CN113528661A - Primer for amplifying CTLA4 gene SNP site, detection kit and application - Google Patents

Primer for amplifying CTLA4 gene SNP site, detection kit and application Download PDF

Info

Publication number
CN113528661A
CN113528661A CN202110198419.2A CN202110198419A CN113528661A CN 113528661 A CN113528661 A CN 113528661A CN 202110198419 A CN202110198419 A CN 202110198419A CN 113528661 A CN113528661 A CN 113528661A
Authority
CN
China
Prior art keywords
primer
snp
ctla4 gene
ctla4
amplifying
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110198419.2A
Other languages
Chinese (zh)
Inventor
马凯
高丽娟
田彦捷
胡丹丹
刘清珺
夏勇其
魏颖
朱博兰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BEIJING CENTER FOR PHYSICAL AND CHEMICAL ANALYSIS
Original Assignee
BEIJING CENTER FOR PHYSICAL AND CHEMICAL ANALYSIS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BEIJING CENTER FOR PHYSICAL AND CHEMICAL ANALYSIS filed Critical BEIJING CENTER FOR PHYSICAL AND CHEMICAL ANALYSIS
Priority to CN202110198419.2A priority Critical patent/CN113528661A/en
Publication of CN113528661A publication Critical patent/CN113528661A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a primer for amplifying CTLA4 gene SNP sites, a detection kit and application, belonging to the technical field of genotyping detection. A primer for amplifying CTLA4 gene SNP sites comprises an upstream primer shown as SEQ ID NO. 1 and a downstream primer shown as SEQ ID NO. 2. The invention also provides a primer group for detecting the genotype of the CTLA4 gene SNP site, which comprises the primer for amplifying the CTLA4 gene SNP site and a single base extension primer. The primer group detects the rs4553808 site of CTLA4 gene based on the SNaPshot SNP typing technology, and can accurately obtain the SNP genotypes of CTLA4 genes of different samples, so the primer group is applied to the detection of the polymorphism of the gene site for guiding the prednisone medication, and simultaneously lays a foundation for the research of adjuvant selection of chemotherapy medication of multiple myeloma patients.

