRNA-dependent endonucleases, which are enzymes of type V-B (type V-B) in the classification of CRISPR systems.

As used herein, the term "RPA", collectively referred to as recombinase polymerase amplification, is based on the principle that a recombinase, in combination with a primer, forms a protein-DNA complex that is capable of finding homologous sequences in double-stranded DNA. Once the primers locate the homologous sequences, strand exchange reaction formation occurs and DNA synthesis is initiated, and the target region on the template is exponentially amplified. The replaced DNA strand binds to SSB, preventing further replacement. In this system, a single synthesis event is initiated by two opposing primers. The entire process is carried out very quickly and detectable levels of amplification product are typically obtained within ten minutes.

A first aspect of the invention provides a gRNA for detecting bursaphelenchus xylophilus comprising a) a guide sequence, e.g., SEQ ID NO:1, capable of hybridizing to a target nucleotide sequence, and b) a framework nucleic acid fragment that interacts with a Cas nuclease.

In the present invention, the guide sequence may include SEQ ID NO:1, or a nucleic acid fragment corresponding to SEQ ID NO:1, or a nucleic acid fragment comprising substantially the same nucleic acid fragment as set forth in claim 1.

By "substantially identical nucleic acid fragment" is meant a nucleic acid fragment that is capable of hybridizing to SEQ ID NO:1, and a nucleic acid fragment to which the target sequence corresponding to the nucleic acid fragment hybridizes. Such nucleic acid fragments may be compared to SEQ ID NO:1 substitution, increase or decrease of 1, 2, 3 or more nucleobases or base analogues [ e.g. 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5- (carboxyhydroxymethyl) uracil, 5-fluorouracil, 5-bromouracil, Q-nucleosides, etc. ] or nucleic acid fragments with some bases having certain modifications (e.g. methylation modifications, which are usually not critical for the hybridization of the gRNA to the target nucleic acid), preferably controlled in length between 18bp and 24 bp. "stringent conditions" used in the present invention are known, and include, for example, hybridization at 65 ℃ for 12 to 16 hours in a hybridization solution containing 400mM NaCl, 40mM PIPES (pH 6.4) and 1mM EDTA, followed by washing at 65 ℃ for 15 to 60 minutes with a washing solution containing 0.1% SDS and 0.1% SSC. This is familiar to the person skilled in the art.

Typically, one Cas nuclease interacting framework nucleic acid fragment is linked to only one guide sequence that binds to the target nucleic acid.

A second aspect of the present invention is to provide a kit for detecting bursaphelenchus xylophilus, which includes the above-described gRNA or a DNA that can be transcribed into the gRNA.

In order to facilitate storage and reduce cost, the DNA capable of being transcribed into the gRNA can be selected from the kit, and the gRNA is obtained through subsequent transcription.

In some embodiments, the DNA transcribable into the gRNA is selected from, e.g., SEQ ID NO: 10.

Preferably, the kit further comprises at least one of a Cas nuclease, a signaling reporter, a positive control, and a buffer for a CRISPR detection system.

In some embodiments, the Cas nuclease is selected from Cas 12.

In some embodiments, the Cas12 nuclease is selected from Cas12a and/or a Cas nuclease with similar bypass single-stranded DNA cleavage activity as Cas12 a.

In some embodiments, the Cas12a nuclease is selected from at least one of FnCas12a, assas 12a, LbCas12a, Lb5Cas12a, HkCas12a, osccas 12a, TsCas12a, BbCas12a, BoCas12a, and Lb4Cas12 a.

The invention provides application of Cas12a and Cas12 b-based enzymes in nucleic acid detection. The following is described taking Cas12a as an example. Cas12a has the activity of trans cleavage, i.e., once the target DNA, gRNA and Cas12a protein form a ternary complex, additional single-stranded DNA (bypass single-stranded DNA) in the system is cleaved. Whether the reaction system contains the target nucleic acid can be judged by detecting whether the single-stranded DNA is cleaved. Based on this principle, a specific nucleic acid detection method was designed.

The gRNA has the structure 5 '-a framework nucleic acid fragment that interacts with a Cas nuclease-guide sequence-3'.

