CN113512596B

CN113512596B - crRNA and kit for detecting pine wood nematode

Info

Publication number: CN113512596B
Application number: CN202111077374.XA
Authority: CN
Inventors: 王永林; 唐晨; 武瑾; 尹康权; 李学武; 宗世祥
Original assignee: Beijing Forestry University
Current assignee: Beijing Forestry University
Priority date: 2021-09-15
Filing date: 2021-09-15
Publication date: 2021-12-24
Anticipated expiration: 2041-09-15
Also published as: CN113512596A

Abstract

The invention discloses a crRNA for detecting bursaphelenchus xylophilus, which comprises a) a guide sequence such as at least one of SEQ ID NO 1-2, which can be hybridized to a target RNA sequence, and b) a framework nucleic acid fragment interacting with Cas nuclease. The invention also discloses a kit for detecting the pine wood nematode, which comprises the crRNA or DNA capable of being transcribed into the crRNA.

Description

crRNA and kit for detecting pine wood nematode

Technical Field

The invention relates to the technical field of medical detection, in particular to crRNA (ribonucleic acid) for detecting pine wood nematodes and a kit.

Background

The pine wilt disease is also called pine wilt disease, and is the most dangerous and destructive forest disease in the global forest ecosystem. The pathogenic substance of the nematode, Bursaphelenchus xylophilus (1)Bursaphelenchusxylophilus) The pine tree pest control agent causes destructive attack on pine trees, is an internationally recognized quarantine pest, and has no effective control method at present although the pine tree pest control agent is seriously harmful. The detection of the pine wood nematode is beneficial to finding early epidemic points in time and effectively controlling the occurrence range, so the detection becomes an important basis for preventing and treating the disease.

In the aspect of the detection and identification method research of the pine wood nematode, there are many researches from the traditional morphological identification to the modern molecular detection technology. However, these methods either require the experience of a professional or require complicated equipment. In addition, a series of defects such as complex detection method, general sensitivity, long time consumption and the like also prevent the wide popularization of some detection means.

Researchers have recently begun using CRISPR for nucleic acid in vitro diagnostics. The nucleic acid detection platform SHERLLOCK based on CRISPR-Cas13a utilizes the non-specific shearing activity of LwaCas13a and combines with a Recombinant Polymerase Amplification (RPA) technology capable of efficiently amplifying a target fragment, thereby realizing the rapid and high-sensitivity detection of trace nucleic acid. With the intensive research on CRISPR/Cas systems, various CRISPR/Cas systems have been developed as a rapid, highly sensitive nucleic acid detection tool, and are rapidly developing due to their high flexibility, high sensitivity and specificity. With the continuous development of detection technology, the superiority of the detection method by using the CRISPR-Cas13a is gradually highlighted. The CRISPR-Cas13a detection platform is developed to become a new strategy for detecting pathogenic bacteria molecules.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

Therefore, there is a need to provide a crRNA and a kit for detecting pine wood nematode in order to solve the problem of detecting pine wood nematode.

One of the objects of the present invention is to provide a crRNA for detecting Bursaphelenchus xylophilus comprising a) a guide sequence such as at least one of SEQ ID NO 1-2, which is capable of hybridizing to a target RNA sequence, and b) a framework nucleic acid fragment that interacts with a Cas nuclease.

The invention also aims to provide a kit for detecting the bursaphelenchus xylophilus, which comprises the crRNA or DNA capable of transcribing the crRNA.

The invention realizes the detection of the nucleic acid of the pine wood nematode by using the CRISPR/Cas technology, has good detection specificity and high sensitivity, can realize high-sensitivity and high-precision molecular detection at the room temperature of 25-37 ℃, has better specificity and compatibility, and has low detection cost and convenient and quick operation. The detection limit value can reach 2.81 copies/mu L, which shows that the method has better sensitivity.

Drawings

FIG. 1 is a diagram showing the results of screening crRNA according to an embodiment of the present invention, in which 1 denotes crRNA-1, 2 denotes crRNA-2, 3 denotes crRNA-3, and N denotes negative control;

FIG. 2 is a diagram showing the result of specificity detection in accordance with one embodiment of the present invention, wherein Bx representsBursaphelenchusxylophilus(Bursaphelenchus xylophilus), Bm representsBursaphelenchusmucronatus(Bursaphelenchus xylophilus), N represents negative control;

FIG. 3 is a diagram showing the results of sensitivity tests according to an embodiment of the present invention, in which 1-7 covers 2.81X 10⁸copies/. mu.L to 2.81X 10²And (4) detecting the concentrations of copies/. mu.L, wherein N is negative control.

