CN110904215A

CN110904215A - Method for synchronously detecting gene polymorphism of two SNP sites of SLCO1B1 gene

Info

Publication number: CN110904215A
Application number: CN201911298716.3A
Authority: CN
Inventors: 赵方圆; 智慧芳; 倪君君
Original assignee: Xi'an Hehe Medical Laboratory Co Ltd
Current assignee: Xi'an Hehe Medical Laboratory Co Ltd
Priority date: 2019-12-16
Filing date: 2019-12-16
Publication date: 2020-03-24

Abstract

The invention relates to a primer pair and a detection method for synchronously detecting two SNP sites of an SLCO1B1 gene, which are beneficial to improving detection flux. The invention firstly provides a primer pair for synchronously detecting gene polymorphism of two SNP sites of an SLCO1B1 gene, which comprises a pair of primers, wherein the nucleotide sequence of an upstream primer is shown by SEQ ID NO.1, and the nucleotide sequence of a downstream primer is shown by SEQ ID NO. 2. When the primer pair is used for PCR amplification reaction, the 388A > G and 521T > C sites of the SLCO1B1 gene are simultaneously amplified, namely exons 4 and 5 containing 2 SNP sites are simultaneously amplified. The invention can detect the gene polymorphism of the 388A & gtG and 521T & gtC sites of the SLCO1B1 gene by one reaction. More than 90 samples can be detected simultaneously, so that the detection efficiency is improved, and the cost is greatly saved.

Description

Method for synchronously detecting gene polymorphism of two SNP sites of SLCO1B1 gene

Technical Field

The invention relates to the technical field of gene detection, in particular to a primer pair and a detection method for synchronously detecting gene polymorphism of two SNP sites of an SLCO1B1 gene.

Background

The SLCO1B1 gene is about 109kb in length, located on the short arm of chromosome 12, and consists of 14 exons and 1 non-coding exon. Its main function is to code the organic anion transporter OATP1B1 specifically distributed on the outer side of the basal membrane of liver cells.

OATP1B1 is composed of 691 amino acids, and is divided into 14 transmembrane regions and 1 large 5 th extracellular loop, which is one of the main transporters on the liver cell membrane and can mediate various endogenous and exogenous substances to enter the liver cells from blood. Its targeted delivery has important effects on the in vivo distribution of various drugs and liver clearance. It can reduce the medicine exposure of peripheral non-target organs by increasing the medicine aggregation in liver cells, reducing the peripheral blood concentration and reducing the side effect. However, Single Nucleotide Polymorphisms (SNPs) located in the transmembrane region and the 5 th extracellular region of the coding gene SLCO1B1 can significantly affect the transport activity of the OATP1B1 encoded by the coding gene. The mechanism may be: can reduce the affinity of the transport protein and the substrate, leading to the reduction of the transport function of the transport protein; reducing the expression level of the transport protein; the structure of the transport protein on the liver cell membrane is changed, and the transport function of the transport protein is changed. The 521T & gtC mutation mainly reduces the affinity of the coded OATP1B1 to a substrate, so that the transport activity is reduced. Clinically, statin selection for treatment based on the SLCO1B1 genotype is recommended. Therefore, the detection of human SLCO1B1 gene polymorphism can assist doctors to predict the dosage, toxicity response and curative effect of statins.

SLCO1B1 has high genetic polymorphism, and more than 40 nonsynonymous single nucleotide polymorphisms SNPs have been discovered. Of these, the 2 most common non-synonymous mutations in asians were studied at best as a388G and T521C. Research shows that the mutation rates of 388A & gtG and 521T & gtC in Chinese population are 73.4% and 14.0% respectively. The 2 non-synonymous mutations can constitute 4 haplotype, including wild type SLCO1B1 × 1a (388A521T), single mutant SLCO1B1 × 1B (388G521T), single mutant SLCO1B1 × 5(388A521C) and double mutant SLCO1B1 × 15(388G 521C). 388A > G and 521T > C are located on exon 4 and exon 5, respectively.