Description

Primer for amplifying CTLA4 gene SNP site, detection kit and application
Technical Field
The invention belongs to the technical field of genotyping detection, and particularly relates to a primer for amplifying CTLA4 gene SNP sites, a detection kit and application.
Background
Multiple Myeloma (MM) is the second major malignancy of the blood system, usually manifested by hyperproliferation of plasma cells in the bone marrow, and the tumor cells produce large amounts of monoclonal immunoglobulin and appear in the blood and/or urine of patients, called M protein, causing a series of clinical changes such as bone pain, pathological fractures, hematopoietic abnormalities, monoclonal globulinemia, and impaired renal function. At present, MM can not be cured, the survival time of a patient is only prolonged by 5-7 years by means of drug treatment, and the combination of bortezomib, melphalan and prednisone (called MP scheme) is a common chemotherapy scheme of clinical treatment.
The SNaPshot genotyping technology is developed by ABI company in America based on the principle of fluorescence labeling single-base extension chain termination reaction, has the characteristics of high detection speed, accurate detection and high sensitivity, and can be used for detecting by using 0.5ng of DNA. The principle is that in a reaction system containing sequencing enzyme, four kinds of fluorescence labeled ddNTP, extending primers with different lengths close to the 5' -end of an SNP site and template DNA, the primer is extended by one base, namely, the primer is terminated, after the primer is detected by a sequencer, the SNP site corresponding to the extending product is determined according to the position of a peak, and the type of the doped base can be obtained according to the color of the peak, so that the genotype of the sample is determined.
However, there are no reports of clinical-assisted detection of multiple myeloma genotypes using the SNaPshot genotyping technique.
Disclosure of Invention
In view of the above, the invention aims to provide primers for amplifying CTLA4 gene SNP sites, a detection kit and application, which are used for detecting rs4553808 site polymorphism of CTLA4 gene capable of affecting side effects of multiple myeloma patients after MP scheme treatment based on a SNaPshot genotyping technology, determining the genotype of the multiple myeloma patients and providing a basis for subsequent drug selection.
The invention provides a primer for amplifying CTLA4 gene SNP sites, which comprises an upstream primer and a downstream primer;
the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 1;
the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2.
The invention provides a primer group for detecting CTLA4 gene SNP site genotype based on a SNaPshot SNP typing technology, which comprises a primer for amplifying CTLA4 gene SNP sites and a single base extension primer;
the nucleotide sequence of the single base extension primer is shown as SEQ ID NO. 3.
The invention provides application of the primer or the primer group for amplifying CTLA4 gene SNP sites in drug for assisting in selecting chemotherapy for multiple myeloma patients.
The invention provides application of the primer or the primer group for amplifying CTLA4 gene SNP locus in detecting the gene locus polymorphism for guiding prednisone medication.
The invention provides a kit for detecting CTLA4 gene SNP site genotype based on a SNaPshot SNP typing technology, which comprises a primer or a primer group for amplifying CTLA4 gene SNP sites.
The invention provides a kit for detecting CTLA4 gene SNP locus genotype based on the SNaPshot SNP typing technology, which also comprises 1 xHotStarTaq buffer and Mg2+dNTP, HotStarTaq polymerase and SNaPshot Multiplex Kit.
The invention provides application of a kit for detecting CTLA4 gene SNP locus genotype based on a SNaPshot SNP typing technology in detecting the gene locus polymorphism for guiding prednisone medication.
The invention provides application of a kit for detecting CTLA4 gene SNP site genotype based on a SNaPshot SNP typing technology in assisting selection of chemotherapy drugs for multiple myeloma patients.
The invention provides a method for detecting CTLA4 gene SNP locus genotype, which comprises the following steps:
1) extracting the genome DNA of a sample to be detected;
2) taking the genomic DNA extracted in the step 1) as a template, and carrying out PCR amplification by using primers on the amplified CTLA4 gene SNP sites to obtain a PCR amplification product;
3) carrying out single base extension reaction on the PCR amplification product under the action of a single base extension primer in the primer group to obtain an extension product;
4) sequencing the extension product to obtain the CTLA4 gene SNP genotype of the sample to be detected.
Preferably, the reaction procedure of the PCR amplification in the step 2) is 95 ℃ and 5 min; at 94 ℃ for 20s, 60 ℃ for 30s, 75 ℃ for 1.5min, and 31 cycles; 72 ℃ for 2 min;
the reaction system for PCR amplification in the step 2) is 10 ul, and comprises 1 xHotStarTaq buffer1 ul and 25mM Mg2+Mu.l of 0.6. mu.l, 10mM dNTP 0.2. mu.l, 1U HotStarTaq polymerase 0.15. mu.l, 1. mu.l of sample DNA and 1. mu.M of upstream primer 0.5. mu.l and 1. mu.M of downstream primer 0.5. mu.l, ddH2O was supplemented to 10. mu.l.
The reaction system of the single base extension reaction in the step 3) is 10 mul, and comprises 5 mul of SNaPshot Multiplex Kit, 2 mul of PCR amplification product, 1 mul of extension primer with the concentration of 1 mul and 2 mul of ultrapure water;