Detailed Description

To facilitate an understanding of the invention, the invention will now be described more fully with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

As used herein, the term "buffer" refers to an aqueous solution or composition that resists changes in pH when an acid or base is added to the solution or composition. This resistance to pH changes is due to the buffer properties of such solutions. Thus, a solution or composition that exhibits buffering activity is referred to as a buffer or buffer solution. Buffers generally do not have the unlimited ability to maintain the pH of a solution or composition. Rather, they are generally capable of being maintained at a pH within a specified range, such as pH 7 to pH 9. Generally, Buffers are capable of maintaining a pH at their pKa and within the next logarithm (see, e.g., Mohan, Buffers, A guide for the preparation and use of Buffers in biological systems, CALBIOCHEM, 1999). Buffers and buffer solutions are generally prepared from buffered salts or preferably non-ionic buffer components such as TRIS and HEPES. The buffer which can be used in the method of the invention is preferably selected from the group consisting of phosphate buffer, phosphate buffered saline buffer (PBS), 2-amino-2 hydroxymethyl-1, 3-propanediol (TRIS) buffer, TRIS buffered saline solution (TBS) and TRIS/edta (te).

As used herein, the term "amplification" when co-occurring in the context of the term "nucleic acid" refers to the production of multiple copies of a polynucleotide, or portion of a polynucleotide, typically starting from a small amount of the polynucleotide (e.g., as little as a single polynucleotide molecule), wherein the amplification product or amplicon is typically detectable. Amplification of polynucleotides includes a variety of chemical and enzymatic methods. The generation of multiple copies of DNA from one or a few copies of a target or template DNA molecule during Polymerase Chain Reaction (PCR), Rolling Circle Amplification (RCA) or Ligase Chain Reaction (LCR) is an amplified form. Amplification is not limited to the strict replication of the starting molecule. For example, the use of reverse transcription RT-PCR to generate multiple cDNA molecules from a limited amount of RNA in a sample is an amplified version. In addition, the production of multiple RNA molecules from a single DNA molecule during the transcription process is also an amplified version.

As used herein, the term "amplification primer" refers to an oligonucleotide, whether naturally occurring in a purified restriction digest or produced synthetically, that is capable of acting as a point of initiation of synthesis when placed under conditions to induce synthesis of a primer extension product that is complementary to a nucleic acid strand (e.g., in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH). The primer is preferably single stranded for maximum efficiency of amplification, but may alternatively be double stranded. If double stranded, the primers are first treated to separate their strands before being used to prepare extension products. Preferably, the primer is an oligodeoxyribonucleotide. The primer should be long enough to prime the synthesis of extension products in the presence of the inducing agent. The exact length of the primer will depend on many factors, including temperature, source of primer, and use of the method. For example, in some embodiments, the primer ranges from 10 to 100 or more nucleotides (e.g., 10 to 300, 15 to 250, 15 to 200, 15 to 150, 15 to 100, 15 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50 nucleotides, etc.).

In some embodiments, the primer comprises an additional sequence that does not hybridize to the target nucleic acid. The term "primer" includes chemically modified primers, fluorescently modified primers, functional primers (fusion primers), sequence specific primers, random primers, primers with specific and random sequences, and DNA and RNA primers.

As used herein, a "target sequence" is a sequence of bases in a target nucleic acid, and may refer to the sense strand and/or antisense strand of a double-stranded target, and, unless the context dictates otherwise, also encompasses the same sequence of bases as an extension product or amplification product of the original target nucleic acid that is regenerated or replicated in amplified copy number.

As used herein, the term "RPA", collectively referred to as recombinase polymerase amplification, is based on the principle that a recombinase, in combination with a primer, forms a protein-DNA complex that is capable of finding homologous sequences in double-stranded DNA. Once the primers locate the homologous sequences, strand exchange reaction formation occurs and DNA synthesis is initiated, and the target region on the template is exponentially amplified. The replaced DNA strand binds to SSB, preventing further replacement. In this system, a single synthesis event is initiated by two opposing primers. The entire process is carried out very quickly and detectable levels of amplification product are typically obtained within ten minutes.

In a first aspect of the invention there is provided a crRNA for detecting Bursaphelenchus xylophilus comprising a) a guide sequence, such as at least one of SEQ ID NOS: 1-2, capable of hybridizing to a target RNA sequence, and b) a framework nucleic acid fragment that interacts with a Cas nuclease.

In the present invention, the guide sequence may include SEQ ID NO: 1-2, or a nucleic acid fragment corresponding to at least one of SEQ ID NOs: 1-2 are substantially the same as each other.

Preferably, the guide sequence is SEQ ID NO 2.

By "substantially identical nucleic acid fragment" is meant a nucleic acid fragment that is capable of hybridizing to SEQ ID NO: 1-2, and a nucleic acid fragment to which the target sequence corresponds. Such nucleic acid fragments may be compared to SEQ ID NO: 1-2 substitutions, additions or deletions of 1, 2, 3 or more nucleobases or base analogs [ e.g., 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5- (carboxyhydroxymethyl) uracil, 5-fluorouracil, 5-bromouracil, Qnucleoside, etc. ], or a nucleic acid fragment in which some of the bases have certain modifications (e.g., methylation modifications, which are generally not critical for the hybridization of the gRNA to the target nucleic acid), preferably of a length of 18bp to 24 bp. "stringent conditions" used in the present invention are known, and include, for example, hybridization at 65 ℃ for 12 to 16 hours in a hybridization solution containing 400 mM NaCl, 40 mM PIPES (pH 6.4) and 1mM EDTA, followed by washing at 65 ℃ for 15 to 60 minutes with a washing solution containing 0.1% SDS and 0.1% SSC. This is familiar to the person skilled in the art.

