CN113528557A

CN113528557A - Gene element combination, recombinant plasmid combination, genetic engineering strain and method for high yield of N-acetyl serotonin

Info

Publication number: CN113528557A
Application number: CN202110908917.1A
Authority: CN
Inventors: 杨志彬; 田俊波; 李迁; 崔金旺; 邢瑞静; 张永刚
Original assignee: Hebei Weidakang Biotechnology Co ltd
Current assignee: Hebei Weidakang Biotechnology Co ltd
Priority date: 2021-08-09
Filing date: 2021-08-09
Publication date: 2021-10-22

Abstract

The invention relates to the technical field of biology, in particular to a genetic element combination, a recombinant plasmid combination, a genetic engineering strain and a method for producing N-acetyl serotonin at high yield. The gene element combination consists of a gene element 1 and a gene element 2; the gene element 1 comprises a 5-hydroxytryptophan decarboxylase gene and an aromatic alkylamine-N-acetyltransferase gene; genetic element 2 comprises a chaperone gene. The invention provides a simple and effective implementation method for safe biotransformation of N-acetyl serotonin, which utilizes a T7 promoter to ensure that 5-hydroxytryptophan decarboxylase and aromatic alkylamine-N-acetyltransferase are expressed in series in escherichia coli, and the soluble expression of the 5-hydroxytryptophan decarboxylase and the aromatic alkylamine-N-acetyltransferase is enhanced through the co-expression with molecular chaperone plasmids, so that the content of the product N-acetyl serotonin is obviously improved, and the yield of the engineering bacteria biotransformed N-acetyl serotonin reaches 10-20 g/L.

Description

Gene element combination, recombinant plasmid combination, genetic engineering strain and method for high yield of N-acetyl serotonin

Technical Field

The invention relates to the technical field of biology, in particular to a genetic element combination, a recombinant plasmid combination, a genetic engineering strain and a method for producing N-acetyl serotonin at high yield.

Background

N-acetyl serotonin, a naturally occurring compound, is an endogenous synthetic reaction intermediate from serotonin to melatonin. The pace of modern society's life is fast, which causes many health problems, most of which are related to the production level of N-acetyl serotonin in the body, such as stress, lack of sleep, malnutrition, lack of exercise, etc., which may cause the reduction of N-acetyl serotonin, and when the N-acetyl serotonin is reduced to a certain extent, the reduction will affect the personal plan and the tissue ability, even cause depression. Research finds that the N-acetyl serotonin can enhance the immunity of human bodies, improve the sleep quality and relieve depression by supplementing the N-acetyl serotonin, so the production of the N-acetyl serotonin is a focused problem of contemporary society.

When the synthesis of the N-acetyl serotonin mainly depends on a chemical method, toxic substances are used in the production process, the synthesis steps are complicated and tedious, the byproducts are too many, the purity of the obtained product is low, and the defects cause that the medicinal value is low, but the new method, namely biosynthesis, can well solve the problems. Up to now, no genetically engineered strains related to N-acetyl serotonin have been found.

Disclosure of Invention

In view of the above, the present invention provides a combination of genetic elements, a combination of recombinant plasmids, a genetically engineered strain and a method for producing N-acetyl serotonin at high yield. The yield of the engineering bacteria for biotransformation of N-acetyl serotonin reaches 10-20 g/L.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a gene element combination for high-yield N-acetyl serotonin, which consists of a gene element 1 and a gene element 2; the gene element 1 comprises a 5-hydroxytryptophan decarboxylase gene and an aromatic alkylamine-N-acetyltransferase gene; genetic element 2 comprises a chaperone gene.

The microorganism is a genetic engineering strain integrating 5-hydroxytryptophan decarboxylase and aromatic alkylamine-N-acetyltransferase, the 5-hydroxytryptophan decarboxylase and the aromatic alkylamine-N-acetyltransferase are co-expressed in escherichia coli by using a strong promoter, and soluble expression is realized by using molecular chaperones, so that the yield of N-acetyl serotonin products is improved, and feasibility is provided for producing the N-acetyl serotonin by using the bioconversion of the engineering strain.

In the invention, N-acetyl serotonin is synthesized by converting 5-hydroxytryptophan under 5-hydroxytryptophan decarboxylase to generate 5-hydroxytryptamine and then synthesizing the 5-hydroxytryptamine under aromatic alkylamine-N-acetyltransferase, and the effective synthetic pathway is reconstructed in microbial cells, so that the mass synthesis of the N-acetyl serotonin is realized. According to the invention, the aromatic alkylamine-N-acetyltransferase which can be expressed in escherichia coli in a soluble manner is excavated through the genome, and is co-expressed with the molecular chaperone, so that correct folding of a nascent peptide chain is promoted, the soluble expression of the enzyme is greatly increased, the yield of N-acetyl serotonin is remarkably improved, and support is provided for large-scale industrial production of the N-acetyl serotonin.

Preferably, the sequence of the 5-hydroxytryptophan decarboxylase gene is a sequence shown by SEQ ID NO.1, or a sequence shown by SEQ ID NO.1 and having more than 80% of sequence homology;

preferably, the sequence of the aromatic alkylamine-N-acetyltransferase gene is a sequence shown by SEQ ID NO.6, or a sequence shown by SEQ ID NO.6, wherein the homology of the sequence is more than 80%;

preferably, the chaperone is GroES-GroEL.

The invention also provides a recombinant plasmid combination for high-yield N-acetyl serotonin, which consists of a recombinant plasmid 1 and a recombinant plasmid 2; the recombinant plasmid 1 comprises a 5-hydroxytryptophan decarboxylase gene, an aromatic alkylamine-N-acetyl transferase gene and a plasmid vector; the recombinant plasmid 2 is a molecular chaperone plasmid.

preferably, the chaperone plasmid is a pGro7 plasmid.

Preferably, the plasmid vector is pET28 a.

The invention also provides a genetic engineering strain for high yield of N-acetyl serotonin, which comprises the recombinant plasmid combination and the chassis strain.

Preferably, the underpan strain is E.coli.

In the particular example provided by the present invention, the Chassis strain is E.coli BL21(DE 3).

The invention also provides a construction method of the genetic engineering strain, and the recombinant plasmid combination is co-transferred into a chassis strain to obtain the genetic engineering strain.

The invention also provides a method for synthesizing N-acetyl serotonin, which comprises the following steps:

(1) inoculating the genetic engineering strain into a fermentation culture medium for fermentation culture;

(2) adding an inducer into a fermentation medium for induced expression, and then adding a cell penetrating agent for penetrating treatment;

(3) adding substrate 5-hydroxytryptophan into the fermentation medium for biotransformation to obtain N-acetyl serotonin.

Preferably, the inducer is IPTG and arabinose;

preferably, the cell permeabilizer is one or more of polymyxin B, lysozyme or CT.

Preferably, the cell permeabilizing agent is polymyxin B.

Preferably, the biotransformation temperature is 20-45 ℃ and the time is 8-50 h.

Preferably, the temperature of biotransformation is 28-37 ℃, and the time is 20-40 h.

More preferably, the temperature of the biotransformation is 30 ℃ and the time is 28 h.

Preferably, in the step (3), pyridoxal phosphate is added simultaneously with the addition of the substrate 5-hydroxytryptophan to the fermentation medium.

Preferably, the amount of pyridoxal phosphate to be added is 0.1 to 10 mM.

Preferably, the addition amount of pyridoxal phosphate is 0.5-5 mM.

In the specific embodiment provided by the invention, the fermentation medium (mass percent) is 1.2 percent of tryptone, 2.4 percent of yeast extract, 0.5 percent of glycerol and 0.231 percent of KH₂PO₄And 1.64% K₂HPO₄·3H₂O。

Preferably, the culture conditions of the fermentation medium are 28-40 ℃ and 160-230 rpm.

Preferably, the fermentation medium is cultured at 37 ℃ and 225 rpm.

Preferably, the adding time of the inducer is 1-3h after fermentation culture.

Preferably, the inducer is added for 2 hours after fermentation culture.