reaction procedure for the single base extension reaction described in step 3): at 96 deg.C for 1 min; 96 ℃ for 10s, 55 ℃ for 5s, 60 ℃ for 30s, 28 cycles.
The primer for amplifying CTLA4 gene SNP sites is a specific PCR amplification primer designed aiming at CTLA4 gene rs4553808 sites, can accurately amplify CTLA4 gene segments containing rs4553808 sites, and has the characteristics of high specificity and accurate amplification.
The primer group for detecting the SNP locus genotype of the CTLA4 gene is designed based on a SNaPshot SNP typing technology. Experiments show that the primer group provided by the invention is adopted to detect the CTLA4 gene SNP site genotype, the detection results of 20 cases of physical examination samples are completely consistent with the results of a Sanger sequencing method, and the detection accuracy of the primer group provided by the invention is 100 percent. The primer group provided by the invention has the characteristic of high accuracy in detection result, and has incomparable advantages compared with the problem that the detection result is inaccurate easily caused by the interference of noise peaks at the early stage of the sequencing reaction of the first generation sequencing. Meanwhile, according to a sequencing peak image, the primer peak disappears, the product is fully amplified, the high ratio of the result peak of each genotype is clear, the results are separated from each other and are not intersected with each other, and the primer provided by the invention has good specificity and repeatability and high sensitivity. In addition, the primer group provided by the invention also has the advantage of low detection cost, and the defects that the cost of the probe can be balanced only by detecting a large number of samples due to high price of the probe used in the TaqMan qPCR method are avoided.
The method for detecting the SNP locus genotype of the CTLA4 gene provided by the invention is used for detecting by using the primer amplification and the single-base extension primer, and can accurately detect that the SNP locus genotype of the rs4553808 locus of the CTLA4 gene of a sample to be detected is AA or AG. Experiments show that the proportions of the genotypes appearing in 20 samples are AA (75.0%) and AG (25.0%), which are basically consistent with AA (76.7%), AG (23.3%) and GG (0.0%) in the data of Chinese Han nationality in thousand human genes, and the detection method provided by the invention has higher detection accuracy. Meanwhile, the method has high sensitivity, can be realized only by 0.5ng of DNA, and is widely applicable to trace DNA samples such as blood cards, oral test strips and the like. In addition, the method provided by the invention has high detection efficiency, the whole experimental process is completed within 6 hours, and the defects of large quantity of lowest sequencing samples and long time consumption of high-throughput sequencing are overcome.
Drawings
FIG. 1 is a graph of the typing statistics of a test sample according to the present invention;
FIG. 2 is a diagram showing the result of detecting the heterozygous genotype of AG in a sample according to the present invention;
FIG. 3 is a diagram showing the result of detecting the AA homozygous genotype of the sample according to the present invention.
Detailed Description
The invention provides a primer for amplifying CTLA4 gene SNP sites, which comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 1 (ACGTTGGATGACAACCTAATGGGCACTTCC); the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2 (ACGTTGGATGCTGTGTGTTCCTCTTGAGGG). The primer is an amplification primer designed aiming at the site rs4553808 of the CTLA4 gene, and can be used for accurately amplifying to obtain a CTLA4 gene fragment containing an SNP molecular marker of the site rs 4553808. The source of the primer is not particularly limited in the present invention, and a gene synthesis method well known in the art may be used. In the examples of the present invention, the primers were synthesized by the firm Biotech (Shanghai) corporation.
The invention provides a primer group for detecting CTLA4 gene SNP site genotype based on a SNaPshot SNP typing technology, which comprises a primer for amplifying CTLA4 gene SNP sites and a single base extension primer; the nucleotide sequence of the single-base extension primer is shown as SEQ ID NO. 3 (agaaTGGGCAACAGAGGTTTTT). The primers can be used for amplifying to obtain a CTLA4 gene fragment containing the rs4553808 site SNP molecular marker; the single-base extension primer takes the CTLA4 gene segment as a template to carry out extension reaction, so as to obtain CTLA4 gene segments with different genotypes. The source of the primer set is not particularly limited in the present invention, and a gene synthesis method well known in the art may be used. In the examples of the present invention, the primers were synthesized by the firm Biotech (Shanghai) corporation.
The invention provides application of the primer or the primer group for amplifying CTLA4 gene SNP sites in drug for assisting in selecting chemotherapy for multiple myeloma patients. In view of the fact that the rs4553808 site polymorphism of the CTLA4 gene can influence the side effect of multiple myeloma patients after being treated by MP scheme and the fact that multiple myeloma patients with the rs4553808 site genotype of GG have peripheral neuropathy induced by bortezomib earlier than multiple myeloma patients with the genotype of AA or AG, the primer or the primer group can assist in guiding whether prednisone is selected as chemotherapy for multiple myeloma patients.