Typically, one Cas nuclease interacting framework nucleic acid fragment is linked to only one guide sequence that binds to the target nucleic acid.

In a second aspect of the present invention, there is provided a kit for detecting bursaphelenchus xylophilus, which comprises the above-mentioned crRNA or DNA that is transcribable into the crRNA.

For the convenience of preservation and cost reduction, the DNA capable of being transcribed into the crRNA can be selected from the kit, and the crRNA is obtained through subsequent transcription.

In some embodiments, the DNA that can be transcribed into the crRNA is selected from at least one of SEQ ID NO 8-9, for example.

Preferably, the kit further comprises at least one of a Cas nuclease, a signaling reporter, a positive control, and a buffer for a CRISPR detection system.

In some embodiments, the Cas nuclease is selected from Cas 13.

CRISPR-Cas (clustered regularly interspaced short palindromic repeats) is a special class of nucleic acid protein complexes, generally having the activity of an RNA-degrading enzyme (RNase) or a DNA-degrading enzyme (DNase). Among them, Cas13 can bind and cleave RNA in Cas protein, which is an RNA-guided enzyme. CRISPR-Cas13 can be divided into four subtypes (A, B, C and D) according to phylogeny. This cleavage requires the participation of CRISPR RNA (crRNA). crRNA is RNA composed of an anchor sequence and a guide sequence, wherein the guide sequence is responsible for being combined with a characteristic single-stranded RNA through base complementary pairing to form hybrid RNA, a framework nucleic acid fragment interacted with Cas nuclease can assist the hybrid RNA to enter a specific structural domain of Cas13 to activate the enzyme digestion activity of Cas13, and further the characteristic single-stranded RNA is cut, after the cut, Cas13 can keep the activity, and other RNA molecules in the environment are subjected to non-specific cutting, which is called as 'lateral cutting'.

In some embodiments, the Cas nuclease is selected from at least one of Cas13a, Cas13b, Cas13c, and Cas13 d.

In some embodiments, the Cas nuclease is at least one of LshCas13a, LbuCas13a, and LwCas13 a.

The structure of the crRNA is 5 '-a framework nucleic acid fragment interacting with the Cas nuclease-guide sequence-3'.

Framework nucleic acid fragments interacting with Cas nucleases, which differ according to the source of Cas13a protein, are classified as:

GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC against LwCas13a (SEQ ID NO: 4);

GGCCACCCCAAUAUCGAAGGGGACUAAAAC against LshCas13a (SEQ ID NO: 5);

GACCACCCCAAAAAUGAAGGGGACUAAAAC against LbuCas13a (SEQ ID NO: 6).

In some embodiments, Cas13a is LwaCas13a and the framework nucleic acid fragment that interacts with Cas nuclease is shown in SEQ ID No. 4.

The positive control is usually in the form of a plasmid containing the target sequence corresponding to the crRNA.

In some embodiments, the signaling reporter molecule is a signaling reporter RNA molecule, which is an RNA molecule with signaling reporting functions that, when the RNA sequence therein is degraded, reports a positive signal and is detected.

In some embodiments, the signaling reporter RNA molecule is labeled at the 5 'end with a fluorescence emitting group and at the 3' end with a quenching group.

In some embodiments, the fluorescent emitting group is selected from any one of FAM, HEX, TET, NED, ROX, CY5, CY3, Texas Red, TFAM, SYBR Green I, VIC, and JOE.

In some embodiments, the quencher group is selected from any one of TAMRA, BHQ, Dabcyl, Eclipse, and NFQ-MGB.

In some embodiments, the signaling reporter RNA molecule is labeled with different labels at both ends, respectively, a first label and a second label. As such, the first label is separated from the second label when the signaling reporter RNA molecule is cleaved by the CRISPR detection system.

In some embodiments, the kit further comprises a reagent strip for interacting with the signaling reporter RNA molecule and displaying a signaling result of the signaling reporter RNA molecule.

In some embodiments, the test strip comprises a sample pad, a reaction membrane and an absorption pad, wherein the reaction membrane is provided with a detection area and a quality detection area;

wherein:

the detection area is fixedly coated with a signal substance, and the signal substance is marked with a first anti-label aiming at the first label;

the quality detection area is fixedly coated with an antibody aiming at the second marker;

the first label and the first anti-label are capable of forming a label-anti-label complex, and the first anti-label is different from the antibody to the second label.

In some embodiments, the combination of label/anti-label in the label-anti-label complex is selected from the group consisting of biotin or a derivative thereof/streptavidin, biotin or a derivative thereof/avidin, biotin or a derivative thereof/neutravidin, hapten/antibody, antigen/antibody, receptor/ligand, digoxin/digoxigenin, carbohydrate/lectin and polynucleotide/complementary polynucleotide.

Wherein the derivative of biotin is any one of D-biotin, activated biotin, biocytin, ethylenediamine biotin, cadaverine biotin and desthiobiotin.