In some embodiments, Cas12a is LbCas12a and the framework nucleic acid fragment that interacts with Cas nuclease is shown in SEQ ID No. 2.

In some embodiments, the Cas nuclease with similar bypass single-stranded DNA cleavage activity as Cas12a is Cas12b nuclease.

In some embodiments, the Cas12b nuclease is selected from at least one of AacCas12b, Aac2Cas12b, AkCas12b, AmCas12b, AhCas12b, and AcCas12 b.

The positive control is usually in the form of a plasmid containing the target sequence corresponding to the gRNA.

In some embodiments, the signal reporter molecule is a signal reporter single-stranded DNA molecule, which is a DNA molecule having a signal reporting function, wherein when the DNA sequence therein is degraded, a positive signal can be reported and detected.

In some embodiments, the signal-reporting single-stranded DNA molecule is labeled with a fluorescent emitting group at the 5 'end and a quenching group at the 3' end.

In some embodiments, the fluorescent emitting group is selected from any one of FAM, HEX, TET, NED, ROX, CY5, CY3, Texas Red, TFAM, SYBR Green I, VIC, and JOE.

In some embodiments, the quencher group is selected from any one of TAMRA, BHQ, Dabcyl, Eclipse, and NFQ-MGB.

In some embodiments, the two ends of the single-stranded signaling DNA molecule are labeled with different labels, namely a first label and a second label. As such, the first label is separated from the second label when the signaling single-stranded DNA molecule is cleaved by the CRISPR detection system.

In some embodiments, the kit further comprises a reagent strip for interacting with the signal-reporting single-stranded DNA molecule and displaying a signal result of the signal-reporting molecule.

In some embodiments, the test strip comprises a sample pad, a reaction membrane and an absorption pad, wherein the reaction membrane is provided with a detection area and a quality detection area;

wherein:

the detection area is fixedly coated with a signal substance, and the signal substance is marked with a first anti-label aiming at the first label;

the quality detection area is fixedly coated with an antibody aiming at the second marker;

the first label and the first anti-label are capable of forming a label-anti-label complex, and the first anti-label is different from the antibody to the second label.

In some embodiments, the combination of label/anti-label in the label-anti-label complex is selected from the group consisting of biotin or a derivative thereof/streptavidin, biotin or a derivative thereof/avidin, biotin or a derivative thereof/neutravidin, hapten/antibody, antigen/antibody, receptor/ligand, digoxin/digoxigenin, carbohydrate/lectin and polynucleotide/complementary polynucleotide.

Wherein the derivative of biotin is any one of D-biotin, activated biotin, biocytin, ethylenediamine biotin, cadaverine biotin and desthiobiotin.

Where the antigen and hapten may be polypeptides, they may also be proteins or protein subunits, and such proteins or protein subunits may themselves be antibodies or antibody fragments.

An "antibody" is a substance that binds to its antigen. The term can include polyclonal and monoclonal antibodies, and the term "antibody fragment" includes antigen-compound binding fragments of these antibodies, including Fab, F (ab') 2, Fd, Fv, scFv, diabodies, and minimum recognition units of antibodies, as well as single chain derivatives of these antibodies and fragments, such as scFv-Fc and the like. The type of antibody can be selected from IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD. Furthermore, the term "antibody" includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, chimeric (chimeric), bifunctional (bifunctional), humanized (humanized) antibodies and human antibodies, as well as related synthetic isomeric forms (isoantibodies).

The reaction membrane is typically a microfiltration membrane, such as an NC membrane.

The protein family of the biotin/biotin pool, as well as digoxigenin/digoxigenin, are preferred in the present invention.

The biotin-binding protein family includes streptavidin (streptavidin), avidin (avidin), and neutravidin (neutravidin) described above, each of which is capable of binding four biotin molecules with a high degree of affinity and specificity. Among these, streptavidin, which is not glycosylated and has a very low level of non-specific binding, is most commonly used. Avidin is a highly cationized glycoprotein with an isoelectric point of about 10.5, and its positively charged residues and oligosaccharide components can mediate non-specific binding, resulting in a problem of high background in some applications. Neutravidin undergoes deglycosylation and a lowering of the isoelectric point, thereby reducing its background coloration.