Preferably, the final concentration of IPTG is 0.1-1 mM.

Preferably, the final concentration of IPTG is 1 mM.

Preferably, the final concentration of arabinose is 0.5 to 4 mg/ml.

Preferably, the final concentration of arabinose is 4 mg/ml.

Preferably, the condition for inducing expression is 16-37 ℃.

Preferably, the conditions for inducing expression are 25 ℃.

Preferably, the adding time of the substrate is 6-15h after the induction expression.

Preferably, the substrate addition time is 10h after induction of expression.

Preferably, the substrate concentration is 0.1-1M.

Preferably, the substrate concentration is 0.2M.

The invention provides a gene element combination, a recombinant plasmid combination, a genetic engineering strain and a method for high-yield N-acetyl serotonin. The gene element combination consists of a gene element 1 and a gene element 2; the gene element 1 comprises a 5-hydroxytryptophan decarboxylase gene and an aromatic alkylamine-N-acetyltransferase gene; genetic element 2 comprises a chaperone gene. Compared with the prior art, the invention has the following beneficial effects:

the invention provides a simple and effective implementation method for safe biotransformation of N-acetyl serotonin, which utilizes a T7 promoter to ensure that 5-hydroxytryptophan decarboxylase and aromatic alkylamine-N-acetyltransferase are expressed in series in escherichia coli, and the soluble expression of the 5-hydroxytryptophan decarboxylase and the aromatic alkylamine-N-acetyltransferase is enhanced through the co-expression with molecular chaperone plasmids, so that the content of the product N-acetyl serotonin is obviously improved, and the yield of the engineering bacteria biotransformed N-acetyl serotonin reaches 10-20 g/L.

Drawings

FIG. 1 is a schematic diagram showing the construction of recombinant plasmid pET28 a-hsDDC-expressing 5-hydroxytryptophan decarboxylase in example 1;

FIG. 2 is a schematic diagram showing the construction of recombinant plasmid pET28a-hsDDC-hsAANAT for expressing 5-hydroxytryptophan decarboxylase and aromatic alkylamine-N-acetyltransferase in example 2;

FIG. 3 is the schematic diagram of the construction of engineering bacteria of recombinant plasmid pET28a-hsDDC-hsAANAT and molecular chaperone pGro7G in example 3.

Detailed Description

The invention discloses a gene element combination, a recombinant plasmid combination, a genetic engineering strain and a method for high yield of N-acetyl serotonin, and a person skilled in the art can realize the combination by appropriately improving process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The invention aims to provide an engineering bacterium for synthesizing N-acetyl serotonin by using 5-hydroxytryptophan as a substrate and simultaneously expressing 5-hydroxytryptophan decarboxylase and aromatic alkylamine-N-acetyltransferase.

The second purpose of the invention is to provide a construction method of an engineering strain for producing N-acetyl serotonin by taking 5-hydroxytryptophan as a substrate. The system simultaneously catalyzes two reaction systems by utilizing an enzyme coupling method, wherein one enzyme system is 5-hydroxytryptophan decarboxylase to catalyze the decarboxylation of a 5-hydroxytryptophan substrate to produce 5-hydroxytryptamine, and then the 5-hydroxytryptamine produces N-acetyl serotonin under an aromatic alkylamine-N-acetyl transferase system; meanwhile, the system and molecular chaperone plasmid are co-expressed, so that correct folding of a new peptide chain is promoted, soluble expression of enzyme in the system is enhanced, and the efficiency of catalytic reaction is improved, thereby greatly improving the yield of the product N-acetyl serotonin.

The invention also aims to provide a biotransformation method of engineering bacteria for synthesizing N-acetyl serotonin by taking 5-hydroxytryptophan as a substrate.

In the above engineering bacteria, the 5-hydroxytryptophan decarboxylase and aromatic alkylamine-N-acetyltransferase are all expressed after being placed in a promoter of an exogenous expression plasmid, the aromatic alkylamine-N-acetyltransferase gene sequence is expressed after being placed in the 5-hydroxytryptophan decarboxylase gene, and the transcription of the 5-hydroxytryptophan decarboxylase and the aromatic alkylamine-N-acetyltransferase is initiated by T7RNA polymerase in the engineering strain.

The 5-hydroxytryptophan decarboxylase and the aromatic alkylamine-N-acetyltransferase can be heterologous enzymes or endogenous enzymes.

The heterologous 5-hydroxytryptophan decarboxylase is derived from one or more of Homo sapiens (hsDDC), Rattus norvegicus (rnDDC), Sparus aurata (sadDC); the heterologous aromatic alkylamine-N-acetyltransferase is derived from one or more of Homo sapiens (hsAANAT), Rattus norvegicus (rnAANAT) and Sparus aurata (saAANAT); the nucleotide sequences of the heterologous 5-hydroxytryptophan decarboxylase and the aromatic alkylamine-N-acetyltransferase are sequences subjected to codon optimization according to the codon preference of Escherichia coli.

The construction method of the engineering bacteria for synthesizing the N-acetyl serotonin by using the 5 hydroxytryptophan as the substrate microorganisms comprises the following steps:

(1) carrying out linearization treatment on the pET28a vector by utilizing a PCR technology or an enzyme digestion method, wherein a recovered product is a linearization vector fragment marked as pET28 a-reverse amplification, and the size of the linearization vector fragment is 5206 bp;

(2) respectively carrying out PCR amplification on 5-hydroxytryptophan decarboxylase and aromatic alkylamine-N-acetyltransferase by using specific primers, and recovering target fragments which are respectively marked as DDC and AANAT;

(3) connecting and transforming the target fragment containing the coding genes of the 5-hydroxytryptophan decarboxylase and the aromatic alkylamine-N-acetyltransferase with the linearized vector pET28 a-by a seamless cloning method in sequence to obtain recombinant expression vectors pET28a-DDC and pET28 a-DDC-AANAT;

(4) the recombinant expression vector pET28a-DDC-AANAT and molecular chaperone plasmid are co-transformed into BL21(DE3) to obtain an engineering strain.

The nucleotide sequences of the 5-hydroxytryptophan decarboxylase hsDDC, rnDDC and sadDC are respectively shown in SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, and the nucleotide sequences of the aromatic alkylamine-N-acetyltransferase hsAANAT, rnAANAT and saAANAT are respectively shown in SEQ ID No.4, SEQ ID No.5 and SEQ ID No. 6.

The molecular chaperones overexpressing 5-hydroxytryptophan decarboxylase and aromatic alkylamine-N-acetyltransferase are one or more of pGro7, pG-KJE8, pKJE7 and pTf 16.

A biotransformation method of N-acetyl serotonin also belongs to the protection scope of the invention, comprising the following steps:

(1) culturing any one of the engineering bacteria in a seed culture medium containing antibiotics to obtain a seed solution;

(2) inoculating the seed liquid into a fermentation culture medium for fermentation culture;

(3) fermenting for a certain time, adding an inducer for induction expression, inducing for a certain time, adding a cell penetrating agent for treatment, then adding a substrate 5-hydroxytryptophan for biotransformation, and detecting the yield of 5-hydroxytryptophan or N-acetyl serotonin by using a liquid chromatography (HPLC) after the transformation for a certain time.

The antibiotic is one or more of chloramphenicol and kanamycin;

the seed liquid OD₆₀₀＝5-10；

The seed culture medium comprises (by mass) 1% of tryptone, 1% of sodium chloride and 0.5% of yeast extract;

the culture conditions of the seed liquid are 28-40 ℃, 160-230rpm, preferably 37 ℃ and 225 rpm;

the culture time of the seed liquid is 10-15h, preferably 15 h;

the proportion of the seed liquid to the fermentation medium is 1-2%, and the optimal proportion is 2%;

the fermentation medium comprises (by weight) tryptone 1.2%, yeast extract 2.4%, glycerol 0.5%, and KH 0.231%₂PO₄And 1.64% K₂HPO₄·3H₂O；

The culture conditions of the fermentation culture medium are 28-40 ℃, 160-230rpm, preferably 37 ℃ and 225 rpm;

the adding time of the inducer is 1-3h after fermentation culture, preferably 2 h;

the inducer is IPTG and arabinose;

the final concentration of IPTG is 0.1-1mM, preferably 1 mM;

the final concentration of the arabinose is 0.5-4mg/ml, preferably 4 mg/ml;

the condition for inducing expression is 16-37 ℃, preferably 25 ℃;

the cell penetrating agent is one or more of polymyxin B, lysozyme and CT, and preferably polymyxin B;

the substrate is 5-hydroxytryptophan;

the adding time of the substrate is 6-15h after induction expression, preferably 10 h;

the substrate concentration is 0.2M;

the biotransformation time is 8-50h, preferably 28 h.