Where the antigen and hapten may be polypeptides, they may also be proteins or protein subunits, and such proteins or protein subunits may themselves be antibodies or antibody fragments.

An "antibody" is a substance that binds to its antigen. The term can include polyclonal and monoclonal antibodies, and the term "antibody fragment" includes antigen-compound binding fragments of these antibodies, including Fab, F (ab') 2, Fd, Fv, scFv, diabodies, and minimum recognition units of antibodies, as well as single chain derivatives of these antibodies and fragments, such as scFv-Fc and the like. The type of antibody can be selected from IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD. Furthermore, the term "antibody" includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, chimeric (chimeric), bifunctional (bifunctional), humanized (humanized) antibodies and human antibodies, as well as related synthetic isomeric forms (isoantibodies).

The reaction membrane is typically a microfiltration membrane, such as an NC membrane.

The protein family of the biotin/biotin pool, as well as digoxigenin/digoxigenin, are preferred in the present invention.

The biotin-binding protein family includes streptavidin (streptavidin), avidin (avidin), and neutravidin (neutravidin) described above, each of which is capable of binding four biotin molecules with a high degree of affinity and specificity. Among these, streptavidin, which is not glycosylated and has a very low level of non-specific binding, is most commonly used. Avidin is a highly cationized glycoprotein with an isoelectric point of about 10.5, and its positively charged residues and oligosaccharide components can mediate non-specific binding, resulting in a problem of high background in some applications. Neutravidin undergoes deglycosylation and a lowering of the isoelectric point, thereby reducing its background coloration.

Digoxigenin can be an antibody.

In some embodiments, a signal substance refers to any atom or molecule that can be used to provide a detectable (preferably quantifiable) effect and that can be attached to a nucleic acid. Signal substances include, but are not limited to, dyes(ii) a Radiolabels, e.g.³²P; binding moieties such as biotin; haptens such as digoxin; a luminescent, phosphorescent, or fluorescent moiety; and a fluorescent dye alone or in combination with a portion of the emission spectrum that can be suppressed or shifted by Fluorescence Resonance Energy Transfer (FRET). The signal substance may provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, or the like. The signal species may be a charged moiety (positive or negative) or alternatively, may be charge neutral. The signal substance may comprise or be a combination of nucleic acid or protein sequences, as long as the sequence comprising the label is detectable. In some embodiments, the nucleic acid is detected directly (e.g., direct sequence read) without a label.

In some embodiments, the signal species is a fluorophore, colorimetric label, colloidal gold, quantum dot, biotin, and other label molecules that can be used for detection (e.g., alkyne groups for raman diffraction imaging, cyclic olefins for click reactions, priming groups for polymer labeling), and can also be selected from at least one of polypeptide/protein molecules, LNA/PNA, unnatural amino acids and their analogs (e.g., peptidomimetics), unnatural nucleic acids and their analogs (nucleomimetics), and nanostructures (including inorganic nanoparticles, NV-centers, aggregation/assembly-induced emission molecules, rare earth ion ligand molecules, polyoxometalate, etc.).

In some embodiments, one of the labels is a fluorophore.

In some embodiments, the fluorophore may be selected from the group consisting of fluorescein-based dyes, rhodamine-based dyes, and cyanine dyes.

In some embodiments, the fluorescein-based dye includes standard fluorescein and its derivatives, such as Fluorescein Isothiocyanate (FITC), hydroxyfluorescein (FAM), tetrachlorofluorescein (TET), and the like.

In some embodiments, the rhodamine-based dye includes R101, tetraethylrhodamine (RB 200), carboxytetramethylrhodamine (TAMRA), and the like.

In some embodiments, the cyanine dyes are selected from two classes, one class being Thiazole Orange (TO), oxazole orange (YO) series and dimer dyes thereof, and the other class being cyanine dyes of the polymethine series.

In some embodiments, the fluorophore may also be selected from the following dyes: stilbene, naphthalimide, coumarins, acridines, pyrenes, and the like.

Preferably, the second marker is biotin.

Preferably, the signal substance is colloidal gold.

In some embodiments, the first label is a fluorophore, the second label is biotin, and the signaling substance is colloidal gold.

In some embodiments, the kit further comprises at least one of RNA polymerase, amplification primers, DNA polymerase, amplification buffer, sample pre-treatment reagents, and water.

Wherein the amplification primer is used for amplifying the nucleic acid segment containing the crRNA targeting sequence.

The RNA polymerase is used to transcribe DNA that is transcribable into the crRNA into crRNA.

In some embodiments, the DNA polymerase is selected from any of Taq, Bst, Vent, Phi29, Pfu, Tru, Tth, Tl1, Tac, Tne, Tma, Tih, Tf1, Pwo, Kod, Sac, Sso, Poc, Pab, Mth, Pho, ES4 DNA polymerase, Klenow fragment.

In some embodiments, the sample pretreatment reagent comprises a reagent for extracting DNA, and such a reagent is further preferably a reagent that can be used for extraction by phenol chloroform method, NaOH method, resin extraction method, salting out method, cetyltrimethylammonium bromide method, silica gel membrane adsorption method, FTA card method, silica bead method, or magnetic bead extraction method.