Digoxigenin can be an antibody.

In some embodiments, a signal substance refers to any atom or molecule that can be used to provide a detectable (preferably quantifiable) effect and that can be attached to a nucleic acid. Signal substances include, but are not limited to, dyes; radiolabels, e.g.³²P; binding moieties such as biotin; haptens such as digoxin; a luminescent, phosphorescent, or fluorescent moiety; and a fluorescent dye alone or in combination with a portion of the emission spectrum that can be suppressed or shifted by Fluorescence Resonance Energy Transfer (FRET). The signal substance may provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, or the like. The signal species may be a charged moiety (positive or negative) or alternatively, may be charge neutral. The signal substance may comprise or be a combination of nucleic acid or protein sequences, as long as the sequence comprising the label is detectable. In some embodiments, the nucleic acid is detected directly (e.g., direct sequence read) without a label.

In some embodiments, the signal species is a fluorophore, colorimetric label, colloidal gold, quantum dot, biotin, and other label molecules that can be used for detection (e.g., alkyne groups for raman diffraction imaging, cyclic olefins for click reactions, priming groups for polymer labeling), and can also be selected from at least one of polypeptide/protein molecules, LNA/PNA, unnatural amino acids and their analogs (e.g., peptidomimetics), unnatural nucleic acids and their analogs (nucleomimetics), and nanostructures (including inorganic nanoparticles, NV-centers, aggregation/assembly-induced emission molecules, rare earth ion ligand molecules, polyoxometalate, etc.).

In some embodiments, one of the labels is a fluorophore.

In some embodiments, the fluorophore may be selected from the group consisting of fluorescein-based dyes, rhodamine-based dyes, and cyanine dyes.

In some embodiments, the fluorescein-based dye includes standard fluorescein and its derivatives, such as Fluorescein Isothiocyanate (FITC), hydroxyfluorescein (FAM), tetrachlorofluorescein (TET), and the like.

In some embodiments, the rhodamine-based dye includes R101, tetraethylrhodamine (RB 200), carboxytetramethylrhodamine (TAMRA), and the like.

In some embodiments, the cyanine dyes are selected from two classes, one class being Thiazole Orange (TO), oxazole orange (YO) series and dimer dyes thereof, and the other class being cyanine dyes of the polymethine series.

In some embodiments, the fluorophore may also be selected from the following dyes: stilbene, naphthalimide, coumarins, acridines, pyrenes, and the like.

Preferably, the second marker is biotin.

Preferably, the signal substance is colloidal gold.

In some embodiments, the first label is a fluorophore, the second label is biotin, and the signaling substance is colloidal gold.

In some embodiments, the kit further comprises at least one of RNA polymerase, amplification primers, DNA polymerase, dNTPs, amplification buffer, sample pre-treatment reagents, and water.

Wherein the amplification primer is used for amplifying a nucleic acid fragment containing the gRNA targeting sequence.

The RNA polymerase is used to transcribe DNA that can be transcribed into the gRNA into a gRNA.

In some embodiments, the DNA polymerase is selected from any of Taq, Bst, Vent, Phi29, Pfu, Tru, Tth, Tl1, Tac, Tne, Tma, Tih, Tf1, Pwo, Kod, Sac, Sso, Poc, Pab, Mth, Pho, ES4 DNA polymerase, Klenow fragment.

In some embodiments, the sample pretreatment reagent comprises a reagent for extracting DNA, and such a reagent is further preferably a reagent that can be used for extraction by phenol chloroform method, NaOH method, resin extraction method, salting out method, cetyltrimethylammonium bromide method, silica gel membrane adsorption method, FTA card method, silica bead method, or magnetic bead extraction method.

Wherein:

the phenol chloroform method generally refers to a DNA extraction method in which a protein-like organic substance in a DNA solution is extracted by a phenol chloroform mixture, and the DNA is retained in an aqueous solution.

The NaOH method generally comprises the steps of dissolving and denaturing protein by strong alkali, destroying cell membranes and nuclear membranes, denaturing nuclease and releasing DNA, wherein NaOH does not destroy the primary structure of the DNA.