The biotransformation temperature is 20 to 45 ℃ and preferably 30 ℃.

The gene sequences of the 5-hydroxytryptophan decarboxylase and the aromatic alkylamine-N-acetyltransferase are not limited to the following examples, and the technical scheme of constructing engineering bacteria to synthesize the N-acetyl serotonin by using the gene sequences with homology of more than 80% in the examples also belongs to the protection scope of the invention.

The vectors, genes and consumables used in the present invention are commercially available.

The invention is further illustrated by the following examples:

example 1: construction of recombinant plasmid and strain for expressing 5-hydroxytryptophan decarboxylase

1. Construction of recombinant expression vectors pET28a-hsDDC, pET28a-rnDDC and pET28a-sadDC

(1) PCR amplification is carried out by taking a pET28a vector as a template and utilizing primers P-a and P-b; the pET28a vector is a commercial vector purchased from Novagen; the sequence of the primer P-a is 5'-GGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGG-3', and the sequence of the primer P-b is 5'-GATCCGGCTGCTAACAAAGCC-3'; recovering the PCR product to obtain a linearized vector pET28a, wherein the size of the linearized vector fragment is 5206 bp;

(2) respectively taking artificially synthesized hsDDC, rnDDC and sadDC genes as templates, respectively taking primers of the genes as P1 and P2, P3 and P4, P5 and P6, carrying out PCR amplification, recovering the amplification products to obtain target fragments of the hsDDC, rnDDC and sadDC, wherein the sizes of the fragments are 1479bp, 1479bp and 1332bp respectively, the nucleotide sequences of the fragments are shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, the sequence of the primer P1 is 5'-TTAAGAAGGAGATATACCATGAACGCAAGCGAATTCCG-3', and the sequence of the primer P2 is 5'-TTTGTTAGCAGCCGGATCTTAATCACGTTCCGCACGCAG-3'; the primer P3 sequence 5'-TTAAGAAGGAGATATACCATGGATTCCCGCGAGTTTCG-3', the primer P4 sequence 5'-TTTGTTAGCAGCCGGATCTTATTCTTTTTCAGCGCGCAGGACA-3'; the primer P5 sequence 5'-TTAAGAAGGAGATATACCATGGACGCGGCGGAA-3', the primer P6 sequence 5'-TTTGTTAGCAGCCGGATCTTAAGCACGAGTCGGGGTAACG-3';

SEQ ID NO.1(Homo sapiens)1443bp

ATGAACGCAAGCGAATTCCGTCGCCGTGGCAAAGAAATGGTAGATTACGTAGCGAACTACATGGAGGGTATCGAGGGCCGTCAGGTTTACCCAGATGTGGAACCGGGCTACCTGCGTCCGCTGATCCCGGCTGCTGCGCCGCAAGAACCGGACACTTTCGAAGACATTATCAACGACGTGGAGAAAATCATTATGCCGGGCGTTACTCATTGGCACAGCCCGTACTTCTTTGCGTACTTCCCGACTGCATCCTCCTACCCGGCCATGCTGGCGGACATGCTGTGCGGTGCGATCGGTTGTATCGGTTTCTCTTGGGCGGCAAGCCCGGCATGTACTGAACTGGAAACCGTGATGATGGACTGGCTGGGTAAAATGCTGGAACTGCCAAAAGCATTCCTGAACGAAAAAGCTGGCGAGGGTGGCGGTGTGATTCAGGGTAGCGCGAGCGAAGCCACTCTGGTTGCACTGCTGGCGGCGCGCACCAAGGTGATCCACCGTCTGCAGGCTGCTTCCCCTGAACTGACCCAGGCTGCTATTATGGAAAAACTGGTCGCCTATAGCTCTGATCAGGCACATAGCTCTGTTGAACGCGCGGGTCTGATCGGCGGTGTAAAACTGAAAGCGATCCCGAGCGATGGCAACTTCGCAATGCGTGCATCCGCCCTGCAGGAAGCGCTGGAACGTGACAAGGCAGCTGGCCTGATTCCGTTTTTTATGGTTGCGACCCTGGGTACTACCACCTGCTGCTCCTTCGATAACCTGCTGGAAGTCGGCCCGATTTGCAACAAAGAAGACATCTGGCTGCATGTGGACGCGGCTTACGCAGGCAGCGCATTCATCTGTCCGGAATTTCGTCATCTGCTGAACGGTGTTGAATTCGCCGATAGCTTCAACTTCAACCCGCACAAATGGCTGCTGGTCAACTTTGACTGCTCTGCTATGTGGGTAAAGAAACGTACTGACCTGACCGGCGCGTTCCGCCTGGACCCGACGTATCTGAAACACAGCCATCAGGATTCTGGTCTGATCACCGACTACCGTCACTGGCAGATTCCGCTGGGTCGTCGTTTCCGCAGCCTGAAGATGTGGTTTGTTTTCCGTATGTACGGCGTGAAAGGCCTGCAGGCATACATTCGCAAACACGTGCAACTGTCTCATGAATTTGAATCCCTGGTTCGTCAGGACCCACGTTTTGAAATTTGTGTGGAAGTTATCCTGGGTCTGGTTTGCTTTCGTCTGAAAGGCAGCAACAAAGTAAACGAAGCGCTGCTGCAGCGTATCAACAGCGCTAAGAAAATCCACCTGGTGCCTTGCCACCTGCGCGACAAATTCGTACTGCGTTTCGCTATTTGTTCTCGTACCGTGGAATCTGCTCACGTTCAGCGTGCTTGGGAACACATCAAAGAACTGGCAGCAGATGTCCTGCGTGCGGAACGTGATTAA

SEQ ID NO.2(Rattus norvegicus)1443bp

ATGGATTCCCGCGAGTTTCGTCGTCGCGGTAAGGAAATGGTTGACTACATCGCCGATTATCTGGATGGCATCGAAGGTCGCCCTGTATACCCGGATGTGGAACCTGGTTACCTGCGTGCTCTGATCCCGACCACCGCCCCGCAGGAACCGGAAACCTACGAAGATATCATCCGTGATATCGAAAAAATCATTATGCCGGGTGTAACTCACTGGCACTCTCCGTATTTCTTTGCTTATTTCCCAACTGCGTCTTCCTACCCGGCGATGCTGGCTGACATGCTGTGCGGCGCCATCGGTTGCATTGGCTTCTCTTGGGCTGCGTCCCCGGCATGTACCGAACTGGAAACCGTTATGATGGACTGGCTGGGCAAAATGCTGGAACTGCCGGAAGCTTTCCTGGCTGGTCGTGCAGGTGAAGGTGGTGGCGTTATCCAGGGTTCCGCGTCTGAAGCGACCCTGGTAGCTCTGCTGGCCGCCCGTACTAAAATGATCCGTCAGCTGCAGGCTGCATCTCCGGAACTGACCCAAGCTGCACTGATGGAAAAGCTGGTTGCATACACTTCCGACCAGGCCCACTCCAGCGTCGAACGTGCGGGTCTGATTGGCGGTGTTAAGATTAAAGCTATCCCGTCTGACGGCAACTACTCTATGCGTGCCGCGGCTCTGCGTGAAGCTCTGGAACGTGACAAAGCGGCAGGTCTGATCCCTTTCTTCGTTGTAGTAACTCTGGGTACTACCTCTTGTTGCTCTTTCGACAACCTGCTGGAAGTTGGTCCAATCTGCAACCAGGAAGGTGTTTGGCTGCATATTGATGCGGCTTATGCGGGCAGCGCTTTCATTTGCCCGGAATTCCGTTACCTGCTGAACGGCGTGGAATTCGCCGACTCTTTCAACTTCAACCCGCATAAATGGCTGCTGGTTAACTTTGACTGTTCCGCTATGTGGGTGAAAAAACGCACCGATCTGACGGAGGCTTTCAACATGGACCCGGTATACCTGCGCCACAGCCACCAGGATTCTGGCCTGATTACCGACTACCGTCACTGGCAGATCCCTCTGGGTCGTCGCTTTCGTTCCCTGAAAATGTGGTTCGTTTTCCGCATGTATGGTGTTAAAGGCCTGCAGGCATACATCCGTAAACATGTTAAGCTGAGCCACGAATTCGAATCCCTGGTCCGTCAGGATCCGCGTTTTGAGATCTGTACCGAGGTGATTCTGGGCCTGGTTTGCTTCCGCCTGAAAGGCTCCAACCAGCTGAACGAAACCCTGCTGCAGCGTATCAACTCCGCTAAAAAAATTCACCTGGTTCCGTGCCGTCTGCGTGATAAGTTTGTTCTGCGTTTCGCAGTTTGTTCTCGCACCGTTGAATCTGCTCACGTTCAGCTGGCATGGGAACACATCCGCGATCTGGCGTCTTCTGTCCTGCGCGCTGAAAAAGAATAA