In view of the fact that the rs4553808 site polymorphism of the CTLA4 gene can influence side effects of multiple myeloma patients after being treated by an MP scheme, the invention provides the application of the primer or the primer group for amplifying the SNP site of the CTLA4 gene in detecting the gene site polymorphism for guiding prednisone administration.
The invention provides a kit for detecting CTLA4 gene SNP site genotype based on a SNaPshot SNP typing technology, which comprises a primer or a primer group for amplifying CTLA4 gene SNP sites. The kit preferably also comprises 1 × HotStarTaq buffer and Mg2+dNTP, HotStarTaq polymerase and SNaPshot Multiplex Kit. The source of the above-mentioned reagent is not particularly limited in the present invention, and any reagent known in the art may be used.
The invention provides application of a kit for detecting CTLA4 gene SNP locus genotype based on a SNaPshot SNP typing technology in detecting the gene locus polymorphism for guiding prednisone medication.
The invention provides application of a kit for detecting CTLA4 gene SNP site genotype based on a SNaPshot SNP typing technology in assisting selection of chemotherapy drugs for multiple myeloma patients.
The invention provides a method for detecting CTLA4 gene SNP locus genotype, which comprises the following steps:
1) extracting the genome DNA of a sample to be detected;
2) taking the genomic DNA extracted in the step 1) as a template, and carrying out PCR amplification by using primers on the amplified CTLA4 gene SNP sites to obtain a PCR amplification product;
3) carrying out single base extension reaction on the PCR amplification product under the action of a single base extension primer in the primer group to obtain an extension product;
4) sequencing the extension product to obtain the CTLA4 gene SNP genotype of the sample to be detected.
The invention firstly extracts the genome DNA of a sample to be detected.
The method for extracting genomic DNA is not particularly limited in the present invention, and a method for extracting genomic DNA from a sample, which is well known in the art, such as a kit method, may be used.
After extracting DNA, the invention takes the extracted genome DNA as a template, and uses the primer to carry out PCR amplification by using the amplified CTLA4 gene SNP locus to obtain a PCR amplification product.
In the invention, the reaction procedure of the PCR amplification is preferably 95 ℃ and 5 min; at 94 ℃ for 20s, 60 ℃ for 30s, 75 ℃ for 1.5min, and 31 cycles; 72 ℃ for 2 min. The reaction system for PCR amplification is 10 ul, which comprises 1 xHotStarTaq buffer 0.1 ul and 25mM Mg2+Mu.l of 0.6. mu.l, 10mM dNTP 0.2. mu.l, 1U HotStarTaq polymerase 0.15. mu.l, 1. mu.l of sample DNA and 1. mu.M of upstream primer 0.5. mu.l and 1. mu.M of downstream primer 0.5. mu.l, ddH2O was supplemented to 10. mu.l.
In the present invention, the PCR amplification also preferably includes purification. The purification method of the present invention is not particularly limited, and may be carried out by a purification method known in the art, for example, using a purification kit.
After purification, the invention carries out single base extension reaction on the purified PCR amplification product under the action of the single base extension primer in the primer group to obtain an extension product.
In the present invention, the reaction system of the single base extension reaction is 10. mu.l, and includes 5. mu.l of the SNaPshot Multiplex Kit, 2. mu.l of the PCR amplification product, 1. mu.l of the extension primer at a concentration of 1. mu.M, and 2. mu.l of ultrapure water. Reaction procedure for the single base extension reaction: at 96 deg.C for 1 min; 96 ℃ for 10s, 55 ℃ for 5s, 60 ℃ for 30s, 28 cycles.
In the present invention, the extension product is preferably further purified. The purification is preferably performed with SAP-enzymes. The purification method preferably comprises adding 1U of SAP enzyme to 10. mu.l of the extension product, incubating at 37 ℃ for 30min, and inactivating at 75 ℃ for 15min.
After purification, sequencing the purified extension product to obtain the CTLA4 gene SNP genotype of the sample to be detected.
In the present invention, the sequencing system is preferably 1. mu.l of purified extension product, 0.3. mu.l of Liz120 SIZE STANDARD and 9. mu.l of Hi-Di. The sequencer for sequencing is preferably an ABI3730XL sequencer.
In the present invention, it is preferred to analyze the raw data obtained from sequencing with GeneMapper4.1(applied biosystems Co., Ltd., USA) to obtain a specific genotype. Experimental results show that the proportions of the genotypes appearing in 20 samples are AA (75.0%) and AG (25.0%), which are basically consistent with AA (76.7%), AG (23.3%) and GG (0.0%) in Chinese Han data in thousand human genes, and the primer set and the detection method provided by the invention have high amplification accuracy.
The primer, the detection kit and the application for amplifying the CTLA4 gene SNP site provided by the present invention will be described in detail with reference to the following examples, but they should not be construed as limiting the scope of the present invention.