PCR (Polymerase Chain Reaction) has been widely used in medicine, genetics, microbiology, and even throughout life sciences. At present, PCR detection tests can be respectively designed aiming at two polymorphic sites 388A & gtG and 521T & gtC of the SLCO1B1 gene so as to detect the gene mutation condition. Because each PCR reaction only aims at one SNP site, the detection flux is low.

Disclosure of Invention

In order to solve the above-mentioned drawbacks, the present invention provides a primer pair and a detection method for synchronously detecting two SNP sites of the SLCO1B1 gene, which are beneficial to improving the detection throughput.

In order to achieve the purpose, the invention is realized by the following technical scheme:

firstly, a primer pair for synchronously detecting gene polymorphism of two SNP sites of an SLCO1B1 gene is provided, which comprises a pair of primers, wherein the nucleotide sequence of an upstream primer is shown by SEQ ID NO.1, and the nucleotide sequence of a downstream primer is shown by SEQ ID NO. 2. The primer pair is specially designed for specific amplification of exons 4 and 5 of SLCO1B1 containing 388A & gtG and 521T & gtC sites, can simultaneously, synchronously, efficiently, specifically and accurately amplify a section of specific gene of the exon at the sites, and detects the gene polymorphism of the specific gene by sequencing. When the primer pair is used for PCR amplification reaction, the 388A > G and 521T > C sites of the SLCO1B1 gene are simultaneously amplified, namely exons 4 and 5 containing 2 SNP sites are simultaneously amplified. The detection flux can be improved to the maximum extent.

Multiple tests prove that the primer pair provided by the invention has better specificity and amplification accuracy, can be applied to preparing a kit for synchronously detecting the gene polymorphism of two SNP sites of the SLCO1B1 gene, can quickly and accurately obtain the gene polymorphism results of the SLCO1B1 gene at the two sites after sample collection tests by preparing a finished kit, and guides the selection of clinical statins.

The kit mainly comprises the primer pair provided by the invention, wherein the final concentration of the primer is preferably 20-300 nM. Other PCR reagents may be selected according to conventional techniques, for example, a preferred embodiment further comprises a DNA polymerase, a PCR buffer, a mixture of 4 kinds of dNTPs (deoxyribose nucleotide triphosphates), and ultrapure water. Wherein the amount of DNA polymerase is 0.5-5U, and the final concentration of each dNTP is 50-500. mu.M.

The DNA polymerase can be Taq, KOD FX, etc., so that the PCR buffer solution is a concentrated buffer solution corresponding to the selected DNA polymerase, and the concentration degree can be 2X, 5X or 10X.

For example, when KOD FX is used as the DNA polymerase and 2 × concentrated buffer is used, the above PCR system may be configured such that the following components are used: 0.5-2 μ l of DNA polymerase, 18-30 μ l of PCR buffer solution, 1-10 μ l of mixture of various dNTPs, 1-5 μ l of each of upstream and downstream primers, 5-1000 ng of DNA, and an appropriate amount of ultrapure water to supplement water to 50 μ l. And may be other volume sizes configured in the same proportions.

When the finished product kit is manufactured, a reagent for extracting the DNA of a sample or a professional DNA extraction kit can be selectively configured according to actual needs; the DNA of the sample to be detected can be obtained more conveniently and quickly, and the convenience and the rapidity of the detection finished product kit are enhanced. The sample to be tested can be any blood, cell, tissue or buccal swab sample containing genomic DNA.

On the basis of the primer pair provided by the invention, the invention further provides a detection method for synchronously detecting the gene polymorphism of two SNP sites of the SLCO1B1 gene, and the primer pair is adopted for PCR detection.

According to a preferred embodiment, the detection method comprises the following specific steps:

(1) extracting genome DNA from a sample to be detected as an amplification template;

(2) configuring a PCR reaction system comprising the primer pair and the amplification template;

(3) carrying out PCR amplification reaction on the PCR reaction system to obtain a PCR product;

(4) and determining the gene polymorphism of two SNP sites of the SLCO1B1 gene according to the PCR product.

