CN113528527B

CN113528527B - Promoter for recombinant protein expression and application thereof

Info

Publication number: CN113528527B
Application number: CN202110864017.1A
Authority: CN
Inventors: 周勉; 欧阳雅琦; 许宁
Original assignee: East China University of Science and Technology
Current assignee: East China University of Science and Technology
Priority date: 2021-07-29
Filing date: 2021-07-29
Publication date: 2023-09-29
Anticipated expiration: 2041-07-29
Also published as: CN113528527A

Abstract

The invention discloses a methanol inducible promoter P for recombinant protein expression ₀₅₄₇ The methanol inducible promoter P ₀₅₄₇ The genomic DNA sequence of (2) includes a base sequence shown as 2416633 th to 2417632 th from the 5' -end of NCBI accession No. NC_ 012963.1. The invention also discloses a constitutive promoter P for recombinant protein expression ₀₄₇₂ The constitutive promoter P ₀₄₇₂ The genomic DNA sequence of (2) includes a base sequence shown as 874193 th to 875192 th from the 5' -end of NCBI accession No. NC_ 012964.1. Methanol inducible promoter P of the present invention ₀₅₄₇ And constitutive promoter P ₀₄₇₂ Can be applied to the recombinant protein expression of large-scale bioreactors and/or small-scale bioreactors.

Description

Promoter for recombinant protein expression and application thereof

Technical Field

The invention belongs to the technical field of biology, in particular to a promoter for recombinant protein expression of a large-scale bioreactor and/or a small-scale bioreactor and application thereof.

Background

Methylotrophic pichia pastoris is one of the most widely used recombinant protein expression systems. To date, 5000 more proteins have been successfully expressed by this system. In most cases, protein expression is dependent on methanol inducible promoter P _AOX1 (alcohol oxidase I promoter). Furthermore, GAP promoter (P _GAP ) Is the most common constitutive promoter without induction.

P removal _AOX1 And P _GAP In addition, some other promoters have been reported in pichia pastoris, such as glutathione-dependent formaldehyde dehydrogenase promoter (P _FLD1 ) And dihydroxyacetone synthase promoter (P) _DAS ). Prielhofer et al identified P _G1 And P _G6 They are induced by low concentrations of glucose and inhibited by glycerol. In addition to inducible promoters, several constitutive promoters have been reported, including the translational elongation factor 1 (TEF 1) promoter, the GTPase (YPT 1) promoter, and the potential glycosyl phosphatidyl inositol anchor protein (GCW 14) promoter. Ahmad, hirz, pichler and Schwab provide a summary of the above promoters from Pichia pastorisProtein expression in Pichia pastoris: recent achievements and perspectives for heterologous protein production). However, these promoters have not been widely used due to various drawbacks in expression strength, induction conditions, and regulatory stringency. For example, P _FLD1 Not only methanol as sole carbon source but also ammonium sulfate as nitrogen source; many promoters such as P _G1 、P _G6 And a few constitutive promoters are not strong enough to support large-scale recombinant protein expression. Thus, the use of promoters in pichia pastoris is quite limited, which requires the selection of other novel strong promoters.

Disclosure of Invention

To identify new inducible or constitutive promoters, the present invention selects 16 candidate promoters based on pichia pastoris wild-type GS115 strain RNA-seq data and mRNA folding free energy (Δg) under three different carbon sources (glucose, glycerol, and methanol) conditions. GFP reporter gene and recombinant alpha-amylase were inserted after these promoters to test their expression strength and induction capacity. Finally, the present invention identifies two novel promoters promising for recombinant protein expression: methanol inducible promoter P ₀₅₄₇ And constitutive promoter P ₀₄₇₂ . Through experiments, alpha-amylase is used as a reporter protein, P ₀₅₄₇ And P ₀₄₇₂ Promoter strength in shake flask experiments with P _AOX1 And P _GAP Comparable, but in fed-batch culture, respectively compared to P _AOX1 And P _GAP 5-10% and 25-30% higher.

It is therefore a first object of the present invention to provide a methanol inducible promoter P for recombinant protein expression in large-scale and/or small-scale bioreactors ₀₅₄₇ And constitutive promoter P ₀₄₇₂ 。

A second object of the present invention is to provide a methanol inducible promoter P ₀₅₄₇ Or constitutive promoter P ₀₄₇₂ Use in large scale bioreactors and/or small scale bioreactors for recombinant protein expression.

In order to achieve the above purpose, the invention adopts the following technical scheme:

as a first aspect of the present invention, a methanol inducible promoter P expressed by a recombinant protein ₀₅₄₇ The methanol inducible promoter P ₀₅₄₇ The genomic DNA sequence of (2) includes a base sequence shown as 2416633 th to 2417632 th from the 5' -end of NCBI accession No. NC_ 012963.1.

As a second aspect of the invention, a constitutive promoter P for recombinant protein expression ₀₄₇₂ The constitutive promoter P ₀₄₇₂ Is a base sequence shown from 874193 th to 875192 th from the 5' -end of NCBI accession No. NC_ 012964.1.