SEQ ID NO.3(Sparus aurata)1296bp

ATGGACGCGGCGGAATTTCGTCGTCGCGGCAAAGAAATGGTTGATTACGTGGCTGACTACCTGGAAAACATTGAACAGCGCCCGGTCTATCCGGATCTGGAACCAGGCTATCTGCGTAGCCTGATCCCAAACGAAGCGCCGGCAGAGCCGGAAACCTACGAAGAAATCATGAAAGACGTGGAACGTGTGATCATGCCGGGCATTACCCATTGGCACTCTCCGTATTTTTACGCTTACTTCCCGGCTGCTTCCAGCTATCCGGCTATGCTGGCGGACATGCTGTGTACCGCGATTGGTTGCATCGGTTTCAGCTGGGCTGCCAGCCCGGCATGTACCGAACTGGAAACTGTTATGATGGATTGGCTGGGTAAAATGCTGCAGCTGCCGGAACATTTCATCGCAGGTACGCACGGTCACGGTGGTGGTGTTATCCAGGGTACCGCATCTGAGGCGACTCTGATGTCTCTGCTGGCTGCACGTTGTAAAGCAGTGCGTCGTGTACAAGCGAGCAATTCCGAACTGCCGGAAGCGGAAATCTTCAGCAAACTGGTGGCGTACACTTCTGAACAGGCTCATAGCAGCGTGGAACGTGCGGCACTGATCGGCGGTGTTATGATGCGTAAAGTTCCGACCGACAACTCTTACGCGGTTGGTGGTGATATGCTGAAAAAAATGGTGGAAGAAGACAAAGCGGCTGGTCTGATTCCGTTCTACTTCTGCGCCACTCTGGGCACTACTCCGTCTTGCGCATTCGATCACATCGCGGAACTGGGTCCGCTGTGCAACAAAGAGAACATGTGGATGCATATCGACGCAGCCTATGCAGGTTCTGCGTTCATCTGTCCGGAATTCCGTCCGCTGCTGAACGGTGTCGAATATGCGGATTCCTTCAATTTCAACCCGCACAAATGGCTGCTGGTGAACTTCGACTGTTCTGCAATGTGGGTTAAAAAACGTGCGGACATCATCGGCGCCTTCAAGTTCGAACCGCTGTACCTGAAACATGAAAACCAGGAATCTGGCCTGGTCACTGACTATCGTCACTGGCAGATTCCGCTGGGTCGTCGTTTTCGTTCTCTGAAACTGTGGTTCGTATTCCGTATGTACGGTCTGTCCGGTCTGCAGGCCCACATCCGTAAAAGCCTGTGTAATCTGCGTGCGCCGGCTGCACCAACTTCTCAGAACCTGTCTGTGGATCCGCTGCGTCTGACGCATCTGTGCCTGCAGCTGAACCTGTCTCTGCCGGTACTGCGTGCGCCAGCAAAACCAAGCGCCGTTACCCCGACTCGTGCTTAA

(3) the PCR amplification procedure was pre-denaturation at 95 ℃ for 5min, denaturation at 94 ℃ for 45s, annealing at 60 ℃ for 45s, extension at 72 ℃ for 1.5min, 35 cycles, and extension at 72 ℃ for 10 min.

(4) The target fragment is connected with a linearization vector pET28a to obtain recombinant plasmids, which are named as pET28a-hsDDC, pET28a-rnDDC and pET28a-sadDC, and the successfully constructed pET28a-hsDDC, pET28a-rnDDC and pET28a-sadDC plasmids are obtained after the sequencing verification is correct.

(5) The plasmid pET28a-hsDDC, pET28a-rnDDC and pET28a-sadDC are transformed into an escherichia coli cloning host by a heat shock transformation method to obtain a positive transformant, then the transformant plasmid with correct sequencing is transformed into an escherichia coli expression host bacterium BL21(DE3) and coated on an LB solid culture medium containing kanamycin, an LB plate is cultured at 37 ℃ to grow the transformant, and the positive transformant is picked to obtain the expected engineering bacterium 1, the engineering bacterium 2 and the engineering bacterium 3.

2. Fermentation culture and biotransformation of engineering bacteria 1, 2 and 3:

(1) culturing engineering bacteria 1, 2 and 3 in seed culture medium containing 50 μ g/mL kanamycin for 10 hr to obtain seed solution, wherein OD of the seed solution₆₀₀The seed culture medium (mass percent) is 1% of tryptone, 1% of sodium chloride and 0.5% of yeast extract, and the culture conditions of the seed liquid are 37 ℃ and 225 rpm;

(2) mixing 2% of the above seedsThe solution was inoculated into a medium containing 1.2% tryptone, 2.4% yeast extract, 0.5% glycerol, 0.231% KH₂PO₄And 1.64% K₂HPO₄·3H₂Performing fermentation culture in a fermentation culture medium (in percentage by mass) of O;

(3) after 2h of fermentation culture, adding 1mM IPTG for induction expression, wherein the temperature of the induction expression is 25 ℃, after 10h of induction expression, adding a cell permeation agent CT with the final concentration of 35 mu g/mL, treating for 30min, adding a substrate 5-hydroxytryptophan with the final concentration of 0.2M and using ethanol for solubilization, performing a biotransformation stage, performing transformation for 28h at the temperature of 28 ℃, and detecting the yield of the 5-hydroxytryptamine by using High Performance Liquid Chromatography (HPLC).

3. Detecting 5-hydroxytryptamine by high performance liquid chromatography:

(1) adding 1mL of methanol into 1mL of the conversion solution for dissolving to obtain a product dissolved substance;

(2) centrifuging the product dissolved substance at 5000rpm for 10min, and taking supernatant;

(3) filtering the supernatant with a 0.22 mu m filter membrane in a brown liquid bottle to obtain a sample to be detected;

(4) the chromatographic conditions of the high performance liquid chromatography are as follows: the chromatographic column is C18(250mm 4.6mm, 5 μm) or equivalent chromatographic column, the mobile phase is 90 wt% phosphate buffer and 10 wt% methanol, the flow rate is 1mL/min, the sample amount is 10 μ L, and the temperature of the column incubator is 35 deg.C;

(5) the 5-hydroxytryptamine content was finally calculated based on the peak area of the 5-hydroxytryptamine standard, and the results are shown in Table 1.