The resin extraction method is usually a Chelex100 method, and is a DNA extraction method for inactivating nuclease degrading DNA by chelating magnesium, sodium and potassium ions by Chelex.

The salting-out method is generally carried out by disrupting cells and centrifuging, then precipitating the protein with about 6M saturated NaCl, precipitating the DNA in the supernatant from the centrifugation with anhydrous ethanol, and dissolving the DNA in TE.

The cetyltrimethylammonium bromide method is generally a DNA extraction method in which a nonionic detergent CTAB destroys cell walls and cell membranes and hard tissues, forms a complex with DNA, and separates DNA from proteins and polysaccharides.

The silica gel membrane adsorption method generally refers to a method for extracting and purifying DNA by adsorbing cell lysate to release DNA after cracking through a silica gel membrane, and removing impurities such as protein, lipid, polysaccharide and the like through protease digestion and rinsing liquid cleaning.

The FTA card method generally refers to a method for obtaining DNA from blood and oral epithelial cells by the lysis of cells by the FTA card to release the DNA.

The silica bead method generally refers to a DNA extraction method in which DNA molecules in an organic solution are specifically captured by silica microparticles in the presence of high concentration of guanidine thiocyanate.

The magnetic bead method generally refers to a method for extracting and purifying DNA, in which a layer of magnetic beads of magnetic resin is coated on the surface of silica gel in the presence of guanidine salt, and DNA is released after cell lysis is specifically adsorbed and lysed.

In some embodiments, the water is typically nucleic acid and/or nuclease-free water, such as double distilled or deionized water.

In some embodiments, the amplification primers are specific primers.

Preferably, the amplification is based on an RPA reaction. The kit contains an RPA reaction reagent. The RPA reaction allows for rapid amplification. The RPA reaction reagent comprises buffer solution, RPA primer and magnesium acetate.

In some embodiments, the upstream primer of the RPA primer may be added with a promoter sequence at the 5' end for subsequent in vitro transcription of the amplified product.

The promoter can be selected from T7, T3, SP6 and the like, and is preferably T7 promoter.

It should be noted that the template (to-be-detected fragment) of the RPA reaction of the present invention may be DNA or RNA; when the template is RNA, an RPA enzyme premix for RNA is used to perform the reverse transcription function.

The present invention also relates to a vector system comprising one or more vectors comprising: a first regulatory element operably linked to a nucleotide fragment encoding a Cas nuclease and a second regulatory element operably linked to a nucleotide fragment encoding a gRNA as described above.

The Cas nuclease is capable of specifically cleaving a target sequence in coordination with the gRNA.

The Cas nuclease may be located on the same or different vector as the gRNA.

The invention also relates to a method of killing bursaphelenchus xylophilus comprising cleaving a target DNA using a CRISPR-Cas nuclease system to alter expression of a gene product;

the CRISPR-Cas nuclease system comprises a gRNA as described above and/or a vector system as described above.

The gene product is preferably a bursaphelenchus xylophilus-associated protein.

According to a third aspect of the present invention, the present invention also relates to the use of a gRNA as described above, or a kit as described above, for detecting pine wood nematodes or pine wood nematode disease.

Bursaphelenchus xylophilus (Bursaphelenchus xylophilus) belongs to the phylum nematoda, class nematoda, order Lepidoptera, family Lepidaceae, genus Lepidium. The length of the female worm body is about 0.81mm, the length of the male worm body is about 0.73mm, the tail of the female worm is nearly conical, and the tail end of the female worm is round; the tail of the male insect is similar to a bird claw and is bent towards the ventral surface.

The detectable pine wood nematodes of the present invention are derived from pine or other non-pine plants or non-plants.

The pine tree is selected from Pinus massoniana, Pinus tabulaeformis, Pinus bungeana, Pinus armandii, Pinus koraiensis, Pinus sylvestris, and Cedar.

Such use may be for diagnostic or non-diagnostic purposes.

The application can be used for preventing and treating the pine wilt disease caused by the pine nematode, also known as pine wilt disease.

The following are specific examples.

Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated. Unless otherwise indicated, reagents and materials used in the following examples are commercially available.