As a third aspect of the present invention, a methanol inducible promoter P ₀₅₄₇ Or constitutive promoter P ₀₄₇₂ Use in large scale bioreactors and/or small scale bioreactors for recombinant protein expression.

According to the invention, the large scale bioreactor is a 3-5L bioreactor.

According to the invention, the small-scale bioreactor is a bioreactor which is more than or equal to 0.1L and less than 3L.

According to the invention, the methanol inducible promoter P ₀₅₄₇ Is a base sequence shown as 2416633 th to 2417632 th from the 5' -end of NCBI accession No. NC_ 012963.1; the constitutive promoter P ₀₄₇₂ Is a base sequence shown from 874193 th to 875192 th from the 5' -end of NCBI accession No. NC_ 012964.1.

As a fourth aspect of the present invention, a GS 115-promoter-GFP expression strain, which uses PAGR1 and PGFPF2 with primer sequences shown in SEQ ID NO.3 and SEQ ID NO.6, respectively, as primers to amplify green fluorescent protein GFP expression cassette, and uses one-step cloning kit to clone GFP fragment, P ₀₅₄₇ The promoter fragment is connected to a pPIC 9K vector for construction; or, it uses PAGR1 and PGFPF2 whose primer sequences are shown as SEQ ID NO.3 and SEQ ID NO.6 as primer to amplify green fluorescent protein GFP expression frame, uses one-step cloning kit to make GFP fragment and P ₀₄₇₂ Ligation of the promoter fragment to the pPIC 9K vectorObtained by construction of (1), wherein the P ₀₅₄₇ The DNA sequence of the promoter fragment is a base sequence shown as 2416633 th to 2417632 th from the 5' end of NCBI accession NC_012963.1, said P ₀₄₇₂ The DNA sequence of the promoter fragment is a base sequence shown as 874193 th to 875192 th from the 5' -end of NCBI accession No. NC_ 012964.1.

As a fifth aspect of the present invention, a GS 115-promoter-AMY expression strain in which a recombinant alpha-amylase expression cassette was amplified by PCR and was combined with a promoter fragment P ₀₄₇₂ Together to pPIC 9K vector construction; alternatively, it is amplified by PCR of a recombinant alpha-amylase expression cassette, and is fused to a promoter fragment P ₀₅₄₇ Together to pPIC 9K vector construct, wherein the P ₀₅₄₇ The DNA sequence of the promoter fragment is a base sequence shown as 2416633 th to 2417632 th from the 5' end of NCBI accession NC_012963.1, said P ₀₄₇₂ The DNA sequence of the promoter fragment is a base sequence shown as 874193 th to 875192 th from the 5' -end of NCBI accession NC_ 012964.1.

As a sixth aspect of the present invention, a GS 115-promoter-GFP expression strain or a GS 115-promoter-AMY expression strain as described above is used for recombinant protein expression in large-scale bioreactors and/or small-scale bioreactors.

According to the invention, the large scale bioreactor is a 3-5L bioreactor.

Methanol inducible promoter P of the present invention ₀₅₄₇ And constitutive promoter P ₀₄₇₂ The beneficial effects are that:

1. methanol inducible promoter P ₀₅₄₇ And constitutive promoter P ₀₄₇₂ Can be used for recombinant protein expression of large-scale bioreactors, and can also be used for recombinant protein expression of small-scale bioreactors, and is a good inducible or constitutive promoter in pichia pastoris.

2. The GS 115-promoter-GFP expression strain or the GS 115-promoter-AMY expression strain can be used for recombinant protein expression of a large-scale bioreactor, and can also be used for recombinant protein expression of a small-scale bioreactor, and is a good inducible or constitutive promoter expression strain in pichia pastoris.

Drawings

FIG. 1 shows the fluorescence intensities of GS 115-promoter-GFP reporter genes for the 5 candidate promoters described in example 4 at different carbon sources.

FIG. 2 shows the fluorescence intensities of the GS 115-promoter-GFP reporter genes with potential potent candidate promoters in the 16 candidate promoters described in example 1, except for the 5 candidate promoters described in example 4.

FIG. 3 shows the transcriptional level of GS 115-promoter-GFP gene under different carbon source conditions.

FIG. 4 is a comparison of the intensities of candidate promoters and common promoters.

FIG. 5 shows the amylase activity of candidate promoters of GS 115-promoter-AMY expressing strains at different carbon sources and times.

FIG. 6 is P ₀₃₇₄ 、P ₀₅₄₇ And P _AOX1 Comparison of expression intensity under methanol.

FIG. 7 is an analysis of the expression capacity of candidate promoters in a 5L bioreactor.

Detailed Description

The invention will be further illustrated with reference to specific examples. It should be understood that the following examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedures, which do not address the specific conditions in the examples below, are generally performed under conventional conditions, or conditions supplied by the manufacturer.

Unless defined otherwise, all technical and scientific terms used hereinafter have the same meaning as commonly understood by one of ordinary skill in the art. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the scope of the present invention.