Wherein the most preferable reaction conditions for the PCR amplification reaction are: 94 ℃ below zero: 1-10 min; 98 ℃ C: 5-20 s, and 58-68 ℃: 10-60 s, 68-72 ℃: 30 s-5 min, and 25-40 cycles in total; 68-72 ℃: 0-30 min.

Based on the method and the conditions, the detection method can quickly, effectively and conveniently synchronously obtain the gene polymorphism of two SNP loci of the SLCO1B1 gene of a sample to be detected, wherein the gene polymorphism is most common with 388A & gtG and 521T & gtC. May be used for non-diagnostic purposes. In general, when the 388A > G and 521T > C sites of SLCO1B1 gene are amplified by using an upstream primer SEQ ID NO.1 and a downstream primer SEQ ID NO.2, the length of the corresponding amplified product fragment is 2133 bp. The DNA fragment was then recovered by cutting and sequenced.

According to a preferred embodiment of the present invention, the step (4) of determining gene polymorphism comprises: electrophoretically detecting the PCR product to verify the amplified fragment size of the PCR product; and after the PCR product is verified to be correct, performing sequence determination on the PCR product to obtain the gene polymorphism conditions of the 388A & gtG and 521T & gtC sites of the SLCO1B1 gene of the sample to be detected. In detail, the PCR amplified fragment can be detected by agarose gel electrophoresis or polyacrylamide gel electrophoresis.

Compared with the prior art, the invention at least has the following beneficial effects: (1) and (3) improving the detection flux: generally, each PCR reaction only aims at one SNP site, but the invention can simultaneously detect 2 SNP sites of the SLCO1B1 gene, and can detect the gene polymorphism of the 388A > G and 521T > C sites of the SLCO1B1 gene through one reaction. Therefore, more than 90 samples can be detected simultaneously, the detection efficiency is improved, and the cost is greatly saved. (2) The cost is reduced: the invention can reduce the PCR reaction system from 2 systems/procedures to 1 system/procedure, thereby reducing the use amount of reagents and consumables such as DNA polymerase, dNTP and the like and greatly reducing the detection cost.

Drawings

FIG. 1 shows the result of agarose gel electrophoresis detection according to an embodiment of the present invention;

FIG. 2 is a diagram showing a portion of a PCR product sequence determination result for a SNP site according to an embodiment of the present invention;

FIG. 3 shows a portion of the PCR product sequence determination result for another SNP site according to an embodiment of the present invention.

Detailed Description

To further illustrate the present invention, reference is made to the following examples. Specifically, the reagents used in the implementation of the invention are all commercial products, and the databases used in the implementation of the invention are all public online databases. The following examples are illustrative only and are not to be construed as limiting the invention.

Example 1

Designing and synthesizing a primer pair, comprising the following steps:

step 1.1: based on exons 4 and 5 including 388A & gtG and 521T & gtC sites of SLCO1B1 gene and upstream and downstream sequences thereof, upstream and downstream primers for specifically amplifying 388A & gtG and 521T & gtC sites are designed.

For designing primers, Primer Quest and Primer Premier 5.0 are adopted to design the primers and analyze the mismatch of dimers and stem loops, and the primers are designed at two ends of No. 4 and No. 5 exons.

Primer pairs provided in this example cover the 388A > G and 521T > C sites of the SLCO1B1 gene. Because the amplification efficiency of the primers is obviously reduced and the specificity is deteriorated due to small sequence change, PCR primer pairs are respectively designed aiming at different sites/exons, and after the screening of a pre-experiment, the primer pairs with the best amplification effect are selected according to the length of product fragments and the inclusion conditions of the sites/exons, wherein the primer pairs are shown in the following table 1.

TABLE 1

Primer name	Primer sequence 5 '-3'
		SEQ ID NO.1	gtgataacccacttagcctggggtgtattg
SEQ ID NO.2	gaaagccccaatggtactatgggagtctcc

Step 1.2: the primer pair designed in 1.1 was synthesized.

