CN111518888A - Method for synchronously detecting gene polymorphism of two SNP sites of APOE gene - Google Patents
Method for synchronously detecting gene polymorphism of two SNP sites of APOE gene Download PDFInfo
- Publication number
- CN111518888A CN111518888A CN202010369738.0A CN202010369738A CN111518888A CN 111518888 A CN111518888 A CN 111518888A CN 202010369738 A CN202010369738 A CN 202010369738A CN 111518888 A CN111518888 A CN 111518888A
- Authority
- CN
- China
- Prior art keywords
- gene
- pcr
- primer
- snp sites
- apoe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Abstract
The invention provides a primer pair and a detection method for synchronously detecting two SNP sites of an APOE gene, which are beneficial to the improvement of detection flux. The invention provides a primer pair for synchronously detecting gene polymorphism of two SNP sites of an APOE gene, which comprises a pair of primers, wherein the nucleotide sequence of an upstream primer is shown by SEQ ID NO.1, and the nucleotide sequence of a downstream primer is shown by SEQ ID NO. 2. When the primer pair is used for PCR amplification reaction, the rs429358 and rs7412 sites of the APOE gene are simultaneously amplified, namely, the gene fragment containing 2 SNP sites is simultaneously amplified. The invention can detect the gene polymorphism of the rs429358 and rs7412 sites of the APOE gene through one reaction. Therefore, more than 90 samples can be detected simultaneously, the detection efficiency is improved, and the cost is greatly saved.
Description
Technical Field
The invention relates to the technical field of gene detection, in particular to a primer pair and a detection method for synchronously detecting gene polymorphism of two SNP sites of APOE (apolipoprotein).
Background
The APOE (apolipoprotein) gene is located at 19q13.2, has a full length of 3.7kb and contains 4 exons, and generates APOE functional proteins which are ligands of low density lipoprotein, very low density lipoprotein and chylomicron receptor. The APOE gene is shown in polymorphism in normal population, and 6 different genotypes are formed by two SNP sites: E4/E4 type: rarely, it is associated with senile dementia, sudden death of coronary heart disease, intractable hypertension, cerebral ischemia, type IV hyperlipidemia, hypercholesterolemia and inheritance thereof; E4/E3: rarely, it is associated with senile dementia, hypercholesterolemia, myocardial infarction and high genetic susceptibility; E4/E2 type: rare, moderate frequency of cerebral recurrent bleeding infarct rate, and diabetic nephrotic syndrome incidence; E3/E3: frequently, heart and brain ischemia is low, but hemorrhage and death can recur, the damage of hypertension and viscera is late, and the senile dementia rate is low; E3/E2: the medicine is related to longevity, the senile dementia rate is low, and the patients possibly suffer from heart ischemia diseases, so that the total cholesterol can be increased by the female climacteric hormone replacement therapy; E2/E2 type: rarely, it is manifested as type III hyperlipidemia, early arteriosclerosis, but heart protection, and low incidence of diabetes. That is, there are different types of APOE in the population, and thus different pathogenic states are exhibited, resulting in significant variability in the types and risk frequencies of human disease.
PCR (Polymerase Chain Reaction) has been widely used in medicine, genetics, microbiology, and even throughout life sciences. At present, PCR detection tests can be respectively designed aiming at two polymorphic sites rs429358 and rs7412 of an APOE gene so as to detect the gene mutation condition. Because each PCR reaction only aims at one SNP site, the detection flux is low.
Disclosure of Invention
In order to solve the above-mentioned drawbacks, the present invention provides a primer set and a detection method for synchronously detecting two SNP sites of an APOE gene, which are beneficial to the improvement of detection throughput.