1. The primer sequences of the following examples are shown in Table 1.

TABLE 1 primer sequences

2. The list of candidate promoters in pichia pastoris is shown in table 2.

TABLE 2 candidate promoters in Pichia pastoris

3. Candidate promoter sequences in pichia pastoris are shown in table 3.

Promoters	Promoter sequence (NCBI)
		P ₀₃₇₄	Chromosome:3；NC_012965.1(729544..730543)
P ₀₀₄₃	Chromosome:4；NC_012966.1(92081..93080)
		P ₀₅₄₇	Chromosome:1；NC_012963.1(2416633..2417632)
P ₀₀₉₉	Chromosome:3；NC_012965.1(211600..212599)
		P ₀₃₁₉	Chromosome:1；NC_012963.1(1162600..1163599)
P ₀₀₁₆	Chromosome:2；NC_012964.1(31010..32009)
		P ₀₀₆₅	Chromosome:2；NC_012964.1(2255592..2256591)
P ₀₀₉₀	Chromosome:1；NC_012963.1(1570910..1571909)
		P ₀₁₈₈	Chromosome:3；NC_012965.1(381287..382286)
P ₀₇₆₉	Chromosome:2；NC_012964.1(1464321..1465320)
		P ₀₀₇₂	Chromosome:1；NC_012963.1(679765..680764)
P ₀₄₄₀	Chromosome:3；NC_012965.1(855281..856280)
		P ₀₄₂₈	Chromosome:2；NC_012964.1(785382..786381)
P ₀₁₂₂	Chromosome:1；NC_012963.1(228631..229630)
		P ₀₂₀₀	Chromosome:2；NC_012964.1(2011923..2012922)
P ₀₄₇₂	Chromosome:2；NC_012964.1(874193..875192)

4. Biological material source

(1) Commercial plasmids and strains were used for gene cloning. Plasmid pPIC 9K, strain e.coli TOP 10,Pichia Pastoris GS115, were all purchased from Invitrogen.

(2)P _AOX1 The sequence of (2) is shown as SEQ ID No. 52.

GATCTAACATCCAAAGACGAAAGGTTGAATGAAACCTTTTTGCCATCCGACATCCACAGGTCCATTCTCAC ACATAAGTGCCAAACGCAACAGGAGGGGATACACTAGCAGCAGACCGTTGCAAACGCAGGACCTCCACTCCTCTT CTCCTCAACACCCACTTTTGCCATCGAAAAACCAGCCCAGTTATTGGGCTTGATTGGAGCTCGCTCATTCCAATT CCTTCTATTAGGCTACTAACACCATGACTTTATTAGCCTGTCTATCCTGGCCCCCCTGGCGAGGTTCATGTTTGT TTATTTCCGAATGCAACAAGCTCCGCATTACACCCGAACATCACTCCAGATGAGGGCTTTCTGAGTGTGGGGTCA AATAGTTTCATGTTCCCCAAATGGCCCAAAACTGACAGTTTAAACGCTGTCTTGGAACCTAATATGACAAAAGCG TGATCTCATCCAAGATGAACTAAGTTTGGTTCGTTGAAATGCTAACGGCCAGTTGGTCAAAAAGAAACTTCCAAA AGTCGGCATACCGTTTGTCTTGTTTGGTATTGATTGACGAATGCTCAAAAATAATCTCATTAATGCTTAGCGCAG TCTCTCTATCGCTTCTGAACCCCGGTGCACCTGTGCCGAAACGCAAATGGGGAAACACCCGCTTTTTGGATGATT ATGCATTGTCTCCACATTGTATGCTTCCAAGATTCTGGTGGGAATACTGCTGATAGCCTAACGTTCATGATCAAA ATTTAACTGTTCTAACCCCTACTTGACAGCAATATATAAACAGAAGGAAGCTGCCCTGTCTTAAACCTTTTTTTT TATCATCATTATTAGCTTACTTTCATAATTGCGACTGGTTCCAATTGACAAGCTTTTGATTTTAACGACTTTTAA CGACAACTTGAGAAGATCAAAAAACAACTAATTATTCGAAACG，SEQ ID NO.52。

(3)P _GAP The sequence of which is shown as SEQ ID No.53

TTTTTGTAGAAATGTCTTGGTGTCCTCGTCCAATCAGGTAGCCATCTCTGAAATATCTGGCTCCGTTGCAA CTCCGAACGACCTGCTGGCAACGTAAAATTCTCCGGGGTAAAACTTAAATGTGGAGTAATGGAACCAGAAACGTC TCTTCCCTTCTCTCTCCTTCCACCGCCCGTTACCGTCCCTAGGAAATTTTACTCTGCTGGAGAGCTTCTTCTACG GCCCCCTTGCAGCAATGCTCTTCCCAGCATTACGTTGCGGGTAAAACGGAGGTCGTGTACCCGACCTAGCAGCCC AGGGATGGAAAAGTCCCGGCCGTCGCTGGCAATAATAGCGGGCGGACGCATGTCATGAGATTATTGGAAACCACC AGAATCGAATATAAAAGGCGAACACCTTTCCCAATTTTGGTTTCTCCTGACCCAAAGACTTTAAATTTAATTTAT TTGTCCCTATTTCAATCAATTGAACAACTAT，SEQ ID NO.53。