Unless otherwise indicated, the present invention employs immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, recombinant DNA and the like, which are within the ordinary skill of the art.

The following are specific examples.

Example 1 design and screening of CRISPR/Cas12a detection primer gRNA for Bursaphelenchus xyfolus

1. Selection of target sequences

On the basis of earlier research, through multiple screening and comparison, a sequence with difference of about 20 bases in a 5S rDNA region of the bursaphelenchus xylophilus and a related species of the bursaphelenchus xylophilus, such as SEQ ID NO. 4, is selected as a target sequence, and the sequence is used as a specific conserved sequence of the bursaphelenchus xylophilus, so that the specificity of the bursaphelenchus xylophilus can be detected.

2. Design of gRNA of specific target pine wood nematode 5S rDNA gene

The design for LbCas12 agna follows the following four principles:

(1) the gRNA sequence format is: 5 '-framework nucleic acid fragment interacting with LbCas12a nuclease-guide sequence-3'. The frame nucleic acid fragment corresponding to LbCas12a is AAUUUCUACUGUUGUAGAU (SEQ ID NO: 2);

(2) ligating a framework nucleic acid fragment that interacts with LbCas12a nuclease to a guide sequence to generate a complete gRNA sequence;

(3) the guide sequence of the gRNA is reverse complementary to the target site sequence in the target DNA;

(4) the guide sequence of gRNA is 24 bases in length, and recognition of the gRNA with a target DNA relies on a short T base-rich pro-spacer sequence adjacent to the motif protospacer-adjacent motif (PAM), namely "TTTV".

Aiming at the RAA primer amplified fragment of the existing bursaphelenchus xylophilus 5S rDNA gene, the sites shown in the table 1 are selected according to the design principle of gRNAs, and a plurality of gRNAs are obtained by software design, but after sequence comparison verification, most of the gRNAs cannot be practically applied, and only one effective sequence is shown as gRNA-1.

Guide sequence: AAUAAAGAAAUCAGAACCGUAUU (SEQ ID NO: 1);

gRNA-1：AAUUUCUACUGUUGUAGAUAAUAAAGAAAUCAGAACCGUAUU(SEQ ID NO:3)。

TABLE 1 screening of 5S rDNA target sequence gRNA sites

3. Preparation of gRNA

In order to facilitate the requirements of experimental preservation and amplification, the gRNA is synthesized into a DNA sequence, and the DNA is transcribed into RNA by an in vitro transcription method in actual use; the in vitro transcription method requires the addition of the T7 promoter sequence 5' to the synthetic DNA sequence (SEQ ID NO:25- -GAAATTAATACGACTCACTATAGGG). The DNA sequence was synthesized by Shanghai Bioengineering Co., Ltd. The DNA sequences for transcription into grnas are shown in table 1 below.

TABLE 2 template sequences (oligo DNA) for the preparation of bursaphelenchus xylophilus gRNA

Example 2 establishment of a method for detecting Bursaphelenchus xylophilus

1. Artificially synthesized oligo DNA and transcribed into gRNA

The oligo DNA template of gRNA was annealed to double stranded DNA using rTaq 10X PCR buffer (TaKaRa). The annealing system is shown in table 3 below.

TABLE 3

In the above reaction system, the concentrations of oligo DNA and T7 promoter were 100. mu.M, and the Standard Taq buffer concentration was 10X.

The annealing procedure is as follows:

95℃ 5min；94℃ to 25℃(0.1℃/s)；25℃ ∞。

the annealed product dsDNA (gRNA) obtained in the previous step was transcribed using T7 RNA polymerase according to the instructions of HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs) to obtain gRNA.

The above transcription system is shown in Table 4 below.

TABLE 4

In the reaction system, the final concentration of NTP buffer is 6.7mM, and the final concentration of dsDNA (gRNA) is 1 mug/mul.

The transcription reaction program is: incubating at 37 ℃ for 16 h; adding 20 mul of nuclease-free water into a reaction system, sucking, beating and uniformly mixing, and adding 2 mul of DNase I; incubate at 37 ℃ for 15 min.