In order to achieve the purpose, the invention is realized by the following technical scheme:
firstly, a primer pair for synchronously detecting the gene polymorphism of two SNP sites of an APOE gene is provided, which comprises a pair of primers, wherein the nucleotide sequence of an upstream primer is shown by SEQ ID NO.1, and the nucleotide sequence of a downstream primer is shown by SEQ ID NO. 2. The primer pair is specially designed for specific amplification of the gene containing the rs429358 and rs7412 sites of APOE, can simultaneously, synchronously, efficiently, specifically and accurately amplify a specific gene fragment of the gene at the sites, and detect the gene polymorphism of the gene fragment by sequencing. When the primer pair is used for PCR amplification reaction, the rs429358 and rs7412 sites of the APOE gene are simultaneously amplified, namely, the gene fragment containing 2 SNP sites is simultaneously amplified. The detection flux can be improved to the maximum extent.
Multiple tests prove that the primer pair provided by the invention has better specificity and amplification accuracy, can be applied to the preparation of a kit for synchronously detecting the gene polymorphism of two SNP sites of an APOE gene, and can quickly and accurately obtain the result of the gene polymorphism of the APOE gene at the two sites after a sample is collected and tested by preparing a finished kit.
The kit mainly comprises the primer pair provided by the invention, wherein the final concentration of the primer is preferably 20-300 nM. Other PCR reagents may be selected according to conventional techniques, for example, a preferred embodiment further comprises a DNA polymerase, a PCR buffer, a mixture of 4 kinds of dNTPs (deoxyribose nucleotide triphosphates), and ultrapure water. Wherein the amount of DNA polymerase is 0.5-5U, and the final concentration of each dNTP is 50-500. mu.M.
The DNA polymerase can be Taq, KOD FX, etc., so that the PCR buffer solution is a concentrated buffer solution corresponding to the selected DNA polymerase, and the concentration degree can be 2X, 5X or 10X.
For example, when KOD FX is used as the DNA polymerase and 2 × concentrated buffer is used, the amounts of the components in the PCR system may be: 0.5-2 μ l of DNA polymerase, 18-30 μ l of PCR buffer solution, 1-10 μ l of mixture of various dNTPs, 1-5 μ l of each of upstream and downstream primers, 5-1000 ng of DNA, and an appropriate amount of ultrapure water to supplement water to 50 μ l. And may be other volume sizes formulated in the same proportions.
When the finished product kit is manufactured, a reagent for extracting the DNA of a sample or a professional DNA extraction kit can be selectively prepared according to actual needs; the DNA of the sample to be detected can be obtained more conveniently and quickly, and the convenience and the rapidity of the detection finished product kit are enhanced. The sample to be tested can be any blood, cell, tissue or buccal swab sample containing genomic DNA.
On the basis of the primer pair provided by the invention, the invention further provides a detection method for synchronously detecting the gene polymorphism of two SNP sites of the APOE gene, and the primer pair is adopted for PCR detection.
According to a preferred embodiment, the detection method comprises the following specific steps:
(1) extracting genome DNA from a sample to be detected as an amplification template;
(2) preparing a PCR reaction system containing the primer pair and the amplification template;
(3) carrying out PCR amplification reaction on the PCR reaction system to obtain a PCR product;
(4) and determining the gene polymorphism of two SNP sites of the APOE gene according to the PCR product.
Wherein the most preferable reaction conditions for the PCR amplification reaction are: 94 ℃ below zero: 1-10 min; 98 ℃ C: 5-20 s, and 58-68 ℃: 10-60 s, 68-72 ℃: 30 s-3 min, and 25-40 cycles in total; 68-72 ℃: 0-30 min.
On the basis of the method and the conditions, the detection method can quickly, effectively and conveniently synchronously obtain the gene polymorphism of two SNP loci of the APOE gene of the sample to be detected, most commonly rs429358 and rs7412 loci. May be used for non-diagnostic purposes. In general, when the rs429358 and rs7412 sites of the APOE gene are amplified by using the upstream primer SEQ ID NO.1 and the downstream primer SEQ ID NO.2, the length of the corresponding amplified product is 728 bp. The DNA fragment was then recovered by cutting and sequenced.