(4) The sequence of the Green Fluorescent Protein (GFP) expression frame is shown as SEQ ID No.54

ATGGGTTCTAAAGGTGAAGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATGTTAA TGGTCACAAATTTTCTGTCTCCGGTGAAGGTGAAGGTGATGCTACTTACGGTAAATTGACCTTAAAATTTATTTG TACTACTGGTAAATTGCCAGTTCCATGGCCAACCTTAGTCACTACTTTCGGTTATGGTGTTCAATGTTTTGCGAG ATACCCAGATCATATGAAACAACATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCAAGAAAGAACTAT TTTTTTCAAAGATGACGGTAACTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAATAGAAT CGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAACATTTTAGGTCACAAATTGGAATACAACTATAACTCTCA CAATGTTTACATCATGGCTGACAAACAAAAGAATGGTATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGA TGGTTCTGTTCAATTAGCTGACCATTATCAACAAAATACTCCAATTGGTGATGGTCCAGTCTTGTTACCAGACAA CCATTACTTATCCACTCAATCTGCCTTATCCAAAGATCCAAACGAAAAGAGAGACCACATGGTCTTGTTAGAATT TGTTACTGCTGCTGGTATTACCCATGGTATGGATGAATTGTACAAATAA，SEQ ID NO.54。

5. Strains and culture conditions

Coli TOP 10 cells were used for plasmid construction and propagation. Pichia pastoris wild-type strain GS115 was used as a host to prepare a strain expressing GFP (GS 115-promoter-GFP) and a recombinant alpha-amylase expression strain (GS 115-promoter-AMY).

YPD medium included 1% yeast extract, 2% tryptone, and 2% glucose.

YNB medium included 1.34% YNB solid powder.

The buffered BM carbon source medium (hereinafter referred to as BM medium) includes 1% yeast extractExtract, 2% tryptone, 0.3% K ₂ HPO ₄ And 1.18% KH ₂ PO ₄ 。

YNB medium YND medium was obtained after addition of 1% glucose;

YNB medium YNG medium was obtained after adding 1% glycerol;

YNB medium was supplemented with 0.5% methanol to give YNM medium.

The BM medium is added with 1% glucose to obtain a BMDY medium;

the BMGY culture medium is obtained after adding 1% glycerol into the BM culture medium;

BM Medium BMMY medium was obtained after addition of 0.5% methanol.

TOP 10 cells were cultured at 37℃in LB medium containing 0.5% yeast extract, 1% tryptone and 0.5% NaCl. GS 115-promoter-GFP was incubated at 30℃in YNB carbon source medium. Yeast amylase expression strain GS 115-promoter-AMY was incubated in buffered BM carbon source medium at 30 ℃.

6. Calculation of the folding free energy (ΔG) of mRNA

RNA stability and Folding free energy (. DELTA.G) was predicted on-line (http:// unafaold. RNA. Albany. Edu/.

Example 1 selection of candidate promoters based on RNA sequence data and mRNA structural stability

To screen for high efficiency promoters, RNA sequence data of Fei Qi, cai, zhou, and Zhang (Genome re-analysis, novel strong promoter discovery and sequence analysis of Pichia Pastoris based on RNA-seq.) were re-analyzed, and RPKM values of each gene under the conditions of glucose, glycerol and methanol carbon source culture were calculated. RPKM values represent mRNA levels. Since mRNA levels are determined by transcription and degradation, prediction of the folding free energy Δg of each gene was also performed to reveal structural stability. The absolute value of Δg is greater and mRNA secondary structure is generally less susceptible to degradation. Thus, candidate promoters were selected under culture conditions of different carbon sources (glucose, glycerol, methanol) where the difference in expression of the two genes was as high as possible. Finally, 16 candidate promoters with potential effectiveness were successfully selected (see Table 2). These promoters include 5 methanol inducible promoters, 10 non-methanol inducible promoters (induced by glucose or glycerol) and 1 constitutive promoter.

Example 2 cloning of the promoter

The 16 promoter genes selected in example 1 were amplified by PCR (the location names and sequences of the 16 promoter genes are shown in Table 2 and Table 3, and the sequences of the PCR primers are shown in SEQ ID NO.7-SEQ ID NO. 37) and the genomic DNA sequence (1000 bp upstream of the initiation codon ATG) was amplified by PCR. At the same time, P is cloned _AOX1 And P _GAP Promoters were used as controls for subsequent experiments.

EXAMPLE 3 construction of GS 115-promoter-GFP expression Strain and GS 115-promoter-AMY expression Strain

The promoter fragments in this example were 16 promoter fragments obtained in example 2, and each promoter fragment was used to construct an expression strain when used. Each expression strain uses only one promoter fragment.