Example 2

The method for extracting the genome DNA from the sample to be detected comprises the following steps:

step 2.1: mouth shed cells were collected with a mouth swab or fresh peripheral blood samples were collected with an EDTA blood collection tube.

In this embodiment, the sample source is a human body.

Step 2.2: genomic DNA was extracted from the specimen using a Tiangen buccal swab genomic DNA extraction kit (DP322) or a blood/cell/tissue genomic DNA extraction kit (DP304), and the concentration and purity of the DNA were measured using NP80-touch (IMPLEN, Germany) to preserve the genomic DNA.

Example 3

The PCR detection method for synchronously detecting the gene polymorphism of the 388A & gtG and 521T & gtC loci of the SLCO1B1 gene comprises the following steps:

step 3.1: and (3) taking the genome DNA obtained in the step 2.2 as an amplification template, and adopting the primer pair synthesized in the step 1.2 to configure a PCR reaction system.

In this example, a PCR amplification system was prepared by using DNA polymerase and buffer solution as basic raw materials in KOD FX enzyme system (cat. KFX-101) manufactured by Toyobo, Inc., and adjusting the primer concentration, dNTP concentration, buffer solution concentration and enzyme amount based on the amplification system in the enzyme system specification, and the specific composition of this reaction system is shown in Table 3 below. Of course, the equal scale enlargement/reduction of the reaction system is within the protection scope of the embodiment of the invention; the amplification can also be achieved by replacing other DNA polymerase systems and adjusting the appropriate proportion.

TABLE 3

Reagent composition	Volume of
		2×PCR buffer for FX	25μl
2mM dNTP	8μl
		F	2.5μl
R	2.5μl
		KOD FX(1U/μl)	1μl
DNA	1μl
		Water (W)	10μl

The amount of the DNA template can be adjusted, and 20ng of genomic DNA can be used in this example.

Step 3.2: the PCR instrument was programmed according to the PCR reaction conditions shown in Table 4 below.

TABLE 4

Step 3.3: and (3) carrying out PCR amplification reaction on the PCR reaction system configured in the step 3.1 by using a programmed PCR instrument to obtain a PCR product.

Example 4

Electrophoresis detection, comprising the following steps:

step 4.1: the PCR product obtained in step 3.3 was examined by agarose gel electrophoresis to verify the size of the PCR product fragment.

The detection results are shown in fig. 1, the LSL, ZHF, JYX, JYK, SYL, LSF, FW, etc. shown in fig. 1 are mainly used for distinguishing different samples to be detected, the left-most column of fig. 1 shows a ruler bar, the right-most column shows electrophoresis results of PCR products of a blank control group, and the middle columns show electrophoresis results of PCR products of different samples.

According to the comparison between the position of each product bright band and the left scale bar, whether the product bright band corresponds to the target amplification product can be identified.

Referring to fig. 1, it can be seen from the electrophoresis results of the blank set that the environmental factors have no adverse effect on the electrophoresis detection results of the sample to be detected. According to the electrophoresis result of each sample to be detected, the existing strip is a corresponding PCR amplification product, and the size of the strip is consistent with the theory; the strip is clear, has no smear and the like, and has good bright strip effect. Thus, when the PCR amplification primer pair designed in step 1.1 is used for PCR amplification, only the expected target product is generated, but no other unrelated product is generated, and the primer pair is reasonably designed.

Step 4.2: after the size of the PCR product fragment is verified to be correct, the sequence of the PCR product can be determined.

Example 5

Sequence determination comprising the steps of:

step 5.1: and (4) after the sizes of the PCR product fragments are verified to be correct in the step 4.2, sending the PCR product obtained in the step 3.3 to a sequencing company for sequence determination to obtain a sequencing result in the format of ab 1.

Step 5.2: analyzing the sequencing result obtained in the step 5.1 by using Chromas sequence analysis software to obtain the gene polymorphism conditions of the 388A & gtG and 521T & gtC sites of the SLCO1B1 gene.

The partial sequencing results are shown in FIGS. 2-3.

Referring to FIG. 2, FIG. 2 shows nucleotide base sequences at and upstream and downstream of the polymorphic site c.388A > G. Referring to the box line portion in FIG. 2, the genotype at the c.388A > G site of the sample is known as heterozygote AG.