After the transcription reaction is finished, RNA Clean & Concentrator kit is used for in vitro purification of gRNA; the concentration of the purified gRNA is measured by Nanodrop2000, and the concentration of the gRNA is diluted to 10 ng/mul by DEPC water (the diluted gRNA is packed into each tube of 20 mul in portions, and the tubes are stored at-80 ℃ for convenient subsequent use).

2. Artificially synthesized signal single-stranded DNA probe

Due to the affinity of recombinant protease to T base, the composition of single-stranded DNA base with non-specific DNase activity is generally "TTATT", the 5 'end of the single-stranded DNA base is labeled with FAM, the 3' end is labeled with Biotin (Biotin), and a signal reporting single-stranded DNA molecule with a label is directly synthesized.

After the LbCas12a and the gRNA are combined and cut the target sequence, the signal report single-stranded DNA molecule is broken, and the two labels can generate a color development result in a lateral flow chromatography test strip reaction.

3. Nucleic acid preparation and vector construction

Pine wood nematode genome DNA is extracted by using pine wood nematode as material and through CTAB process and stored at-20 deg.c.

The obtained DNA is used as a template to carry out conventional PCR reaction on the 5S rDNA gene fragment to obtain a single band with the length of 556 bp.

The PCR reaction system is shown in Table 5.

TABLE 5

In the reaction system, the concentrations of the upstream primer and the downstream primer are both 10 mu M.

The PCR reaction procedure is as follows:

94℃ 5min；94℃30s，55℃ 30s，72℃ 20s，30 cycles；72℃ 10min；4℃ ∞。

and performing agarose gel electrophoresis on the obtained product, cutting the gel, recovering and purifying the target fragment.

The target fragment was ligated with pMD-19T cloning vector and transferredTransforming to Escherichia coli DH5 alpha competent cell, screening positive clone strain and shaking overnight, extracting plasmid and sequencing, and storing positive plasmid with correct sequence identification at-20 deg.C as pMD-19T Bx-5S. The OD value of the plasmid standards was determined using a spectrophotometer as follows: 287.7 ng/mul, and diluting to 100 ng/mul. Copy number calculation formula: copies (. mu.L) ═ 6.02X 10²³X concentration x10^-9) V (660 x base number), calculating the copy number of the 100 ng/mu l pMD-19T Bx-5S standard to be 2.8 x10 according to the formula¹⁰copies/μ l. The plasmid was diluted 10-fold in a gradient and used as a standard for CRISPR/Cas12a visualization detection.

4. Recombinase polymerase amplification (RAA)

47.5. mu.L of the reaction mixture shown in Table 6 was added to each tube of the lyophilized powder according to the (RAA) kit instructions to dissolve the lyophilized powder sufficiently and uniformly. Adding 2.5 μ L of 280mM magnesium acetate solution on the tube cover of each reaction tube, covering the tube cover, flicking with finger to mix the reagents in the tube, centrifuging at low speed for 3-5s, and reacting at 37 deg.C for 40 min.

TABLE 6 RAA reaction mixture

5. Detection of bursaphelenchus xylophilus DNA based on CRISPR/Cas12a system

The reaction system is shown in Table 7 below, and specific gRNA used was gRNA-1 prepared in example 1.

The negative control was set to DEPC water instead of template DNA in table 4, and the other reagent components were kept unchanged.

TABLE 7 CRISPR/Cas12a assay System

In the reaction system, the final concentration of the LbCas12a is 30nM, the final concentration of the gRNA is 30nM, the final concentration of the signal single-stranded DNA molecule is 100nM, and the concentration of the template DNA is 1 ng-1 fg.

In the reaction system, DEPC water, LbCas12a protein, 10 XNEBuffer and gRNA need to be mixed in advance, treated at 25 ℃ for 10min and then incubated at constant temperature of 37 ℃ for 1 hour.

30. mu.l DEPCH was added to the PCR tube after the reaction₂And O, inserting the test strip into the tube, standing for 2-3 minutes, and reading the result. Wherein, the signal single-stranded DNA molecule is FAM-DNA-biotin. The detection area of the test strip is fixedly coated with colloidal gold, and anti-FAM antibodies are marked on the colloidal gold; the quality detection area is fixedly coated with biotin ligand.