To construct the GS 115-promoter-GFP expression strain, a pair of primers PAGR1/PGFPF2 (sequences shown in SEQ ID NO.3 and SEQ ID NO.6, respectively) was designed to amplify a Green Fluorescent Protein (GFP) expression cassette. GFP fragments, promoter fragments were ligated into the pPIC 9K vector by ClonExpress MultiS one-step cloning kit (cloning of primers containing homology arm promoters was performed as shown in SEQ ID NO.42-SEQ ID NO. 51). After completion of the verification (verified primer sequences H410-amp/3AOX as shown in SEQ ID NO.1 and SEQ ID NO. 2) and amplification, the pPIC 9K-promoter-GFP vector was then linearized by Sal I and transformed into GS115 by electroporation and screened for single copy strains of the GFP expression cassette (primers for monoclonal screening as shown in SEQ ID NO.4 and SEQ ID NO. 5).

To construct the GS 115-promoter-AMY expression strain, the recombinant alpha-amylase expression cassette (AmyA, a source of Geobacillus sp.4j), was amplified by PCR (the sequences of the amplified primers are shown as SEQ ID NO.38 and SEQ ID NO. 41) and ligated into the pPIC 9K vector (cloning of the primer sequences containing the homology arm promoter is shown as SEQ ID NO.42-SEQ ID NO. 51) together with the promoter fragment. Similarly, the pPIC 9K-promoter-AMY vector was verified and amplified and transformed into GS115 to screen single copy strains.

Example 4 use of GFP reporter gene assay to verify the intensity and regulatory Properties of candidate promoters

The candidate promoter strength and efficiency of promoter described in example 1 was measured by expression of intracellular reporter GFP.

(1) 16 GS 115-promoter-GFP strains were pre-grown to 2D in YPD ₆₀₀ -6OD ₆₀₀ Wherein GFP expression is relatively low. Cells were harvested and washed 3 times with sterile water. Cells were then transferred to different carbon source media (YND, YNG or YNM) with high differential expression. After incubation at 30℃for 12, 18 and 24 hours, 1mL aliquots were harvested and subsequently used to measure GFP fluorescence. In this example, the OD was measured three times in biological repetition using a microplate reader (BioTek Synergy Mx) ₆₀₀ And GFP. The results for all 16 candidate promoters are shown in FIGS. 1 and 2. 5 candidate promoters were finally selected for further investigation based on fluorescence overlap (FIG. 1), including two methanol inducible promoters P ₀₅₄₇ And P ₀₃₇₄ Two non-methanol inducible promoters P ₀₄₄₀ And P ₀₁₈₈ And a constitutive promoter P ₀₄₇₂ 。

(2) mRNA levels of GFP were detected by real-time quantitative PCR (qRT-PCR). 5 GS 115-promoter-GFP strains were pre-grown to 2-6OD in YPD ₆₀₀ After which the mixture was washed 3 times with sterile water. The washed cell pellet was transferred to YND, YNG or YNM medium. After 4h incubation at 30℃the cell pellet was collected and subsequently used to isolate mRNA. Genomic DNA was removed and cDNA was synthesized using the reverse tra Ace quantitative PCR RT kit (Toyobo). Quantitative PCR was performed using primers designed by Beacon Designer 7.9 (primer sequences shown as SEQ ID NO.39 and SEQ ID NO. 40). Induction was consistent with fluorescence data (FIG. 3), P ₀₅₄₇ ，P ₀₃₇₄ ，P ₀₄₄₀ ，P ₀₁₈₈ And P ₀₄₇₂ Are candidate promoters for further experimentation.

(3) To better analyze the strength of methanol inducible and constitutive candidate promoters, the common promoter P was used _AOX1 And P _GAP As a control (fig. 4). Under the condition of taking methanol as a carbon source, P ₀₅₄₇ Induced GS115P0547-GFP Strain GFP fluorescence intensity ratio P _AOX1 20% stronger, the induction intensity of P0374 reaches P only _AOX1 One third of (fig. 4 a). This indicates P ₀₅₄₇ May be a strong promoter worthy of further investigation.

For constitutive promoter P ₀₄₇₂ The GFP fluorescence intensity is slightly lower than P _GAP (FIG. 4 b). Since GFP fluorescence intensity is not fully representative of the intensity of the promoter to express secreted recombinant protein, the intensity and regulatory properties of five candidate promoters were further examined using recombinant alpha-amylase (Amy).

Example 5 determination of promoter Activity for expression of recombinant alpha-amylase (Amy)

The present invention selects recombinant alpha-amylase as a secreted recombinant protein for further analysis of promoter activity. Construction of a single copy GS 115-promoter-AMY Strain (GS 115-P) ₀₅₄₇ -AMY、GS115-P ₀₄₇₂ -AMY、GS115-P ₀₄₄₀ -AMY、 GS115-P ₀₁₈₈ -AMY and GS115-P ₀₄₇₂ -AMY) pre-grown to 2D at 30℃and 200rpm in YND ₆₀₀ -6OD ₆₀₀ . Cells were harvested and transferred to the original OD after 3 washes with sterile water ₆₀₀ BMDY, BMGY or BMMY medium of=1. After incubation at 30℃for 24, 48 and 72 hours, 1mL aliquots were harvested and the amylase enzyme activity was measured by the DNS method. And the specific activity (enzyme activity per unit OD) was calculated.