Example 1
1. DNA extraction from saliva/throat swab or the like
The collected 20 saliva or cotton swabs wiped across the cheek were transferred to a 2ml centrifuge tube, the cotton swab portion was cut from the rod with scissors, and 40. mu.l of buffer GA was added. Add 20. mu.l of Proteinase K solution, vortex for 30sec and mix, stand at 56 ℃ for 60min, vortex for several times every 15min. Add 400. mu.l buffer GB, mix well by inversion, stand at 70 ℃ for 10min, at which time the solution should be clear, centrifuge briefly to remove droplets on the inner wall of the tube cover, then squeeze to remove the swab, transfer as much lysate as possible to a new centrifuge tube. Add 200. mu.l of absolute ethanol, mix well by inversion, centrifuge briefly to remove droplets on the inner wall of the tube cap. Adding the solution and flocculent precipitate obtained in the previous step into an adsorption column CR2 (adsorption column CR2 is put into a collection tube), centrifuging at 12000rpm for 30sec, pouring off waste liquid in the collection tube, and putting adsorption column CR2 back into the collection tube. Add 500. mu.l buffer GD to the adsorption column CR2, centrifuge at 12000rpm for 30sec, discard the tube and replace the adsorption column CR2 back in the tube. 600. mu.l of the rinsing solution PW was added to the adsorption column CR2, centrifuged at 12000rpm for 30sec, the waste liquid in the collection tube was discarded, and the adsorption column CR2 was returned to the collection tube. Repeating the previous step. Centrifuging at 12000rpm for 2min, and discarding waste liquid. The adsorption column CR2 was left at room temperature for several min to thoroughly dry the residual rinse solution from the adsorption material. Transferring the adsorption column CR2 into a clean centrifuge tube, suspending and dripping 30 μ l of elution buffer TB into the middle position of the adsorption membrane, standing at room temperature for 3min, centrifuging at 12000rpm for 2min, collecting DNA solution, inspecting quality, and storing at 4 deg.C. (genomic DNA extraction method varies depending on the kit)
2. Multiplex PCR reaction:
2.1PCR amplification reaction
The reaction (10. mu.l) contained 1 × HotStarTaq buffer,3.0mM Mg2+0.3mM dNTP,1U HotStarTaq polymerase (Qiagen Inc.), 1. mu.l of sample DNA, and 0.5. mu.l each of upstream and downstream PCR amplification primers (1. mu.M each of upstream and downstream).
2.2PCR amplification reaction procedure
Figure BDA0002947077430000071
Figure BDA0002947077430000081
Purification of PCR products
5U of SAP enzyme and 2U of Exonaclease I enzyme were added to 10. mu.l of PCR product, incubated at 37 ℃ for 30min, and then inactivated at 75 ℃ for 15min.
Note: SAP enzyme and Exonuclase I enzyme were purchased from NEB (New England Biolabs (Beijing) LTD.) at SAP concentration of 1U/. mu.L, Exon I of 20U/. mu.L, SAP 5. mu.L, Exonuclase I of 0.1. mu.L.
SnaPshot multiplex single base extension reaction
4.1 extension reaction
The extension reaction system (10. mu.l) included 5. mu.l of the SNaPshot Multiplex Kit (ABI), 2. mu.l of the purified Multiplex PCR product, 1. mu.l of the extension primer (concentration 1. mu.M) and 2. mu.l of ultrapure water.
4.2 reaction sequence
Figure BDA0002947077430000082
5. Purification of extension products
Mu.l of the extension product was added with 1U of SAP enzyme, incubated at 37 ℃ for 30min and then inactivated at 75 ℃ for 15min.
6. ABI3730XL sequencer on extension products
Mu.l of the purified extension product was mixed with 0.3. mu.l Liz120 SIZE STANDARD and 9. mu.l Hi-Di, denatured at 95 ℃ for 5min and applied to ABI3730XL sequencer.
7. Raw data collected on the ABI3730XL sequencer was analyzed using GeneMapper4.1(applied biosystems co., ltd., USA).
The genotype detection results of the rs4553808 locus of 20 samples are verified by a Sanger sequencing method of a sequence gold standard, and the samples to be detected are analyzed by combining data of Chinese Han nationality in the ensembl and thousand-person genes. The results are shown in Table 2.
TABLE 2 SNP typing results of genes related to drug administration for children
Sample (I) The detection result of the method Sanger sequencing results
1 AA AA
2 AG AG
3 AA AA
4 AA AA
5 AA AA
6 AA AA
7 AG AG
8 AA AA
9 AG AG
10 AA AA
11 AA AA
12 AG AG
13 AG AG
14 AA AA
15 AA AA
16 AA AA
17 AA AA
18 AA AA
19 AA AA
20 AA AA
The results show that the detection results of 20 physical examination samples are completely consistent with the results of a Sanger sequencing method, and the accuracy of the results of the kit and the detection system disclosed by the invention is 100%. The proportions of the genotypes appearing in the 20 samples are AA (75.0%) and AG (25.0%), which are basically consistent with AA (76.7%), AG (23.3%) and GG (0.0%) in the data of Chinese Han nationality in thousand genes, which shows that the primer set and the detection method provided by the invention have higher amplification accuracy.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> physical and chemical analysis testing center in Beijing market
<120> primer for amplifying CTLA4 gene SNP site, detection kit and application
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
acgttggatg acaacctaat gggcacttcc 30
<210> 2
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
acgttggatg ctgtgtgttc ctcttgaggg 30
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
agaatgggca acagaggttt tt 22