And (4) judging a result: for a negative sample, the colloidal gold particle anti-FAM antibody is fully coupled with FAM-DNA-biotin reporter molecules, the conjugate is intercepted by biotin ligand in a quality detection area, only the strip in the quality detection area is colored, and the strip in the detection area is not colored; for positive samples, FAM-DNA-biotin reporter was cleaved by Cas12a, and the gold colloidal particle-anti-FAM antibody-FAM conjugate accumulated at the detection zone, developed color at the detection zone, and reduced or even no color at the quality control zone.

Test results show that the positive Control and the sample containing the DNA of the bursaphelenchus xylophilus can detect the Test line and the Control line, and the negative Control and the sample containing no DNA of the bursaphelenchus xylophilus can not detect the Test line and only the Control line.

Example 3 specificity and sensitivity test

1. Test method

1.1 specificity test

Extracting genome DNA of the pine wood nematode and the pine wood nematode by a CTAB method. RAA pre-amplification is carried out by taking the genome DNA as a template, and CRISPR/Cas12a lateral flow test strip detection is carried out by applying the system established in the embodiment 2, and meanwhile, negative control is set, so that the specificity of the method is verified.

1.2 sensitivity test

pMD-19T Bx-5S standard plasmid (2.8X 10S) diluted in 10-fold gradient⁸copies/μL-2.8×10²copies/mu L) as a template, and DEPCH is used for sensitivity detection₂O is used as a negative control, and the lowest concentration of a test line without obvious bands is used as the sensitivity of the detection methodAnd (4) degree.

2. Test results

2.1 specific assay results

Detection of bursaphelenchus xylophilus and bursaphelenchus pseudoxylophilus, respectively, the specificity of CRISPR/Cas12a lateral flow detection was evaluated.

The detection result is shown in figure 1, the color development of the test strip only appears on the test strip for detecting the pine wood nematode, the test strips for detecting the pine wood nematode are judged to be negative, and the result proves that the detection method established by the invention has good specificity.

2.2 sensitivity test results

The standard plasmid is subjected to 10-fold gradient dilution for detecting the sensitivity of the method, and the detection result is shown in FIG. 2, wherein the lowest detection limit can reach 2.8' 10³copies/mu l, which shows that the method has higher detection sensitivity.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, so as to understand the technical solutions of the present invention specifically and in detail, but not to be understood as the limitation of the patent protection scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the patent of the invention is subject to the appended claims, and the description can be used for explaining the contents of the claims.