Table 1: content of biotransformed 5-hydroxytryptamine

As can be seen from Table 1, it can be seen that the type of 5-hydroxytryptophan decarboxylase (DDC) affects the conversion amount of 5-hydroxytryptophan, as compared with the engineered strains separately recombining 5-hydroxytryptophan decarboxylase (DDC) plasmids, wherein 5-hydroxytryptophan of engineered strain 1 is relatively higher among engineered strain 1, engineered strain 2 and engineered strain 3.

Example 2: construction of recombinant plasmid and strain for expressing 5-hydroxytryptophan decarboxylase and aromatic alkylamine-N-acetyltransferase

1. Construction of recombinant expression vectors pET28a-hsDDC-hsAANAT, pET28a-hsDDC-rnAANAT and pET28a-hsDDC-saAANAT

(1) Using pET28a-hsDDC vector as a template, and utilizing primers P-c and P-d to carry out PCR amplification; the sequence of the primer P-c is 5'-TTTGTTAGCAGCCGGATCTTAATCAC-3', and the sequence of the primer P-d is 5'-GCCCGAAAGGAAGCTGAGTTG-3'; recovering the PCR product to obtain a linearized vector pET28a-hsDDC, wherein the size of the linearized vector fragment is 6649 bp;

(2) using artificially synthesized hsAANAT, rnAANAT and saAANAT genes as templates, and primers of the genes are P7 and P8, P9 and P10, P11 and P12 respectively, performing PCR amplification, recovering the amplification product to obtain target fragments of the hsAANAT, the rnAANAT and the saAANAT, wherein the sizes of the fragments are 660bp, 654bp and 654bp respectively, the nucleotide sequences of the fragments are shown as SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, the sequence of the primer P7 is 5'-GATCCGGCTGCTAACAAAAAGAAGGAGATATACCATGAGCACCCAATCTACTCATCCG-3', and the sequence of the primer P8 is 5'-CTCAGCTTCCTTTCGGGCTTAACAACCAGAGTTGCGGCG-3'; the primer P9 sequence is 5' -GATCCGGCTGCTAACAAAAAGAAGGAGATATACCATGCTGTCTATCCATCCTCTGAAACC-3, and the primer P10 sequence is 5'-CTCAGCTTCCTTTCGGGCTTAACAACCAGAGTTACGGCGCAG-3'; the primer P11 sequence 5'-GATCCGGCTGCTAACAAAAAGAAGGAGATATACCATGACTCAGCAGGTCTCCGG-3', and the primer P12 sequence 5'-CTCAGCTTCCTTTCGGGCTTAACAACCAGAGTTGCGACGGG-3'.

SEQ ID NO.4(Homo sapiens)624bp

ATGAGCACCCAATCTACTCATCCGCTGAAACCGGAAGCTCCACGTCTGCCGCCGGGTATTCCGGAATCTCCGTCTTGTCAACGTCGTCACACCCTGCCGGCTTCCGAATTTCGTTGTCTGACTCCGGAAGACGCCGTTAGCGCGTTCGAGATTGAACGTGAAGCGTTCATCAGCGTACTGGGCGTATGTCCGCTGTATCTGGACGAAATCCGTCACTTCCTGACGCTGTGCCCAGAACTGTCCCTGGGCTGGTTTGAAGAAGGTTGCCTGGTTGCCTTCATCATTGGTTCTCTGTGGGACAAAGAACGTCTGATGCAGGAATCTCTGACTCTGCACCGTTCTGGTGGCCACATCGCGCACCTGCACGTTCTGGCGGTACACCGTGCTTTTCGTCAGCAGGGTCGCGGCCCAATTCTGCTGTGGCGTTACCTGCATCACCTGGGTTCTCAGCCTGCGGTTCGTCGTGCGGCACTGATGTGTGAGGACGCTCTGGTGCCGTTCTACGAACGTTTCTCCTTTCATGCTGTGGGTCCATGTGCGATCACTGTGGGCTCTCTGACCTTCATGGAACTGCATTGCTCTCTGCGTGGTCACCCGTTTCTGCGCCGCAACTCTGGTTGTTAA

SEQ ID NO.5(Rattus norvegicus)618bp

ATGCTGTCTATCCATCCTCTGAAACCGGAAGCACTGCATCTGCCGCTGGGTACCAGCGAATTCCTGGGTTGTCAGCGTCGTCATACCCTGCCGGCATCTGAATTCCGCTGCCTGACTCCGGAAGATGCTACTTCTGCGTTCGAAATTGAACGTGAAGCCTTTATCTCCGTAAGCGGCACCTGTCCTCTGCACCTGGACGAAATCCGTCATTTCCTGACTCTGTGCCCAGAGCTGTCCCTGGGCTGGTTCGAAGAAGGTTGTCTGGTTGCATTTATCATTGGTTCCCTGTGGGATAAAGAACGCCTGACCCAGGAATCTCTGACCCTGCACCGTCCTGGTGGCCGTACTGCTCATCTGCACGTGCTGGCTGTTCATCGTACGTTCCGTCAGCAGGGCAAAGGTTCTGTGCTGCTGTGGCGTTATCTGCACCACCTGGGTTCTCAACCAGCCGTTCGTCGCGCGGTTCTGATGTGCGAAAACGCACTGGTACCGTTTTACGAGAAATTCGGTTTTCAGGCGATGGGTCCGTGCGCTATCACCATGGGCTCTCTGACCTTCACCGAACTGCAGTGTAGCCTGCGTTGTCACACCTTCCTGCGCCGTAACTCTGGTTGTTAA

SEQ ID NO.6(Sparus aurata)618bp

ATGACTCAGCAGGTCTCCGGCAGCCCGTTTTTTAAACCGTTTTTCCTGAAAACCCCAGTAAGCCTGCTGCGTCAGCGTCGTCATACTCTGCCGGCGTCTGAGTTCCGTAACCTGACCCCTCAGGATGCGATCTCTGTTTTTGAAATTGAACGCGAAGCGTTTGTGTCTGTCTCTGGCGAATGTCCGCTGACTCTGGACGAAGTTCTGAACTTTCTGGGCCAGTGCCCGGAACTGTCCCTGGGTTGGTTCGAAGAAGGTCAGCTGGTGGCATTCATCATCGGCTCCGGTTGGGGCAAAGAGCGTCTGTCCCAAGAAGCAATGACCCAGCACGTTCCGGATTCCCCGGCCGTTCACATCCACGTCCTGTCCGTTCATCGTCACTGCCGTCAGCAGGGCAAAGGCTCCATTCTGCTGTGGCGTTTTCTGCAGTACCTGCGTTGCATTCCGGGCCTGCGCCGTGCTCTGCTGATCTGCGAAGAATACCTGGTTCCGTTCTACCAAAAAGCAGGCTTCAAAGAAAAGGGTCCGTCCGCTATCTCTATCTCTAACATGCAGTTTCAGGAAATGGAGTACACCATCGGTGGCCAGGCTTACACCCGTCGCAACTCTGGTTGTTAA

(4) The target fragment is connected with a linearization vector pET28a-DDC to obtain recombinant plasmids, which are named as pET28a-hsDDC-hsAANAT, pET28a-hsDDC-rnAANAT and pET28a-hsDDC-saAANAT, and the successfully constructed pET28a-hsDDC-hsAANAT, pET28 a-DDC-rnAANAT and pET28a-hsDDC-saAANAT plasmids are obtained after the sequencing verification is correct.

(5) pET28a-hsDDC-hsAANAT, pET28a-hsDDC-rnAANAT and pET28a-hsDDC-saAANAT plasmids are transformed into an escherichia coli cloning host by a heat shock transformation method to obtain positive transformants, then transformant plasmids with correct sequencing are transferred into escherichia coli expression host bacteria BL21(DE3) and coated on LB solid culture medium containing kanamycin, LB plates are cultured at 37 ℃ to grow the transformants, and the positive transformants are picked to obtain expected engineering bacteria 4, engineering bacteria 5 and engineering bacteria 6.