According to a preferred embodiment of the present invention, the step (4) of determining gene polymorphism comprises: electrophoretically detecting the PCR product to verify the amplified fragment size of the PCR product; and after the verification is correct, performing sequence determination on the PCR product to obtain the gene polymorphism conditions of the rs429358 and rs7412 loci of the APOE gene of the sample to be detected. In detail, the PCR amplified fragment can be detected by agarose gel electrophoresis or polyacrylamide gel electrophoresis.
Compared with the prior art, the invention at least has the following beneficial effects: (1) and (3) improving the detection flux: generally, each PCR reaction only aims at one SNP site, but the invention can simultaneously detect 2 SNP sites of the APOE gene, and can detect the gene polymorphism of the rs429358 and rs7412 sites of the APOE gene through one reaction. Therefore, more than 90 samples can be detected simultaneously, the detection efficiency is improved, and the cost is greatly saved. (2) The cost is reduced: the invention can reduce the PCR reaction system from 2 systems/procedures to 1 system/procedure, thereby reducing the use amount of reagents and consumables such as DNA polymerase, dNTP and the like and greatly reducing the detection cost.
Drawings
FIG. 1 shows the result of agarose gel electrophoresis detection according to an embodiment of the present invention;
FIG. 2 is a diagram showing a portion of a PCR product sequence determination result for a SNP site according to an embodiment of the present invention;
FIG. 3 shows a portion of the PCR product sequence determination result for another SNP site according to an embodiment of the present invention.
Detailed Description
To further illustrate the present invention, reference is made to the following examples. Specifically, the reagents used in the implementation of the invention are all commercial products, and the databases used in the implementation of the invention are all public online databases. The following examples are illustrative only and are not to be construed as limiting the invention.
Example 1
Designing and synthesizing a primer pair, comprising the following steps:
step 1.1: designing an upstream primer and a downstream primer for specifically amplifying the locus including the rs429358 and the rs7412 based on the upstream and downstream gene sequences including the locus including the rs429358 and the rs7412 of the APOE gene.
For designing the primers, Primer Quest and Primer Premier 5.0 are adopted to design the primers and analyze the mismatch of the dimer and the stem loop, and the primers are designed at two ends of two SNP sites.
The primer pair provided in this example covers the rs429358 and rs7412 sites of the APOE gene. Because the amplification efficiency of the primers is obviously reduced and the specificity is deteriorated due to small sequence change, PCR primer pairs are respectively designed aiming at different sites, and after the screening of a pre-experiment, the length of a product fragment and the site inclusion condition are integrated, and the primer pair with the best amplification effect shown in the following table 1 is selected.
TABLE 1
| Primer name | Primer sequence 5 '-3' |
| SEQ ID NO.1 | gcgctgatggacgagaccatgaagg |
| SEQ ID NO.2 | ggcttcggcgttcagtgattgtcg |
Step 1.2: the primer pair designed in 1.1 was synthesized.
Example 2
The method for extracting the genome DNA from the sample to be detected comprises the following steps:
step 2.1: mouth shed cells were collected with a mouth swab or fresh peripheral blood samples were collected with an EDTA blood collection tube.
In this embodiment, the sample source is a human body.
Step 2.2: genomic DNA was extracted from the specimen using a Tiangen buccal swab genomic DNA extraction kit (DP322) or a blood/cell/tissue genomic DNA extraction kit (DP304), and the concentration and purity of the DNA were measured using NP80-touch (IMPLEN, Germany) to preserve the genomic DNA.
Example 3
The PCR detection method for synchronously detecting the rs429358 and rs7412 site gene polymorphism of the APOE gene comprises the following steps:
step 3.1: and (3) taking the genome DNA obtained in the step 2.2 as an amplification template, and adopting the primer pair synthesized in the step 1.2 to prepare a PCR reaction system.
In this example, a PCR amplification system was prepared by using DNA polymerase and buffer solution as basic raw materials in KOD FX enzyme system (cat. KFX-101) manufactured by Toyobo, Inc., and adjusting the primer concentration, dNTP concentration, buffer solution concentration and enzyme amount based on the amplification system in the enzyme system specification, and the specific composition of this reaction system is shown in Table 3 below. Of course, the equal scale enlargement/reduction of the reaction system is within the protection scope of the embodiment of the invention; the amplification can also be achieved by replacing other DNA polymerase systems and adjusting the appropriate proportion.