Wherein:

the phenol chloroform method generally refers to a DNA extraction method in which a protein-like organic substance in a DNA solution is extracted by a phenol chloroform mixture, and the DNA is retained in an aqueous solution.

The NaOH method generally comprises the steps of dissolving and denaturing protein by strong alkali, destroying cell membranes and nuclear membranes, denaturing nuclease and releasing DNA, wherein NaOH does not destroy the primary structure of the DNA.

The resin extraction method is usually a Chelex100 method, and is a DNA extraction method for inactivating nuclease degrading DNA by chelating magnesium, sodium and potassium ions by Chelex.

The salting-out method is generally carried out by disrupting cells and centrifuging, then precipitating the protein with about 6M saturated NaCl, precipitating the DNA in the supernatant from the centrifugation with anhydrous ethanol, and dissolving the DNA in TE.

The cetyltrimethylammonium bromide method is generally a DNA extraction method in which a nonionic detergent CTAB destroys cell walls and cell membranes and hard tissues, forms a complex with DNA, and separates DNA from proteins and polysaccharides.

The silica gel membrane adsorption method generally refers to a method for extracting and purifying DNA by adsorbing cell lysate to release DNA after cracking through a silica gel membrane, and removing impurities such as protein, lipid, polysaccharide and the like through protease digestion and rinsing liquid cleaning.

The FTA card method generally refers to a method for obtaining DNA from blood and oral epithelial cells by the lysis of cells by the FTA card to release the DNA.

The silica bead method generally refers to a DNA extraction method in which DNA molecules in an organic solution are specifically captured by silica microparticles in the presence of high concentration of guanidine thiocyanate.

The magnetic bead method generally refers to a method for extracting and purifying DNA, in which a layer of magnetic beads of magnetic resin is coated on the surface of silica gel in the presence of guanidine salt, and DNA is released after cell lysis is specifically adsorbed and lysed.

In some embodiments, the water is typically nucleic acid and/or nuclease-free water, such as double distilled or deionized water.

In some embodiments, the amplification primers are specific primers.

Preferably, the amplification is based on an RPA reaction. The kit contains an RPA reaction reagent. The RPA reaction allows for rapid amplification. The RPA reaction reagent comprises buffer solution, RPA primer and magnesium acetate.

In some embodiments, the upstream primer of the RPA primer may be added with a promoter sequence at the 5' end for subsequent in vitro transcription of the amplified product.

The promoter can be selected from T7, T3, SP6 and the like, and is preferably T7 promoter.

It should be noted that the template (to-be-detected fragment) of the RPA reaction of the present invention may be DNA or RNA; when the template is RNA, an RPA enzyme premix for RNA is used to perform the reverse transcription function.

The present invention also relates to a vector system comprising one or more vectors comprising: a first regulatory element operably linked to a nucleotide fragment encoding a Cas nuclease and a second regulatory element operably linked to a nucleotide fragment encoding a crRNA as described above.

The Cas nuclease is capable of specifically cleaving a target sequence in coordination with the crRNA.

The Cas nuclease may be on the same or different vector as the crRNA.

The invention also relates to a method of killing bursaphelenchus xylophilus comprising cleaving a target DNA using a CRISPR-Cas nuclease system to alter expression of a gene product;

the CRISPR-Cas nuclease system comprises a crRNA as described above and/or a vector system as described above.

The gene product is preferably a bursaphelenchus xylophilus-associated protein.

According to a third aspect of the invention, the invention also relates to the use of a crRNA as described above, or a kit as described above, for detecting pine wood nematodes or pine wood nematode disease.

Pine wood nematode disease (1)Bursaphelenchusxylophilus) Belongs to the phylum nematoda, class nematoda, order Lepidoptera, family Lepidaceae, genus Lepidium. The length of the female worm body is about 0.81mm, the length of the male worm body is about 0.73mm, the tail of the female worm is nearly conical, and the tail end of the female worm is round; the tail of the male insect is similar to a bird claw and is bent towards the ventral surface.

The detectable pine wood nematodes of the present invention are derived from pine or other non-pine plants or non-plants.

The pine tree is selected from Pinus massoniana, Pinus tabulaeformis, Pinus bungeana, Pinus armandii, Pinus koraiensis, Pinus sylvestris, and Cedar.

Such use may be for diagnostic or non-diagnostic purposes.

The application can be used for preventing and treating the pine wilt disease caused by the pine nematode, also known as pine wilt disease.

The following are specific examples.

Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated. Unless otherwise indicated, reagents and materials used in the following examples are commercially available.

Unless otherwise indicated, the present invention employs immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, recombinant DNA and the like, which are within the ordinary skill of the art.