2. Fermentation culture and biotransformation of engineering bacteria 4, 5 and 6 to N-acetyl serotonin:

(1) culturing engineering bacteria 4, 5 and 6 in seed culture medium containing 50 μ g/mL kanamycin antibiotic for 10h to obtain seed solution, wherein OD of the seed solution₆₀₀The seed culture medium (mass percent) is 1% of tryptone, 1% of sodium chloride and 0.5% of yeast extract, and the culture conditions of the seed liquid are 37 ℃ and 225 rpm;

(2) inoculating 2% of the above seed solution to a solution containing 1.2% tryptone, 2.4% yeast extract, 0.5% glycerol, and 0.231% KH₂PO₄And 1.64% K₂HPO₄·3H₂Performing fermentation culture in a fermentation culture medium (in percentage by mass) of O;

(3) after 2h of fermentation culture, adding 1mM IPTG for induction expression, wherein the temperature of the induction expression is 25 ℃, after 10h of induction expression, adding a cell penetrating agent CT with the final concentration of 35 mu g/mL, treating for 30min, adding a substrate 5-hydroxytryptophan with the final concentration of 0.2M and using ethanol for solubilization, carrying out a biotransformation stage, carrying out transformation for 28h at the temperature of 28 ℃, and using High Performance Liquid Chromatography (HPLC) to detect the yield of the N-acetyl serotonin.

3. Detecting N-acetyl serotonin by high performance liquid chromatography:

(4) the chromatographic conditions of the high performance liquid chromatography are as follows: the chromatographic column is C18(250mm 4.6mm, 5 μm) or equivalent chromatographic column, the mobile phase is 65 wt% ultrapure water (containing 0.1% trifluoroacetic acid) and 35 wt% methanol, the flow rate is 1mL/min, the sample amount is 10uL, and the temperature of the column incubator is 35 ℃;

(5) the content of N-acetyl serotonin was finally calculated from the peak area of the N-acetyl serotonin standard, and the results are shown in Table 2.

Table 2: content of biotransformed N-acetyl serotonin

From Table 2, it can be seen that the type of the aromatic alkylamine-N-acetyltransferase (AANAT) affects the amount of the N-acetyl serotonin converted for the engineering bacteria 4, 5 and 6, and the amount of the N-acetyl serotonin converted for the engineering bacteria 6 is relatively higher.

Example 3: construction of recombinant plasmid pET28a-hsDDC-saAANAT and engineering bacteria of molecular chaperone

1. Construction of engineering bacteria of recombinant plasmid pET28a-hsDDC-saAANAT and molecular chaperones pGro7, pG-KJE8, pKJE7 and pTf16

And (3) plasmid transformation:

the pET28a-hsDDC-saAANAT plasmid and molecular chaperones pGro7, pG-KJE8, pKJE7 and pTf16 plasmid are respectively transformed into an escherichia coli cloning host by a heat shock transformation method to obtain a positive transformant, then the correctly sequenced transformant is transformed into an escherichia coli expression host bacterium BL21(DE3) and is coated on an LB solid culture medium containing kanamycin and chloramphenicol, an LB plate is cultured at 37 ℃ to grow the transformant, and the positive transformant is picked to obtain the expected engineering bacterium 7, the engineering bacterium 8, the engineering bacterium 9 and the engineering bacterium 10.

2. Fermentation culture and biotransformation of engineering bacteria 7, 8, 9 and 10 to N-acetyl serotonin:

(1) culturing engineering bacteria 7, 8, 9 and 10 in seed culture medium containing 50 μ g/mL kanamycin and 10 μ g/mL chloramphenicol antibiotic for 10h to obtain seed solution, wherein OD of the seed solution₆₀₀The seed culture medium (mass percent) is 1% of tryptone, 1% of sodium chloride and 0.5% of yeast extract, and the culture conditions of the seed liquid are 37 ℃ and 225 rpm;

(3) after 2h of fermentation culture, adding 1mM IPTG and 4mg/mL arabinose for induction expression, wherein the temperature for induction expression is 25 ℃, adding a cell penetrating agent CT with the final concentration of 35 mu g/mL after 10h of induction expression, treating for 30min, adding a substrate 5-hydroxytryptophan with the final concentration of 0.2M and using ethanol for cosolvent, carrying out a biotransformation stage, transforming for 28h at the temperature of 28 ℃, and detecting the yield of N-acetyl serotonin by using High Performance Liquid Chromatography (HPLC).

3. Detecting N-acetyl serotonin by high performance liquid chromatography:

(5) the final calculation of the N-acetyl serotonin content was performed based on the peak area of the N-acetyl serotonin standard, and the results are shown in Table 3.

Table 3: content of biotransformed N-acetyl serotonin

From Table 3, it was found that the amount of N-acetyl serotonin converted when chaperone pGr07 was introduced was higher after introduction of chaperone.

Example 4: bioconversion of engineering bacteria 7 under different temperature conditions

(1) Culturing the engineering bacteria 7 in a seed culture medium containing 50 mu g/mL kanamycin and 10 mu g/mL chloramphenicol antibiotic for 10h to obtain a seed solution, wherein the OD of the seed solution₆₀₀The seed culture medium (mass percent) is 1% of tryptone, 1% of sodium chloride and 0.5% of yeast extract, and the culture conditions of the seed liquid are 37 ℃ and 225 rpm;

(3) fermenting and culturing for 2h, adding 1mM IPTG and 4mg/mL arabinose for induced expression at the temperature of 25 ℃, adding after 10h of induced expression, adding a cell penetrating agent CT with the final concentration of 35 mug/mL for treatment for 30min, adding a substrate 5-hydroxytryptophan with the final concentration of 0.2M and using ethanol for solubilization, carrying out biotransformation stage, respectively carrying out transformation for 28h at the temperature of 28 ℃, 30 ℃ and 37 ℃, and using High Performance Liquid Chromatography (HPLC) to detect the yield of the N-acetyl serotonin.

Detecting N-acetyl serotonin by high performance liquid chromatography:

(5) the final calculation of the N-acetyl serotonin content was performed based on the peak area of the N-acetyl serotonin standard, and the results are shown in Table 4.

Table 4: content of biotransformed N-acetyl serotonin

Example 5: influence of different permeabilizers on production of N-acetyl serotonin by engineering bacteria 7

(3) after 2h of fermentation culture, adding 1mM IPTG and 4mg/mL arabinose for induced expression, wherein the temperature of induced expression is 25 ℃, adding cell permeant polymyxin B, CT and lysozyme with the final concentration of 35 mu g/mL after 10h of induced expression, adding substrate 5-hydroxytryptophan with the final concentration of 0.2M and using ethanol for solubilization after 30min of treatment, carrying out biotransformation stage, converting for 28h at 30 ℃, and using High Performance Liquid Chromatography (HPLC) to detect the yield of N-acetyl serotonin.

Detecting N-acetyl serotonin by high performance liquid chromatography:

(5) the final calculation of the N-acetyl serotonin content was performed based on the peak area of the N-acetyl serotonin standard, and the results are shown in Table 5.

Table 5: content of biotransformed N-acetyl serotonin

Example 6: further optimization of conditions for bioconversion of N-acetyl serotonin by engineering bacteria 7

(3) after 2h of fermentation culture, adding 1mM IPTG and 4mg/mL arabinose for induction expression, the temperature for induction expression is 25 ℃, after 10h of induction expression, adding a cell permeant polymyxin B with the final concentration of 35 mu g/mL, after 30min of treatment, adding a substrate 5-hydroxytryptophan with the final concentration of 0.2M and using ethanol for solubilization, respectively adding pyridoxal phosphate with the final concentration of 0.5mM, 1mM and 5mM for biotransformation stage, converting for 28h at the temperature of 30 ℃, and detecting the yield of N-acetyl serotonin by using High Performance Liquid Chromatography (HPLC).

Detecting N-acetyl serotonin by high performance liquid chromatography:

(3) filtering the supernatant in a brown liquid bottle by a 0.22um filter membrane to obtain a sample to be detected;

(4) the chromatographic conditions of the high performance liquid chromatography are as follows: the chromatographic column is C18(250mm 4.6mm, 5um) or equivalent chromatographic column, the mobile phase is 65 wt% ultrapure water (containing 0.1% trifluoroacetic acid) and 35 wt% methanol, the flow rate is 1mL/min, the sample injection amount is 10 muL, and the temperature of the column incubator is 35 ℃;

(5) the final calculation of the N-acetyl serotonin content was performed based on the peak area of the N-acetyl serotonin standard, and the results are shown in Table 6.