TABLE 3
Primer concentration was 10 micromolar; the amount of the DNA template can be adjusted, and 30ng of genomic DNA can be used in this example.
Step 3.2: the PCR instrument was programmed according to the PCR reaction conditions shown in Table 4 below.
TABLE 4
Step 3.3: and (3) carrying out PCR amplification reaction on the PCR reaction system prepared in the step 3.1 by using a programmed PCR instrument to obtain a PCR product.
Example 4
Electrophoresis detection, comprising the following steps:
step 4.1: the PCR product obtained in step 3.3 was examined by agarose gel electrophoresis to verify the size of the PCR product fragment.
The detection results are shown in fig. 1, ZFY, JYX, PSF, and the like shown in fig. 1 are mainly used for distinguishing different samples to be detected, the left-most column of fig. 1 shows a ruler bar, the right-most column shows the electrophoresis results of PCR products of the blank control group, and the middle columns show the electrophoresis results of PCR products of different samples.
According to the comparison between the position of each product bright band and the left scale bar, whether the product bright band corresponds to the target amplification product can be identified.
Referring to fig. 1, it can be seen from the electrophoresis results of the blank set that the environmental factors have no adverse effect on the electrophoresis detection results of the sample to be detected. According to the electrophoresis result of each sample to be detected, the existing strip is a corresponding PCR amplification product, and the size of the strip is consistent with the theory; the strip is clear, has no smear and the like, and has good bright strip effect. Thus, when the PCR amplification primer pair designed in step 1.1 is used for PCR amplification, only the expected target product is generated, but no other unrelated product is generated, and the primer pair is reasonably designed.
Step 4.2: after the size of the PCR product fragment is verified to be correct, the sequence of the PCR product can be determined.
Example 5
Sequence determination comprising the steps of:
step 5.1: and (4) after the sizes of the PCR product fragments are verified to be correct in the step 4.2, sending the PCR product obtained in the step 3.3 to a sequencing company for sequence determination to obtain a sequencing result in the format of ab 1.
Step 5.2: analyzing the sequencing result obtained in the step 5.1 by using Chromas sequence analysis software to obtain the gene polymorphism conditions of the rs429358 and rs7412 sites of the APOE gene.
The partial sequencing results are shown in FIGS. 2-3.
Referring to FIG. 2, FIG. 2 shows the nucleotide base sequence at and upstream and downstream of the gene polymorphism site rs 429358. Referring to the box line portion in fig. 2, it can be seen that the genotype at the rs429358 site of the exemplary sample is homozygous TT.
Referring to fig. 3, fig. 3 shows the nucleotide base sequence at the gene mutation site rs7412 and upstream and downstream thereof. Referring to the box line portion in fig. 3, the genotype at the rs7412 site of the sample is known as homozygous CC.
Example 6: configuration of the kit
According to the above experimental results, the present example provides a preferred kit for simultaneously detecting gene polymorphisms at two SNP sites of the APOE gene, which comprises the following reagents:
1. PCR primer pair: f upstream primer (10. mu.M), R downstream primer (10. mu.M);
2、KOD FX(1U/μl)；
3、2×PCR buffer for FX；
4、dNTP(2mM)；
5. a sample DNA extraction reagent;
6. sample collection receptacles (e.g., containing oral swabs and swab receptacles/tubes);
7. ultrapure water.
The reagent is reasonably placed in the kit, the instructions (optionally reconfigured with a PCR tube or a pore plate or a pipette) of the kit are put in the kit, the instructions comprise the step of collecting the sample to be detected, the collected sample is put in a storage box/tube, the step of DNA extraction is carried out, and finally the PCR amplification process is carried out according to the detection method.