Claims (10)

1. A primer for amplifying CTLA4 gene SNP sites is characterized by comprising an upstream primer and a downstream primer;
the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 1;
the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2.
2. A primer set for detecting the genotype of SNP sites of CTLA4 gene based on SNaPshot SNP typing technology, which comprises the primer for amplifying the SNP sites of CTLA4 gene according to claim 1 and a single base extension primer;
the nucleotide sequence of the single base extension primer is shown as SEQ ID NO. 3.
3. The use of the primer for amplifying CTLA4 gene SNP sites according to claim 1 or the primer set according to claim 2 for assisting in the selection of chemotherapy for multiple myeloma patients.
4. Use of the primer for amplifying CTLA4 gene SNP site according to claim 1 or the primer set according to claim 2 for detecting a polymorphism of a gene site that directs prednisone administration.
5. A kit for detecting the genotype of SNP sites of CTLA4 genes based on a SNaPshot SNP typing technique, which comprises the primer for amplifying the SNP sites of CTLA4 genes according to claim 1 or the primer set according to claim 2.
6. The kit for detecting SNP site genotype of CTLA4 gene based on SNaPshot SNP typing technology according to claim 5, further comprising 1 xHotStarTaqbuffer, Mg2+dNTP, HotStarTaqpolymerase and SNaPshot Multiplex Kit.
7. Use of the kit for detecting the SNP site genotype of the CTLA4 gene based on the SNaPshot SNP typing technique according to claim 5 or 6, for detecting the polymorphism of the SNP site that directs the administration of prednisone.
8. The use of the kit for detecting the SNP site genotype of the CTLA4 gene based on the SNaPshot SNP typing technology according to claim 5 or 6 in assisting in the selection of chemotherapy drugs for patients with multiple myeloma.
9. A method for detecting the genotype of SNP sites of CTLA4 genes is characterized by comprising the following steps:
1) extracting the genome DNA of a sample to be detected;
2) carrying out PCR amplification by using the genomic DNA extracted in the step 1) as a template and primers for amplifying CTLA4 gene SNP sites according to claim 1 to obtain a PCR amplification product;
3) subjecting the PCR amplification product to a single base extension reaction under the action of a single base extension primer in the primer set of claim 2 to obtain an extension product;
4) sequencing the extension product to obtain the CTLA4 gene SNP genotype of the sample to be detected.
10. The method for detecting the SNP site genotype of a CTLA4 gene according to claim 9, wherein the reaction sequence of the PCR amplification in the step 2) is 95 ℃ for 5 min; at 94 ℃ for 20s, 60 ℃ for 30s, 75 ℃ for 1.5min, and 31 cycles; 72 ℃ for 2 min;
the reaction system for PCR amplification in the step 2) is 10 ul, and comprises 1 xHotStarTaqbuffer 1 ul and 25mM Mg2+0.6. mu.l, 10mM dNTP 0.2. mu.l, 1U HotStarTaqpolymerase 0.15. mu.l, 1. mu.l sample DNA and 1. mu.M upstream primer 0.5. mu.l and 1. mu.M downstream primer 0.5. mu.l, ddH2O was supplemented to 10. mu.l.
The reaction system of the single base extension reaction in the step 3) is 10 mul, and comprises 5 mul of SNaPshot Multiplex Kit, 2 mul of PCR amplification product, 1 mul of extension primer with the concentration of 1 mul and 2 mul of ultrapure water;
reaction procedure for the single base extension reaction described in step 3): at 96 deg.C for 1 min; 96 ℃ for 10s, 55 ℃ for 5s, 60 ℃ for 30s, 28 cycles.
CN202110198419.2A 2021-02-22 2021-02-22 Primer for amplifying CTLA4 gene SNP site, detection kit and application Pending CN113528661A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110198419.2A CN113528661A (en) 2021-02-22 2021-02-22 Primer for amplifying CTLA4 gene SNP site, detection kit and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110198419.2A CN113528661A (en) 2021-02-22 2021-02-22 Primer for amplifying CTLA4 gene SNP site, detection kit and application