Table 6: content of biologically converted N-acetyl serotonin after addition of pyridoxal phosphate

Table 6 shows that the biotransformation conditions were further optimized on the basis of the engineered bacterium 7, and that the addition of pyridoxal phosphate increased the amount of N-acetyl serotonin converted.

The recombinant plasmid pET28a-hsDDC-hsAANAT and the molecular chaperone pGr07 plasmid are co-expressed creatively, the culture conditions, the types of cell permeabilizing agents and the coenzyme pyridoxal phosphate added with DDC are changed creatively, the content of N-acetyl serotonin is obviously improved, and the maximum content of the N-acetyl serotonin reaches 20.28 g/L.

In conclusion, the types of cell permeabilizers, transformation conditions, coenzyme, molecular chaperones, DDC (dichloro-diphenyl-trichloroethane) and AANAT (advanced AANAT) and the like in the processes of construction, fermentation and biotransformation of engineering bacteria influence the transformation amount of the N-acetyl serotonin, the factors are not single limiting factors, the content of the N-acetyl serotonin serving as a final product cannot be well improved by singly changing one or two influencing factors, even the content of the N-acetyl serotonin is reduced by generating a negative effect, and the influence factors are creatively changed to generate a synergistic effect, so that the content of the N-acetyl serotonin is greatly improved.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Hebei Weidakang Biotech Co., Ltd

<120> gene element combination, recombinant plasmid combination, genetic engineering strain and method for high yield of N-acetyl serotonin

<130> MP21014605

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1443

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgaacgcaa gcgaattccg tcgccgtggc aaagaaatgg tagattacgt agcgaactac 60

atggagggta tcgagggccg tcaggtttac ccagatgtgg aaccgggcta cctgcgtccg 120

ctgatcccgg ctgctgcgcc gcaagaaccg gacactttcg aagacattat caacgacgtg 180

gagaaaatca ttatgccggg cgttactcat tggcacagcc cgtacttctt tgcgtacttc 240

ccgactgcat cctcctaccc ggccatgctg gcggacatgc tgtgcggtgc gatcggttgt 300

atcggtttct cttgggcggc aagcccggca tgtactgaac tggaaaccgt gatgatggac 360

tggctgggta aaatgctgga actgccaaaa gcattcctga acgaaaaagc tggcgagggt 420

ggcggtgtga ttcagggtag cgcgagcgaa gccactctgg ttgcactgct ggcggcgcgc 480

accaaggtga tccaccgtct gcaggctgct tcccctgaac tgacccaggc tgctattatg 540

gaaaaactgg tcgcctatag ctctgatcag gcacatagct ctgttgaacg cgcgggtctg 600

atcggcggtg taaaactgaa agcgatcccg agcgatggca acttcgcaat gcgtgcatcc 660

gccctgcagg aagcgctgga acgtgacaag gcagctggcc tgattccgtt ttttatggtt 720

gcgaccctgg gtactaccac ctgctgctcc ttcgataacc tgctggaagt cggcccgatt 780

tgcaacaaag aagacatctg gctgcatgtg gacgcggctt acgcaggcag cgcattcatc 840

tgtccggaat ttcgtcatct gctgaacggt gttgaattcg ccgatagctt caacttcaac 900

ccgcacaaat ggctgctggt caactttgac tgctctgcta tgtgggtaaa gaaacgtact 960

gacctgaccg gcgcgttccg cctggacccg acgtatctga aacacagcca tcaggattct 1020

ggtctgatca ccgactaccg tcactggcag attccgctgg gtcgtcgttt ccgcagcctg 1080

aagatgtggt ttgttttccg tatgtacggc gtgaaaggcc tgcaggcata cattcgcaaa 1140

cacgtgcaac tgtctcatga atttgaatcc ctggttcgtc aggacccacg ttttgaaatt 1200

tgtgtggaag ttatcctggg tctggtttgc tttcgtctga aaggcagcaa caaagtaaac 1260

gaagcgctgc tgcagcgtat caacagcgct aagaaaatcc acctggtgcc ttgccacctg 1320

cgcgacaaat tcgtactgcg tttcgctatt tgttctcgta ccgtggaatc tgctcacgtt 1380

cagcgtgctt gggaacacat caaagaactg gcagcagatg tcctgcgtgc ggaacgtgat 1440

taa 1443

<210> 2

<211> 1443

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggattccc gcgagtttcg tcgtcgcggt aaggaaatgg ttgactacat cgccgattat 60

ctggatggca tcgaaggtcg ccctgtatac ccggatgtgg aacctggtta cctgcgtgct 120

ctgatcccga ccaccgcccc gcaggaaccg gaaacctacg aagatatcat ccgtgatatc 180

gaaaaaatca ttatgccggg tgtaactcac tggcactctc cgtatttctt tgcttatttc 240

ccaactgcgt cttcctaccc ggcgatgctg gctgacatgc tgtgcggcgc catcggttgc 300

attggcttct cttgggctgc gtccccggca tgtaccgaac tggaaaccgt tatgatggac 360

tggctgggca aaatgctgga actgccggaa gctttcctgg ctggtcgtgc aggtgaaggt 420

ggtggcgtta tccagggttc cgcgtctgaa gcgaccctgg tagctctgct ggccgcccgt 480

actaaaatga tccgtcagct gcaggctgca tctccggaac tgacccaagc tgcactgatg 540

gaaaagctgg ttgcatacac ttccgaccag gcccactcca gcgtcgaacg tgcgggtctg 600

attggcggtg ttaagattaa agctatcccg tctgacggca actactctat gcgtgccgcg 660

gctctgcgtg aagctctgga acgtgacaaa gcggcaggtc tgatcccttt cttcgttgta 720

gtaactctgg gtactacctc ttgttgctct ttcgacaacc tgctggaagt tggtccaatc 780

tgcaaccagg aaggtgtttg gctgcatatt gatgcggctt atgcgggcag cgctttcatt 840

tgcccggaat tccgttacct gctgaacggc gtggaattcg ccgactcttt caacttcaac 900

ccgcataaat ggctgctggt taactttgac tgttccgcta tgtgggtgaa aaaacgcacc 960

gatctgacgg aggctttcaa catggacccg gtatacctgc gccacagcca ccaggattct 1020

ggcctgatta ccgactaccg tcactggcag atccctctgg gtcgtcgctt tcgttccctg 1080

aaaatgtggt tcgttttccg catgtatggt gttaaaggcc tgcaggcata catccgtaaa 1140

catgttaagc tgagccacga attcgaatcc ctggtccgtc aggatccgcg ttttgagatc 1200

tgtaccgagg tgattctggg cctggtttgc ttccgcctga aaggctccaa ccagctgaac 1260

gaaaccctgc tgcagcgtat caactccgct aaaaaaattc acctggttcc gtgccgtctg 1320

cgtgataagt ttgttctgcg tttcgcagtt tgttctcgca ccgttgaatc tgctcacgtt 1380

cagctggcat gggaacacat ccgcgatctg gcgtcttctg tcctgcgcgc tgaaaaagaa 1440

taa 1443

<210> 3

<211> 1296

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggacgcgg cggaatttcg tcgtcgcggc aaagaaatgg ttgattacgt ggctgactac 60