Test example 1 establishment of CRISPR-Cas13a visualization assay reaction System

1. Experimental methods

1.1 design of crRNA of specific targeting bursaphelenchus xylophilus 5S ribosomal RNA Gene

The design of LwaCas13a crRNA targeting the 5S ribosomal RNA gene follows five principles:

(1) the crRNA sequence format is: 5 '-framework nucleic acid fragment interacting with LwaCas13a nuclease-guide sequence-3'. The sequence of the framework nucleic acid fragment interacting with LwaCas13a nuclease was GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC (SEQ ID NO: 4);

(2) ligating the framework nucleic acid fragment that interacts with LwaCas13a nuclease to a guide sequence to generate an intact crRNA;

(3) the guide sequence of the crRNA should be reverse complementary to the target site in the target RNA;

(4) the guide sequence of crRNA is 28 bases long, and can be placed at any position in the RAA amplification product, but does not overlap with the RPA primer;

(5) the guide sequence of crRNA has and allows for a single base mismatch when only a single base is different.

Based on the existing fragment amplified by the RPA primer of the pine wood nematode 5S ribosomal RNA gene, three guide sequences and crRNAs which are reversely complementary with a target RNA sequence are respectively designed according to the design principle, and one crRNA is finally selected as a common sequence through the optimization of subsequent experimental conditions and the judgment of visual effect.

The guide sequence is:

GAACCGUAUUUUAGAUGGUAUAUCAUGA(SEQ ID NO:1)；

UCAAAAAAGUCAAAAACGCGUACGCCAC(SEQ ID NO:2)；

UAUUUUAAUUCAUGAUAUACCAUCUAAA(SEQ ID NO:3)。

the corresponding crRNA sequences are:

crRNA-1、GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGAACCGUAUUUUAGAUGGUAUAUCAUGA(SEQ ID NO:7)

crRNA-2、GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCAAAAAAGUCAAAAACGCGUACGCCAC(SEQ ID NO:8)

crRNA-3、GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUAUUUUAAUUCAUGAUAUACCAUCUAAA(SEQ ID NO:9)。

1.2 preparation of crRNA

For the convenience of storage and amplification requirements of subsequent experiments, the invention synthesizes crRNA into DNA, and the DNA is transcribed into crRNA in vitro when in use: and the T7 promoter sequence (SEQ ID NO:13- -GAAATTAATACGACTCACTATAGGG) needs to be added 5'. The DNA sequence was synthesized by Shanghai Bioengineering Co., Ltd. The DNA sequences for transcription into crRNA are shown in table 1 below.

TABLE 1 DNA sequences for transcription into crRNA

Annealing the DNA template of crRNA to double stranded DNA using rTaq 10 × PCR buffer (TaKaRa), annealing system: crRNAs IVT tempales (10 uM) 1ul, T7-3G IVT (10 uM) 1ul, 10 XPCR buffer 1ul, DEPCH₂O was made up to 10ul as a whole. Carrying out an annealing reaction, wherein the annealing procedure comprises the following steps: 5min at 95 ℃; 94 ℃ to 25 ℃ (0.1 ℃/s).

According to High Scribe T7 Quick High Yield RNASynthesis Kit (New England Biolabs) described the addition of 10ul rNTP buffer mix, 2ul T7RNA polymerase mix and 8ul DEPC H to the annealed product from the previous step₂And O. Transcribing the double-stranded DNA into crRNA by incubation at 37 ℃ overnight; then 20 ul DEPCH was added₂O, 2ul DNase I, 37 ℃ for 15 min. RNA Clean was then used according to the manufacturer's instructions&The crRNA was purified using the Concentrator Kit (APExBIO) and DEPC H₂Adjusting the concentration of O to 10 ng/ul (split into 50ul per tube and stored at-80 ℃).

1.3 construction of Standard (Positive control)

Extracting the pine wood nematode genome DNA by a CTAB method and reserving at-20 ℃ for later use.

Using the obtained genomic DNA as a template, a conventional PCR reaction was performed on the 5S ribosomal RNA gene fragment. Reaction system: 2 Xsan Taq PCR Mix 25. mu.L, upstream primer (10. mu.M) 2. mu.L, downstream primer (10. mu.M) 2. mu.L, DNA template 1. mu.L, dd H₂O is supplemented to 50 mu L; reaction conditions are as follows: 5min at 94 ℃; 30 cycles at 94 ℃ for 30s, 55 ℃ for 30s, 72 ℃ for 20 s; 10min at 72 ℃; infinity at 4 ℃. And performing gel electrophoresis on the obtained product, cutting the gel, recovering and purifying the target fragment.

Connecting the target fragment with a pMD-19T cloning vector, transforming the pMD-19T cloning vector into escherichia coli DH5 alpha competent cells, screening positive cloning strains, shaking the strains overnight, extracting plasmids and sequencing, and naming the positive plasmids with correct sequence identification as pMD-19T Bx-5S for later use at-20 ℃. The plasmid concentration was determined and 10-fold gradient dilution was performed as a standard for CRISPR-Cas13a visual detection method.

1.4 recombinant polymerase amplification (RAA)

According to the (RAA) kit instruction, 47.5 muL of system shown in Table 2 is added into each tube of reaction dry powder water, so that the freeze-dried powder is fully and uniformly redissolved. Adding 2.5 μ L of 280m M magnesium acetate solution to the tube cap of each reaction tube, covering the tube cap, flicking with finger to mix the reagents in the tube, centrifuging at low speed for 3-5s, and reacting at 37 deg.C for 40 min.