It should be noted that, in this document, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus. Without further limitation, an element defined by the phrase "comprising an … …" does not exclude the presence of other similar elements in a process, method, article, or apparatus that comprises the element.
The above-mentioned embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements made to the technical solution of the present invention by those skilled in the art without departing from the spirit of the present invention shall fall within the protection scope defined by the claims of the present invention.
Sequence listing
<110> Beijing and Hei medical diagnostic technology GmbH
<120> method for simultaneously detecting gene polymorphisms at two SNP sites of APOE gene
<130>ss191-208
<160>2
<170>SIPOSequenceListing 1.0
<210>1
<211>25
<212>DNA
<213> Artificial sequence ()
<400>1
gcgctgatgg acgagaccat gaagg 25
<210>2
<211>24
<212>DNA
<213> Artificial sequence ()
<400>2
ggcttcggcg ttcagtgatt gtcg 24
Claims (10)
1. A primer pair for synchronously detecting gene polymorphism of two SNP sites of an APOE gene is characterized by comprising a pair of primers, wherein the nucleotide sequence of an upstream primer is shown by SEQ ID NO.1, and the nucleotide sequence of a downstream primer is shown by SEQ ID NO. 2.
2. The primer pair of claim 1, wherein the SNP sites are rs429358 and rs7412 sites of an APOE gene.
3. Use of the primer set according to claim 1 or 2 for the preparation of a kit for simultaneous detection of gene polymorphisms at two SNP sites of an APOE gene.
4. A kit for simultaneously detecting gene polymorphisms at two SNP sites of an APOE gene, which comprises the primer set according to claim 1 or 2.
5. The kit according to claim 4, further comprising a DNA polymerase, a PCR buffer, a mixture of 4 dNTPs, and ultrapure water.
6. The kit according to claim 5, wherein the DNA polymerase is used in an amount of 0.5 to 5U, each dNTP is used at a final concentration of 50 to 500. mu.M, and the primer is used at a final concentration of 20 to 300 nM.
7. The kit according to any one of claims 4 to 6, further comprising a test sample DNA extraction reagent or DNA extraction kit.
8. A method for detecting gene polymorphism of two SNP sites of an APOE gene simultaneously, which is characterized in that a primer pair according to claim 1 or 2 is used for carrying out PCR detection on a sample to be detected.
9. The detection method according to claim 8, characterized by comprising the steps of:
(1) extracting genome DNA from a sample to be detected as an amplification template;
(2) preparing a PCR reaction system containing the primer pair and the amplification template;
(3) carrying out PCR amplification reaction on the PCR reaction system to obtain a PCR product;
(4) and determining the gene polymorphism of two SNP sites of the APOE gene according to the PCR product.
10. The detection method according to claim 9, wherein the reaction conditions of the PCR amplification reaction are: 94 ℃ below zero: 1-10 min; 98 ℃ C: 5-20 s, and 58-68 ℃: 10-60 s, 68-72 ℃: 30 s-3 min, and 25-40 cycles in total; 68-72 ℃: 0-30 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010369738.0A CN111518888A (en) | 2020-04-30 | 2020-04-30 | Method for synchronously detecting gene polymorphism of two SNP sites of APOE gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010369738.0A CN111518888A (en) | 2020-04-30 | 2020-04-30 | Method for synchronously detecting gene polymorphism of two SNP sites of APOE gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111518888A true CN111518888A (en) | 2020-08-11 |
Family
ID=71905375
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010369738.0A Pending CN111518888A (en) | 2020-04-30 | 2020-04-30 | Method for synchronously detecting gene polymorphism of two SNP sites of APOE gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111518888A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050196794A1 (en) * | 2004-02-18 | 2005-09-08 | Peter Nurnberg | Use of haplotypes and SNPs in lipid-relevant genes for the analysis and diagnosis of cardiovascular disease |