As shown in FIGS. 5 (a and b), GS115-P ₀₃₇₄ -AMY and GS115-P ₀₅₄₇ The amylase activity of the AMY strain under methanol (BMMY) induction conditions was much higher than under glucose (BMDY) as carbon source, indicating that the two promoters P ₀₃₇₄ And P ₀₅₄₇ Has strict methanol induction and glucose inhibition mechanism. To further detect P ₀₃₇₄ And P ₀₅₄₇ Is compared with the conventional methanol-inducible promoter P _AOX1 A comparison is made (fig. 6). Represented by the enzymatic and specific activities of amylase, P ₀₅₄₇ Intensity and P of (2) _AOX1 Is equivalent in strength.

GS115-P ₀₁₈₈ AMY has almost the same expression ability under the culture conditions of glucose (BMDY) and methanol (BMMY) (FIG. 5 c), while GS115-P ₀₄₄₀ AMY in glucose (BMDY) was approximately twice as high as in methanol (BMMY) (FIG. 5 d), indicating that the two promoters P ₀₁₈₈ And P ₀₄₄₀ Is inferior to the two methanol inducible promoters screened in example 4. Although this limits their use in large-scale recombinant protein expression, it still has the ability to be used to solve specific scientific problems.

With respect to constitutive promoter P ₀₄₇₂ This example demonstrates its constitutive properties under three different carbon sources (glucose, glycerol and methanol), amylase expression levels compared to conventional promoters (P _GAP ) Equivalent (fig. 5e and 5 f). Thus, P ₀₄₇₂ Is also a potentially effective constitutive promoter, and its potential in driving large-scale protein expression can be further assessed by fed-batch culture.

EXAMPLE 6 bioreactor culture

This example establishes a fed-batch culture system (5L bioreactor) and detects two promoters P ₀₄₇₂ And P ₀₅₄₇ The ability to induce recombinant protein expression in larger scale systems. GS115-P ₀₅₄₇ AMY is grown batchwise in glycerol medium for about 20 hours. After glycerol depletion, the glycerol growth phase ends and then switches to the methanol induction phase. GS115-P ₀₄₇₂ AMY is grown on glycerol or glucose medium. GS115-P _AOX1 -AMY and GS115-P _GAP AMY was used as control. 1mL aliquots of medium were harvested every 24 hours to measure OD, wet cell weight and enzyme activity. GS115-P ₀₄₇₂ Cell growth and amylase activity of the AMY strain are shown in figure 7 (a). GS115-P ₀₄₇₂ Fed-batch culture curve of AMY with GS115-P _GAP Comparison of the AMY strains shows that P ₀₄₇₂ Driven amylase enzyme activity and specific activity ratio P _GAP The height of the drive is 25-30% (fig. 7 b).

GS115-P ₀₅₄₇ Cell growth and amylase activity of the AMY strain are shown in FIG. 7 (c) and are associated with GS115-P _AOX1 -AMY for comparison. GS115-P under methanol culture conditions ₀₅₄₇ The amylase activity and specific activity in AMY are both 5-10% higher. To sum up, P ₀₅₄₇ And P ₀₄₇₂ The promoter is a good inducible or constitutive promoter in Pichia pastoris, and can be used for large-scale recombinant protein expression.

The foregoing is merely illustrative of embodiments of this invention and it will be appreciated by those skilled in the art that changes and modifications may be made without departing from the principles of the invention, which is also intended to be within the scope of the invention.