TABLE 2 RAA System

1.5 detecting DNA of pine wood nematode based on CRISPR-Cas13a system

The reaction system is shown in Table 3, and the specific crRNA adopts the crRNA-2 prepared by 1.2 steps.

Replacement of RAA amplification products in Table 3 with DEPC H₂And O, and keeping other reagent components unchanged, namely, the negative control.

TABLE 3 CRISPR-Cas13a detection System

The PCR tube containing 20. mu.L of the system shown in Table 3 was placed in an incubator at 37 ℃ for 1 hour.

Add 30. mu. LDEPC H to post-reaction PCR tube₂And O, inserting the test strip into the tube, standing for 2-3 minutes, and reading the result. Wherein, the signal report RNA molecule is FAM-RNA-biotin. The detection area of the test strip is fixedly coated with colloidal gold, and anti-FAM antibodies are marked on the colloidal gold; the quality detection area is fixedly coated with biotin ligand.

And (4) judging a result: for a negative sample, the colloidal gold particle anti-FAM antibody is fully coupled with FAM-RNA-biotin reporter molecules, the conjugate is intercepted by biotin ligand in a quality detection area, only the strip in the quality detection area is colored, and the strip in the detection area is not colored; for positive samples, FAM-RNA-biotin reporter was cleaved by Cas13a, and the gold colloidal particle-anti-FAM antibody-FAM conjugate accumulated at the detection zone, developed color at the detection zone, and reduced or even no color at the quality control zone.

2. Test results

2.1 selection of crRNA

The best cr RNA was selected by observing the visual effect of the reaction of 3 cr RNAs in FIG. 1.

The results are shown in FIG. 1: the crRNA-3 (SEQ ID NO: 9) test line has NO color development, the crRNA-1 (SEQ ID NO: 7) lateral flow test strip has a color development band but is not obvious, the crRNA-2 (SEQ ID NO: 8) color development effect is optimal, and the negative control is established. This was used as a common crRNA sequence for subsequent experiments. The results also demonstrate that the CRISPR-Cas13a lateral flow detection method can be used for directly detecting the bursaphelenchus xylophilus visually.

2.2 construction of plasmid standards

The general PCR reaction is carried out on the genome DNA of the pine wood nematode to obtain a single band with the length of 556 bp. The product is cloned and sequenced after being recovered and purified by glue, the result is completely consistent with the expectation, and the successfully constructed positive plasmid is named pMD-19T Bx-5S and is stored at the temperature of minus 20 ℃ for later use. The OD value of the plasmid standards was determined using a spectrophotometer as follows: 287.7ng/ul, and diluting to 100 ng/ul. Copy number calculation formula: copies (. mu.L) ═ 6.02X 10²³X concentration x10^-9) /(660X base number), the copy number of the 100ng/ul pMD-19T Bx-5S standard was 2.81X 10 as calculated by the formula¹⁰copies/ul。

Test example 2 specificity and sensitivity test

1. Test method

1.1, specificity test

Extracting genome DNA of the pine wood nematode and the pine wood nematode by a CTAB method. RAA pre-amplification is carried out by taking the genome DNA as a template, and CRISPR-Cas13a lateral flow test strip detection is carried out by applying the system established in the experimental example 1, and meanwhile, negative control is set, so that the specificity of the method is verified.

1.2 sensitivity test

pMD-19T Bx-5S standard plasmid (2.81X 10S) diluted in 10-fold gradient⁸copies/μL-2.81×10²copies/mu L) as a template, DEPC water is used as a negative control, and the lowest concentration of a test line without an obvious strip is used as the sensitivity of the detection method.

2. And (5) testing results.

2.1, result of specificity detection

The specificity of CRISPR-Cas13a lateral flow detection by detection of bursaphelenchus xylophilus and bursaphelenchus xylophilus, respectively, was evaluated.

The detection result is shown in fig. 2, the color development of the detection zone strip only appears on the test strip for detecting the pine wood nematode, the test strips for detecting the pine wood nematode are judged to be negative, and the result proves that the detection method established by the invention has good specificity.

2.2 sensitivity test results

Standard plasmids were subjected to 10-fold gradient dilution for detection of the sensitivity of the method, and the concentrations of the electrophoretic bands 1 to 7 were 2.81X 10 in this order⁸copies/μL、2.81×10⁷copies/μL、2.81×10⁶copies/μL、2.81×10⁵copies/μL、2.81×10⁴copies/μL、2.81×10³copies/μL、2.81×10²The detection result is shown in figure 3, and the lowest detection limit can reach 2.81 multiplied by 10³copies/. mu.L, which shows that the method of the invention has better sensitivity.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, so as to understand the technical solutions of the present invention specifically and in detail, but not to be understood as the limitation of the patent protection scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the patent of the invention is subject to the appended claims, and the description can be used for explaining the contents of the claims.