| CN104862402A (en) * | 2015-05-29 | 2015-08-26 | 沈阳优吉诺生物科技有限公司 | Primers for detecting ApoE gene polymorphism, kit and PCR (polymerase chain reaction) method for primers or kit |
| CN105886608A (en) * | 2015-12-22 | 2016-08-24 | 武汉康昕瑞基因健康科技有限公司 | ApoE gene primer group, detection kit and detection method |
| CN108048565A (en) * | 2018-02-09 | 2018-05-18 | 北京爱普益医学检验中心有限公司 | A kind of primer for detecting ApoE gene pleiomorphisms and its detection method and application |
-
2020
- 2020-04-30 CN CN202010369738.0A patent/CN111518888A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050196794A1 (en) * | 2004-02-18 | 2005-09-08 | Peter Nurnberg | Use of haplotypes and SNPs in lipid-relevant genes for the analysis and diagnosis of cardiovascular disease |
| CN104862402A (en) * | 2015-05-29 | 2015-08-26 | 沈阳优吉诺生物科技有限公司 | Primers for detecting ApoE gene polymorphism, kit and PCR (polymerase chain reaction) method for primers or kit |
| CN105886608A (en) * | 2015-12-22 | 2016-08-24 | 武汉康昕瑞基因健康科技有限公司 | ApoE gene primer group, detection kit and detection method |
| CN108048565A (en) * | 2018-02-09 | 2018-05-18 | 北京爱普益医学检验中心有限公司 | A kind of primer for detecting ApoE gene pleiomorphisms and its detection method and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104805206B (en) | The kit and its detection method of detection TERT gene promoter mutation | |
| EP0402400B1 (en) | Genetic identification employing dna probes of variable number tandem repeat loci | |
| JP2004528027A (en) | Diagnostic test | |
| CN110564861B (en) | Fluorescent marker composite amplification kit for human Y chromosome STR locus and InDel locus and application thereof | |
| US20100015619A1 (en) | Method of detecting genomic aberrations for prenatal diagnosis | |
| CN111394441B (en) | Primer group, kit and method for amplification of vitamin A related genes | |
| JP2014511691A (en) | A novel marker related to beta-ceracemic traits | |
| CN110863040A (en) | Method for detecting CYP3A5 gene polymorphism by fluorescent quantitative PCR | |
| CN110904215A (en) | Method for synchronously detecting gene polymorphism of two SNP sites of SLCO1B1 gene | |
| CN111518888A (en) | Method for synchronously detecting gene polymorphism of two SNP sites of APOE gene | |
| CN108517357B (en) | Kit for detecting sudden cardiac death-related SNP (single nucleotide polymorphism) on SCN5A gene related to sudden cardiac death and detection method thereof | |
| EP1829979B1 (en) | Method of identifying gene with variable expression | |
| CN111363806B (en) | Primer group for detecting vitamin B12 metabolic gene mutation and application method thereof | |
| CN110885884A (en) | Method for synchronously detecting polymorphism of CYP2C19 gene 2, 3, 17 locus gene | |
| CN113774154A (en) | Method for screening related molecular markers of bovine body hypervariability and application thereof | |
| CN111334582A (en) | Method for synchronously detecting 4 exon gene mutations of P53 gene | |
| CN110819701A (en) | Method for detecting CYP2D6 gene polymorphism by fluorescent quantitative PCR | |
| CN111500726A (en) | Primer group for detecting pathogenic gene mutation of pheochromocytoma and paraganglioma and application method thereof | |
| CN111172248A (en) | General kit for verifying copy number variation based on fragment analysis technology | |
| KR20030051425A (en) | Polymorphic Marker That Can Be Used to Assess the Efficacy of Interferon Therapy | |
| CN106282171B (en) | STR locus of PKD2 gene and application thereof | |
| CN111534591A (en) | Method for synchronously detecting gene polymorphism of two SNP sites of UGT1A1 gene | |
| CN110872611A (en) | Method for synchronously detecting metabolic gene polymorphism of warfarin | |
| CN112280852B (en) | SMN1 gene mutation detection kit and application thereof | |
| CN116855606B (en) | Gene mutant, detection primer and kit for heart myxoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200811 |