Sequence listing

<110> Beijing university of forestry

<120> gRNA, kit and carrier system for detecting pine wood nematode

<160> 26

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> RNA

<213> Artificial Sequence

<400> 1

aauaaagaaa ucagaaccgu auu 23

<210> 2

<211> 19

<212> RNA

<213> Artificial Sequence

<400> 2

aauuucuacu guuguagau 19

<210> 3

<211> 42

<212> RNA

<213> Artificial Sequence

<400> 3

aauuucuacu guuguagaua auaaagaaau cagaaccgua uu 42

<210> 4

<211> 530

<212> DNA

<213> Artificial Sequence

<400> 4

gtgtacgccc atagcccgtt gaaagcacgc catcccgtcc gatctggcaa gttaagcaac 60

gctgcgcttg attagtactt ggatcggaga cgtccttgga atctcaagtg gcgtacgcgt 120

ttttgacttt tttgatttga ataaagaaat cagaaccgta ttttagatgg tatatcatga 180

attaaaatac gtttgaattg atatttgttt gactttttag tcaaactttc caaaattttc 240

tttttcagcc acacttttca ggagctggaa tctcaagcta acctttaact tgggaaatta 300

atccgaagat agaatgaaag agccagctta cctctgatcc accctttcct ttttggctgg 360

ggaatttacg ctatttctgt gtggtctctc caaaaacaca atctctaatt tttctgtgtt 420

agtgacgtca ttattgacta aattttcaag aaaatctcga aaaagtagcc ccggccgtgg 480

actgggtgga attgcaggga aaggaatcaa aagtggaaag ggaagggagt 530

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 5

aacgggctat gggcgtacac 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 6

aataaagaaa tcagaaccgt 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 7

actttttagt caaactttcc 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 8

caaaattttc tttttcagcc 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 9

gaaagtttga ctaaaaagtc 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 10

tttttcagcc acacttttca 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 11

agccacactt ttcaggagct 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 12

aggagctgga atctcaagct 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 13

acttgggaaa ttaatccgaa 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 14

ccaagttaaa ggttagcttg 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 15

ctttttggct ggggaattta 20

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 16

gctggggaat ttacgctatt 20

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 17

cgctatttct gtgtggtctc 20

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 18

tgtgtggtct ctccaaaaac 20

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 19

gagagaccac acagaaatag 20

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 20

tgtgttagtg acgtcattat 20

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 21

agtcaataat gacgtcacta 20

<210> 22

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 22

cctgcaattc cacccagtc 19

<210> 23

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 23

attcctttcc ctgcaattcc 20

<210> 24

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 24

cacttttgat tcctttccct 20

<210> 25

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 25

gaaattaata cgactcacta taggg 25

<210> 26

<211> 67

<212> DNA

<213> Artificial Sequence

<400> 26

aatacggttc tgatttcttt attatctaca acagtagaaa ttccctatag tgagtcgtat 60

taatttc 67

Claims

1. A gRNA for detecting bursaphelenchus xylophilus comprising a) a guide sequence of SEQ ID No. 1 capable of hybridizing to a target nucleotide sequence, and b) a framework nucleic acid fragment that interacts with a Cas nuclease.

2. A kit for detecting pine wood nematodes, comprising the gRNA of claim 1 or a DNA transcribable into the gRNA;

further comprising at least one of a Cas nuclease, a signaling reporter, a positive control, and a buffer for a CRISPR detection system.

3. The kit according to claim 2, wherein the DNA transcribable into the gRNA is selected from SEQ ID NO 10.

4. The kit of claim 3, wherein the Cas nuclease is selected from Cas12 nuclease;

the framework nucleic acid fragment interacting with the Cas nuclease is SEQ ID NO:2, respectively.

5. The kit according to any one of claims 2 to 4, wherein the signal reporter molecule is a signal reporter single-stranded DNA molecule, and the signal reporter single-stranded DNA molecule is a DNA molecule having a signal reporter function, and when a DNA sequence therein is degraded, a positive signal is reported and detected.

6. The kit of claim 5, comprising a strip for interacting with the single-stranded signal-reporting DNA molecule and displaying a signal result of the single-stranded signal-reporting DNA molecule.

7. The kit of claim 6, wherein the signal-reporting single-stranded DNA molecule is labeled at both ends with a first label and a second label, respectively, such that the first label is separated from the second label when the signal-reporting single-stranded DNA molecule is cleaved by the CRISPR detection system;

the kit also comprises a reagent strip, wherein the test strip comprises a sample pad, a reaction membrane and an absorption pad, and a detection area and a quality detection area are arranged on the reaction membrane;

wherein:

8. The kit of claim 7, wherein the signal substance is selected from at least one of fluorophores, colorimetric labels, quantum dots, colloidal gold, biotin, alkyne groups for Raman diffraction imaging, cyclic olefins for click reactions, priming groups for polymer labeling, polypeptide/protein molecules, LNA/PNA, unnatural amino acids and analogs thereof, unnatural nucleic acids and analogs thereof, and nanostructures;

the nanostructure includes an inorganic nanoparticle, an NV-center, an aggregation/assembly-induced emission molecule, a rare earth ion ligand molecule, and a polyoxometalate.

9. The kit of claim 7, further comprising at least one of RNA polymerase, amplification primers, DNA polymerase, dNTPs, amplification buffer, sample pre-treatment reagents, and water;

wherein the amplification primer is used to amplify a nucleic acid fragment containing the gRNA targeting sequence.

10. A vector system comprising one or more vectors comprising: a first regulatory element operably linked to a nucleotide fragment encoding a Cas nuclease and a second regulatory element operably linked to a nucleotide fragment encoding the gRNA of claim 1.