Sequence listing

<110> university of Industy of Huadong

<120> a promoter for recombinant protein expression and use thereof

<130> 211075

<141> 2021-07-29

<160> 54

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

ttgtctcatg agcggatac 19

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

gcaaatggca ttctgacatc c 21

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

tgttcccgat ctgcgtctat 20

<210> 4

<211> 30

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

tgatccttca gtaacatcag agattttgag 30

<210> 5

<211> 30

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

ctgatgttac tgaaggatca gatcacgcat 30

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

atgggttcta aaggtgaaga at 22

<210> 7

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

atagacgcag atcgggaaca tgctgtaaga gcgaacgg 38

<210> 8

<211> 41

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

attcttcacc tttagaaccc ataaaacaag caaaaacccg c 41

<210> 9

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

atagacgcag atcgggaaca gaccgtttca acacgaac 38

<210> 10

<211> 50

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

attcttcacc tttagaaccc atggataaag gtaagggaaa aaagcaagtg 50

<210> 11

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

atagacgcag atcgggaaca gacatgttag caacagag 38

<210> 12

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

attcttcacc tttagaaccc atttagaatt tttttttttg tcttgg 46

<210> 13

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

atagacgcag atcgggaaca ccaatccaga cgatcaat 38

<210> 14

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

atagacgcag atcgggaaca cacttttaag gtctttaatc 40

<210> 15

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

attcttcacc tttagaaccc atatttatga aattaatcaa ttacct 46

<210> 16

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

atagacgcag atcgggaaca gtcagaaacc atccagcc 38

<210> 17

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

attcttcacc tttagaaccc attattgttt gttgatggtt ttcact 46

<210> 18

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

atagacgcag atcgggaaca tgcaggagaa gacgaaacag 40

<210> 19

<211> 41

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

attcttcacc tttagaaccc attagggggt ttaacaaggg g 41

<210> 20

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

atagacgcag atcgggaaca gctcagtgat atcatggcc 39

<210> 21

<211> 52

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

attcttcacc tttagaaccc atgaggtatt atgtatgtct gatactttga ag 52

<210> 22

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 22

atagacgcag atcgggaaca agatcgtcac cacgaagt 38

<210> 23

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 23

attcttcacc tttagaaccc attgttgtgt actagctaat tgattg 46

<210> 24

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 24

atagacgcag atcgggaaca catgaaccgg atagcacg 38

<210> 25

<211> 50

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 25

attcttcacc tttagaaccc attggattga tttcagttaa aaaaaagtct 50

<210> 26

<211> 42

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 26

aatagacgca gatcgggaac acgcctgcta tatggttagg ac 42

<210> 27

<211> 55

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 27

taattcttca cctttagaac ccattgtgta aaaaatatgt tcaattgata tgtgg 55

<210> 28

<211> 41

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 28

atagacgcag atcgggaaca acaacaacca gaactgataa t 41

<210> 29

<211> 41

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 29

tcttcacctt tagaacccat tctgtctaga ggatatggaa g 41

<210> 30

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 30

atagacgcag atcgggaaca ctcagcgtct ccagcttc 38

<210> 31

<211> 50

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 31

attcttcacc tttagaaccc attttgattt gtttaggtaa cttgaactgg 50

<210> 32

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 32

atagacgcag atcgggaaca gttacggtct gagaaccg 38

<210> 33

<211> 45

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 33

attcttcacc tttagaaccc atgacgactc tatagtggag attga 45

<210> 34

<211> 41

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 34

atagacgcag atcgggaaca taacctatct acgcatcaaa t 41

<210> 35

<211> 42

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 35

tcttcacctt tagaacccat gattatttgt ttatgggtga gt 42

<210> 36

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 36

gaaatagacg cagatcggga acatgacggt actagaggac tcttag 46

<210> 37

<211> 54

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 37

taattcttca cctttagaac ccatcgtaaa gtaaataaga taaaagctag tagc 54

<210> 38

<211> 30

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 38

cgaataataa ctgttatttt tcagtgttcc 30

<210> 39

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 39

ggaatacaac tataactctc acaa 24

<210> 40

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 40

acaagactgg accatcac 18

<210> 41

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 41

atgagatttc cttcaatttt tactgcag 28

<210> 42

<211> 47

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 42

ggaacactga aaaataacag ttattattca gatcgtcacc acgaagt 47

<210> 43

<211> 52

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 43

ctgcagtaaa aattgaagga aatctcattg ttgtgtacta gctaattgat tg 52

<210> 44

<211> 47

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 44