ctggaaaaca ttgaacagcg cccggtctat ccggatctgg aaccaggcta tctgcgtagc 120

ctgatcccaa acgaagcgcc ggcagagccg gaaacctacg aagaaatcat gaaagacgtg 180

gaacgtgtga tcatgccggg cattacccat tggcactctc cgtattttta cgcttacttc 240

ccggctgctt ccagctatcc ggctatgctg gcggacatgc tgtgtaccgc gattggttgc 300

atcggtttca gctgggctgc cagcccggca tgtaccgaac tggaaactgt tatgatggat 360

tggctgggta aaatgctgca gctgccggaa catttcatcg caggtacgca cggtcacggt 420

ggtggtgtta tccagggtac cgcatctgag gcgactctga tgtctctgct ggctgcacgt 480

tgtaaagcag tgcgtcgtgt acaagcgagc aattccgaac tgccggaagc ggaaatcttc 540

agcaaactgg tggcgtacac ttctgaacag gctcatagca gcgtggaacg tgcggcactg 600

atcggcggtg ttatgatgcg taaagttccg accgacaact cttacgcggt tggtggtgat 660

atgctgaaaa aaatggtgga agaagacaaa gcggctggtc tgattccgtt ctacttctgc 720

gccactctgg gcactactcc gtcttgcgca ttcgatcaca tcgcggaact gggtccgctg 780

tgcaacaaag agaacatgtg gatgcatatc gacgcagcct atgcaggttc tgcgttcatc 840

tgtccggaat tccgtccgct gctgaacggt gtcgaatatg cggattcctt caatttcaac 900

ccgcacaaat ggctgctggt gaacttcgac tgttctgcaa tgtgggttaa aaaacgtgcg 960

gacatcatcg gcgccttcaa gttcgaaccg ctgtacctga aacatgaaaa ccaggaatct 1020

ggcctggtca ctgactatcg tcactggcag attccgctgg gtcgtcgttt tcgttctctg 1080

aaactgtggt tcgtattccg tatgtacggt ctgtccggtc tgcaggccca catccgtaaa 1140

agcctgtgta atctgcgtgc gccggctgca ccaacttctc agaacctgtc tgtggatccg 1200

ctgcgtctga cgcatctgtg cctgcagctg aacctgtctc tgccggtact gcgtgcgcca 1260

gcaaaaccaa gcgccgttac cccgactcgt gcttaa 1296

<210> 4

<211> 624

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgagcaccc aatctactca tccgctgaaa ccggaagctc cacgtctgcc gccgggtatt 60

ccggaatctc cgtcttgtca acgtcgtcac accctgccgg cttccgaatt tcgttgtctg 120

actccggaag acgccgttag cgcgttcgag attgaacgtg aagcgttcat cagcgtactg 180

ggcgtatgtc cgctgtatct ggacgaaatc cgtcacttcc tgacgctgtg cccagaactg 240

tccctgggct ggtttgaaga aggttgcctg gttgccttca tcattggttc tctgtgggac 300

aaagaacgtc tgatgcagga atctctgact ctgcaccgtt ctggtggcca catcgcgcac 360

ctgcacgttc tggcggtaca ccgtgctttt cgtcagcagg gtcgcggccc aattctgctg 420

tggcgttacc tgcatcacct gggttctcag cctgcggttc gtcgtgcggc actgatgtgt 480

gaggacgctc tggtgccgtt ctacgaacgt ttctcctttc atgctgtggg tccatgtgcg 540

atcactgtgg gctctctgac cttcatggaa ctgcattgct ctctgcgtgg tcacccgttt 600

ctgcgccgca actctggttg ttaa 624

<210> 5

<211> 618

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgctgtcta tccatcctct gaaaccggaa gcactgcatc tgccgctggg taccagcgaa 60

ttcctgggtt gtcagcgtcg tcataccctg ccggcatctg aattccgctg cctgactccg 120

gaagatgcta cttctgcgtt cgaaattgaa cgtgaagcct ttatctccgt aagcggcacc 180

tgtcctctgc acctggacga aatccgtcat ttcctgactc tgtgcccaga gctgtccctg 240

ggctggttcg aagaaggttg tctggttgca tttatcattg gttccctgtg ggataaagaa 300

cgcctgaccc aggaatctct gaccctgcac cgtcctggtg gccgtactgc tcatctgcac 360

gtgctggctg ttcatcgtac gttccgtcag cagggcaaag gttctgtgct gctgtggcgt 420

tatctgcacc acctgggttc tcaaccagcc gttcgtcgcg cggttctgat gtgcgaaaac 480

gcactggtac cgttttacga gaaattcggt tttcaggcga tgggtccgtg cgctatcacc 540

atgggctctc tgaccttcac cgaactgcag tgtagcctgc gttgtcacac cttcctgcgc 600

cgtaactctg gttgttaa 618

<210> 6

<211> 618

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgactcagc aggtctccgg cagcccgttt tttaaaccgt ttttcctgaa aaccccagta 60

agcctgctgc gtcagcgtcg tcatactctg ccggcgtctg agttccgtaa cctgacccct 120

caggatgcga tctctgtttt tgaaattgaa cgcgaagcgt ttgtgtctgt ctctggcgaa 180

tgtccgctga ctctggacga agttctgaac tttctgggcc agtgcccgga actgtccctg 240

ggttggttcg aagaaggtca gctggtggca ttcatcatcg gctccggttg gggcaaagag 300

cgtctgtccc aagaagcaat gacccagcac gttccggatt ccccggccgt tcacatccac 360

gtcctgtccg ttcatcgtca ctgccgtcag cagggcaaag gctccattct gctgtggcgt 420

tttctgcagt acctgcgttg cattccgggc ctgcgccgtg ctctgctgat ctgcgaagaa 480

tacctggttc cgttctacca aaaagcaggc ttcaaagaaa agggtccgtc cgctatctct 540

atctctaaca tgcagtttca ggaaatggag tacaccatcg gtggccaggc ttacacccgt 600

cgcaactctg gttgttaa 618

Claims

1. A gene element combination for high yield of N-acetyl serotonin is characterized in that the gene element combination consists of a gene element 1 and a gene element 2; the gene element 1 comprises a 5-hydroxytryptophan decarboxylase gene and an aromatic alkylamine-N-acetyltransferase gene; the genetic element 2 comprises a chaperone gene.

2. The combination of genetic elements as claimed in claim 1, wherein the sequence of the 5-hydroxytryptophan decarboxylase gene is the sequence shown in SEQ ID No.1, or the sequence shown in SEQ ID No.1 has a homology of 80% or more;

the sequence of the aromatic alkylamine-N-acetyltransferase gene is a sequence shown by SEQ ID NO.6, or a sequence with more than 80% of sequence homology shown by SEQ ID NO. 6;

the molecular chaperone is GroES-GroEL.

3. A recombinant plasmid combination for high-yield N-acetyl serotonin is characterized by consisting of a recombinant plasmid 1 and a recombinant plasmid 2; the recombinant plasmid 1 comprises a 5-hydroxytryptophan decarboxylase gene, an aromatic alkylamine-N-acetyl transferase gene and a plasmid vector; the recombinant plasmid 2 is a molecular chaperone plasmid.

4. The recombinant plasmid combination according to claim 3, wherein the sequence of the 5-hydroxytryptophan decarboxylase gene is the sequence shown in SEQ ID No.1, or the sequence shown in SEQ ID No.1 has homology of more than 80%;

the molecular chaperone plasmid is pGro7 plasmid.

5. A genetically engineered strain with high yield of N-acetyl serotonin, comprising the recombinant plasmid combination of claim 3 or 4 and a chassis strain.

6. The method for constructing a genetically engineered strain according to claim 5, wherein the recombinant plasmid combination according to claim 3 or 4 is co-transferred into a chassis strain to obtain a genetically engineered strain.

7. A method for synthesizing N-acetyl serotonin is characterized by comprising the following steps:

(1) inoculating the genetically engineered strain of claim 5 into a fermentation medium for fermentation culture;

8. The method of claim 7, wherein the induction agent is IPTG and arabinose;

the cell penetrating agent is one or more of polymyxin B, lysozyme or CT.

9. The method according to claim 7, wherein the temperature of the biotransformation is 20 to 45 ℃ and the time is 8 to 50 hours.

10. The method according to any one of claims 7 to 9, wherein pyridoxal phosphate is added in a quantity of 0.1 to 10mM in step (3) along with the addition of the substrate 5-hydroxytryptophan to the fermentation medium.