Publications (1)

Publication Number Publication Date
CN113528661A true CN113528661A (en) 2021-10-22

Family

ID=78094340

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110198419.2A Pending CN113528661A (en) 2021-02-22 2021-02-22 Primer for amplifying CTLA4 gene SNP site, detection kit and application

Country Status (1)

Country Link
CN (1) CN113528661A (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100249065A1 (en) * 2009-03-24 2010-09-30 Nadine Cohen Biomarkers for Assessing Peripheral Neuropathy Response to Cancer Treatment
CN107868824A (en) * 2017-11-10 2018-04-03 广州金域医学检验集团股份有限公司 Single base extension method detects primer system, the methods and applications of UGT1A1*6 gene pleiomorphisms
CN109628564A (en) * 2019-02-25 2019-04-16 北京市理化分析测试中心 A method of for detecting the primer sets of SNP polymorphism and detecting SNP polymorphism using primer sets
CN110699445A (en) * 2019-11-05 2020-01-17 哈尔滨医科大学 AS3MT gene single nucleotide polymorphism site detection kit, use method and application
CN110904219A (en) * 2019-12-24 2020-03-24 广州市妇女儿童医疗中心 Application of MYH9 and CTLA4 gene polymorphism sites in guiding children with nephrotic syndrome to use tacrolimus
CN110923310A (en) * 2019-12-24 2020-03-27 广州市妇女儿童医疗中心 Polymorphic site for guiding nephrotic syndrome CYP3A5 expression children to use tacrolimus