Sequence listing

<110> Beijing university of forestry

<120> crRNA for detecting pine wood nematode and kit

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 28

<212> RNA

<213> Artificial Sequence

<400> 1

gaaccguauu uuagauggua uaucauga 28

<210> 2

<211> 28

<212> RNA

<213> Artificial Sequence

<400> 2

ucaaaaaagu caaaaacgcg uacgccac 28

<210> 3

<211> 28

<212> RNA

<213> Artificial Sequence

<400> 3

uauuuuaauu caugauauac caucuaaa 28

<210> 4

<211> 36

<212> RNA

<213> Artificial Sequence

<400> 4

gauuuagacu accccaaaaa cgaaggggac uaaaac 36

<210> 5

<211> 30

<212> RNA

<213> Artificial Sequence

<400> 5

ggccacccca auaucgaagg ggacuaaaac 30

<210> 6

<211> 30

<212> RNA

<213> Artificial Sequence

<400> 6

gaccacccca aaaaugaagg ggacuaaaac 30

<210> 7

<211> 64

<212> RNA

<213> Artificial Sequence

<400> 7

gauuuagacu accccaaaaa cgaaggggac uaaaacgaac cguauuuuag augguauauc 60

auga 64

<210> 8

<211> 64

<212> RNA

<213> Artificial Sequence

<400> 8

gauuuagacu accccaaaaa cgaaggggac uaaaacucaa aaaagucaaa aacgcguacg 60

ccac 64

<210> 9

<211> 64

<212> RNA

<213> Artificial Sequence

<400> 9

gauuuagacu accccaaaaa cgaaggggac uaaaacuauu uuaauucaug auauaccauc 60

uaaa 64

<210> 10

<211> 89

<212> DNA

<213> Artificial Sequence

<400> 10

gaaccgtatt ttagatggta tatcatgagt tttagtcccc ttcgtttttg gggtagtcta 60

aatcccctat agtgagtcgt attaatttc 89

<210> 11

<211> 89

<212> DNA

<213> Artificial Sequence

<400> 11

gtggcgtacg cgtttttgac ttttttgagt tttagtcccc ttcgtttttg gggtagtcta 60

aatcccctat agtgagtcgt attaatttc 89

<210> 12

<211> 89

<212> DNA

<213> Artificial Sequence

<400> 12

tttagatggt atatcatgaa ttaaaatagt tttagtcccc ttcgtttttg gggtagtcta 60

aatcccctat agtgagtcgt attaatttc 89

<210> 13

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 13

gaaattaata cgactcacta taggg 25

Claims

1. crRNA for detecting Bursaphelenchus xylophilus, comprising a) a guide sequence of one of SEQ ID NOS: 1-2, which is capable of hybridizing to a target RNA sequence, and b) a framework nucleic acid fragment that interacts with a Cas nuclease.

2. The crRNA of claim 1, wherein the guide sequence is SEQ ID NO 2.

3. A kit for detecting a pine wood nematode, comprising the crRNA or the DNA transcribable into the crRNA of any one of claims 1 to 2;

further comprising at least one of a Cas nuclease, a signaling reporter, a positive control, and a buffer for a CRISPR detection system.

4. The kit according to claim 3, wherein the DNA capable of transcribing the crRNA is selected from one of SEQ ID NOS: 10 to 11.

5. The kit of claim 3, wherein the Cas nuclease is selected from Cas 13;

the framework nucleic acid fragment interacting with the Cas nuclease is shown as SEQ ID NO. 4.

6. The kit according to any one of claims 3 to 5, wherein the signaling reporter molecule is a signaling reporter RNA molecule, and the signaling reporter RNA molecule is an RNA molecule having a signaling reporting function, and when an RNA sequence therein is degraded, a positive signal is reported and detected.

7. The kit of claim 6, comprising a strip for interacting with the signaling reporter RNA molecule and displaying a signal result of the signaling reporter RNA molecule.

8. The kit of claim 7, wherein the signaling reporter RNA molecule is labeled at each end with a first label and a second label, such that when the signaling reporter RNA molecule is cleaved by the CRISPR detection system, the first label is separated from the second label;

the test strip comprises a sample pad, a reaction membrane and an absorption pad, wherein the reaction membrane is provided with a detection area and a quality detection area;

wherein:

9. The kit of claim 8, wherein the signal substance is selected from at least one of fluorophores, colorimetric labels, quantum dots, colloidal gold, biotin, alkyne groups for raman diffraction imaging, cyclic olefins for click reactions, priming groups for polymer labeling, polypeptide/protein molecules, LNA/PNA, unnatural amino acids and analogs thereof, unnatural nucleic acids and analogs thereof, and nanostructures;

the nanostructure includes an inorganic nanoparticle, an NV-center, an aggregation/assembly-induced emission molecule, a rare earth ion ligand molecule, and a polyoxometalate.

10. The kit of claim 8, further comprising at least one of RNA polymerase, amplification primers, DNA polymerase, amplification buffer, sample pre-treatment reagents, and water;

wherein the amplification primer is used for amplifying the nucleic acid fragment containing the crRNA targeting sequence.