Referring to FIG. 3, FIG. 3 shows nucleotide base sequences at and upstream and downstream of the mutation site c.521T > C of the gene. Referring to the box line part in FIG. 3, the genotype at the c.521T > C site of the exemplary sample is homozygous TT.

Example 6: configuration of the kit

According to the above experimental results, the present example provides a preferred kit for simultaneously detecting gene polymorphisms at two SNP sites of the SLCO1B1 gene, which comprises the following reagents:

1. PCR primer pair: f upstream primer (10. mu.M), R downstream primer (10. mu.M);

2、KOD FX(1U/μl)；

3、2×PCR buffer for FX；

4、dNTP(2mM)；

5. a sample DNA extraction reagent;

6. sample collection receptacles (e.g., containing oral swabs and swab receptacles/tubes);

7. ultrapure water.

The reagent is reasonably placed in the kit, the instructions (optionally reconfigured with a PCR test tube or a pore plate or a pipette) of the kit are put into the kit, the instructions comprise the step of collecting the sample to be detected, the collected sample is put into a storage box/tube, the step of DNA extraction is carried out, and finally the PCR amplification process is carried out according to the detection method.

It should be noted that, in this document, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus. Without further limitation, an element defined by the phrase "comprising a" does not exclude the presence of other similar elements in a process, method, article, or apparatus that comprises the element.

The above-mentioned embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements made to the technical solution of the present invention by those skilled in the art without departing from the spirit of the present invention shall fall within the protection scope defined by the claims of the present invention.

Sequence listing

<110> Xian Hei medical laboratory Co., Ltd

<120> method for simultaneously detecting gene polymorphisms at two SNP sites of SLCO1B1 gene

<130>ss191-207

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>30

<212>DNA

<213> Artificial sequence ()

<400>1

gtgataaccc acttagcctg gggtgtattg 30

<210>2

<211>30

<212>DNA

<213> Artificial sequence ()

<400>2

gaaagcccca atggtactat gggagtctcc 30

Claims

1. A primer pair for synchronously detecting gene polymorphism of two SNP sites of an SLCO1B1 gene is characterized by comprising a pair of primers, wherein the nucleotide sequence of an upstream primer is shown by SEQ ID NO.1, and the nucleotide sequence of a downstream primer is shown by SEQ ID NO. 2.

2. The primer pair of claim 1, wherein the SNP sites are the 388A > G and 521T > C sites of the SLCO1B1 gene.

3. Use of the primer set according to claim 1 or 2 for producing a kit for simultaneously detecting gene polymorphisms at two SNP sites of the SLCO1B1 gene.

4. A kit for simultaneously detecting gene polymorphisms at two SNP sites of the SLCO1B1 gene, comprising the primer set according to claim 1 or 2.

5. The kit according to claim 4, further comprising a DNA polymerase, a PCR buffer, a mixture of 4 dNTPs, and ultrapure water.

6. The kit according to claim 5, wherein the DNA polymerase is used in an amount of 0.5 to 5U, each dNTP is used at a final concentration of 50 to 500. mu.M, and the primer is used at a final concentration of 20 to 300 nM.

7. The kit according to any one of claims 4 to 6, further comprising a test sample DNA extraction reagent or DNA extraction kit.

8. A method for simultaneously detecting gene polymorphisms at two SNP sites of an SLCO1B1 gene, which is characterized in that a sample to be detected is subjected to PCR detection by using the primer set according to claim 1 or 2.

9. The detection method according to claim 8, characterized by comprising the steps of:

(2) preparing a PCR reaction system containing the primer pair and the amplification template;

10. The detection method according to claim 9, wherein the reaction conditions of the PCR amplification reaction are: 94 ℃ below zero: 1-10 min; 98 ℃ C: 5-20 s, and 58-68 ℃: 10-60 s, 68-72 ℃: 30 s-5 min, and 25-40 cycles in total; 68-72 ℃: 0-30 min.