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100249065A1 (en) * 2009-03-24 2010-09-30 Nadine Cohen Biomarkers for Assessing Peripheral Neuropathy Response to Cancer Treatment
CN107868824A (en) * 2017-11-10 2018-04-03 广州金域医学检验集团股份有限公司 Single base extension method detects primer system, the methods and applications of UGT1A1*6 gene pleiomorphisms
CN109628564A (en) * 2019-02-25 2019-04-16 北京市理化分析测试中心 A method of for detecting the primer sets of SNP polymorphism and detecting SNP polymorphism using primer sets
CN110699445A (en) * 2019-11-05 2020-01-17 哈尔滨医科大学 AS3MT gene single nucleotide polymorphism site detection kit, use method and application
CN110904219A (en) * 2019-12-24 2020-03-24 广州市妇女儿童医疗中心 Application of MYH9 and CTLA4 gene polymorphism sites in guiding children with nephrotic syndrome to use tacrolimus
CN110923310A (en) * 2019-12-24 2020-03-27 广州市妇女儿童医疗中心 Polymorphic site for guiding nephrotic syndrome CYP3A5 expression children to use tacrolimus

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
JESÚS F. SAN MIGUEL等: "Bortezomib plus Melphalan and Prednisone for Initial Treatment of Multiple Myeloma", THE NEW ENGLAND JOURNAL OF MEDICINE, vol. 359, pages 906 - 917, XP055093696, DOI: 10.1056/NEJMoa0801479 *
XIAO-YING QIN等: "CTLA-4 polymorphisms are associated with treatment outcomes of patients with multiple myeloma receiving bortezomib-based regimens", ANNALS OF HEMATOLOGY, vol. 97, pages 485 - 495, XP036390628, DOI: 10.1007/s00277-017-3203-7 *
周国华主编: "SNP检测技术与个体化药物治疗", 苏州大学出版社, pages: 213 - 215 *

Similar Documents

Publication Publication Date Title
CN109402257B (en) Primer, method and kit for detecting mutation sites of human BRCA1and BRCA2 gene full-coding sequences
US20190136330A1 (en) Method for screening cancer
CN110317880B (en) Molecular marker related to pig feed conversion rate, identification and application thereof
CN106367491A (en) Kit for detecting deafness susceptibility genes
CN111979313A (en) Specific primer and kit for detecting pathogenic variation of deafness gene based on multiplex PCR and high-throughput sequencing technology and application
WO2013060005A1 (en) Method for detecting specific single nucleotide polymorphism related to ankylosing spondylitis and kit therefor
CN110564861A (en) Fluorescence labeling composite amplification kit for human Y chromosome STR locus and InDel locus and application thereof
CN103789440A (en) Spinal muscular atrophy-related gene mutation detection method, related detection probe composition and detection kit as well as related application
CN101671736B (en) Gene detection kit used for detecting cell chimerism or individual recognition
CN105331623A (en) MTB (mycobacterium tuberculosis) rpoB mutant gene and application thereof
CN111321212B (en) Primer combination for detecting anti-acne capability gene of skin and application thereof
CN110241200B (en) FLT3-ITD mutation high-sensitivity detection method and kit
CN117187380A (en) One-tube APOE genotyping detection kit and detection method thereof
CN105255869B (en) Application of ABCC4 gene polymorphism site rs3742106 and detection primer and kit thereof
CN108517357B (en) Kit for detecting sudden cardiac death-related SNP (single nucleotide polymorphism) on SCN5A gene related to sudden cardiac death and detection method thereof
CN116716386A (en) Detection kit for vitamin C deficiency risk assessment and application method thereof
WO2013078690A1 (en) Ankylosing spondylitis susceptibility and mononucleotide polymorphism detection method, kit and use thereof
CN113528661A (en) Primer for amplifying CTLA4 gene SNP site, detection kit and application
CN112626270B (en) Method and kit for simultaneously and rapidly detecting new coronavirus and influenza A virus
CN112592972B (en) Early screening method and kit for diffuse toxic goiter susceptibility genes
CN110331198B (en) SNP marker for tumor prognosis and application thereof
CN113215241A (en) Detection primer group for risk early warning of cardiovascular and cerebrovascular diseases and application thereof
CN111662967A (en) HLA-DPA1 genotyping kit
CN110904215A (en) Method for synchronously detecting gene polymorphism of two SNP sites of SLCO1B1 gene
CN110468197A (en) A kind of quick analysis detection kit of ALDH2 gene G1510A polymorphism and method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20211022