ggaacactga aaaataacag ttattattct gctgtaagag cgaacgg 47

<210> 45

<211> 47

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 45

ctgcagtaaa aattgaagga aatctcataa aacaagcaaa aacccgc 47

<210> 46

<211> 50

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 46

ggaacactga aaaataacag ttattattca caacaaccag aactgataat 50

<210> 47

<211> 49

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 47

ctgcagtaaa aattgaagga aatctcattc tgtctagagg atatggaag 49

<210> 48

<211> 52

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 48

ggaacactga aaaataacag ttattattct gacggtacta gaggactctt ag 52

<210> 49

<211> 58

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 49

ctgcagtaaa aattgaagga aatctcatcg taaagtaaat aagataaaag ctagtagc 58

<210> 50

<211> 47

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 50

ggaacactga aaaataacag ttattattcg acatgttagc aacagag 47

<210> 51

<211> 52

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 51

ctgcagtaaa aattgaagga aatctcattt agaatttttt tttttgtctt gg 52

<210> 52

<211> 939

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 52

gatctaacat ccaaagacga aaggttgaat gaaacctttt tgccatccga catccacagg 60

tccattctca cacataagtg ccaaacgcaa caggagggga tacactagca gcagaccgtt 120

gcaaacgcag gacctccact cctcttctcc tcaacaccca cttttgccat cgaaaaacca 180

gcccagttat tgggcttgat tggagctcgc tcattccaat tccttctatt aggctactaa 240

caccatgact ttattagcct gtctatcctg gcccccctgg cgaggttcat gtttgtttat 300

ttccgaatgc aacaagctcc gcattacacc cgaacatcac tccagatgag ggctttctga 360

gtgtggggtc aaatagtttc atgttcccca aatggcccaa aactgacagt ttaaacgctg 420

tcttggaacc taatatgaca aaagcgtgat ctcatccaag atgaactaag tttggttcgt 480

tgaaatgcta acggccagtt ggtcaaaaag aaacttccaa aagtcggcat accgtttgtc 540

ttgtttggta ttgattgacg aatgctcaaa aataatctca ttaatgctta gcgcagtctc 600

tctatcgctt ctgaaccccg gtgcacctgt gccgaaacgc aaatggggaa acacccgctt 660

tttggatgat tatgcattgt ctccacattg tatgcttcca agattctggt gggaatactg 720

ctgatagcct aacgttcatg atcaaaattt aactgttcta acccctactt gacagcaata 780

tataaacaga aggaagctgc cctgtcttaa accttttttt ttatcatcat tattagctta 840

ctttcataat tgcgactggt tccaattgac aagcttttga ttttaacgac ttttaacgac 900

aacttgagaa gatcaaaaaa caactaatta ttcgaaacg 939

<210> 53

<211> 477

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 53

tttttgtaga aatgtcttgg tgtcctcgtc caatcaggta gccatctctg aaatatctgg 60

ctccgttgca actccgaacg acctgctggc aacgtaaaat tctccggggt aaaacttaaa 120

tgtggagtaa tggaaccaga aacgtctctt cccttctctc tccttccacc gcccgttacc 180

gtccctagga aattttactc tgctggagag cttcttctac ggcccccttg cagcaatgct 240

cttcccagca ttacgttgcg ggtaaaacgg aggtcgtgta cccgacctag cagcccaggg 300

atggaaaagt cccggccgtc gctggcaata atagcgggcg gacgcatgtc atgagattat 360

tggaaaccac cagaatcgaa tataaaaggc gaacaccttt cccaattttg gtttctcctg 420

acccaaagac tttaaattta atttatttgt ccctatttca atcaattgaa caactat 477

<210> 54

<211> 720

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 54

atgggttcta aaggtgaaga attattcact ggtgttgtcc caattttggt tgaattagat 60

ggtgatgtta atggtcacaa attttctgtc tccggtgaag gtgaaggtga tgctacttac 120

ggtaaattga ccttaaaatt tatttgtact actggtaaat tgccagttcc atggccaacc 180

ttagtcacta ctttcggtta tggtgttcaa tgttttgcga gatacccaga tcatatgaaa 240

caacatgact ttttcaagtc tgccatgcca gaaggttatg ttcaagaaag aactattttt 300

ttcaaagatg acggtaacta caagaccaga gctgaagtca agtttgaagg tgatacctta 360

gttaatagaa tcgaattaaa aggtattgat tttaaagaag atggtaacat tttaggtcac 420

aaattggaat acaactataa ctctcacaat gtttacatca tggctgacaa acaaaagaat 480

ggtatcaaag ttaacttcaa aattagacac aacattgaag atggttctgt tcaattagct 540

gaccattatc aacaaaatac tccaattggt gatggtccag tcttgttacc agacaaccat 600

tacttatcca ctcaatctgc cttatccaaa gatccaaacg aaaagagaga ccacatggtc 660

ttgttagaat ttgttactgc tgctggtatt acccatggta tggatgaatt gtacaaataa 720

Claims

1. Methanol inducible promoter P for recombinant protein expression ₀₅₄₇ Characterized in that the methanol inducible promoter P ₀₅₄₇ The sequence of (2) is shown as 2416633 th to 2417632 th from the 5' end of NCBI accession NC_ 012963.1.

2. Constitutive promoter P for recombinant protein expression ₀₄₇₂ Characterized in that the constitutive promoter P ₀₄₇₂ The sequence of (2) is shown as 874193 th to 875192 th from the 5' end of NCBI accession NC_ 012964.1.

3. Methanol inducible promoter P ₀₅₄₇ Or constitutive promoter P ₀₄₇₂ Use of said P in recombinant protein expression in large-scale and/or small-scale bioreactors, characterized in that ₀₅₄₇ The sequence of the promoter is shown in 2416633 th to 2417632 th positions from the 5' end of NCBI accession NC_012963.1, said P ₀₄₇₂ The sequence of the promoter is shown as 874193 th to 875192 th from the 5' end of NCBI accession NC_ 012964.1.

4. The use according to claim 3, wherein the large scale bioreactor is a 3-5L bioreactor; the small-scale bioreactor is a bioreactor which is more than or equal to 0.1L and less than 3L.

5. A GS 115-promoter-GFP expression strain is characterized in that the strain uses PAGR1 and PGFPF2 with primer sequences shown as SEQ ID NO.3 and SEQ ID NO.6 as primers to amplify green fluorescent protein GFP expression frame, and the GFP expression frame and P are cloned by a one-step cloning kit ₀₅₄₇ The promoter is connected to a pPIC 9K vector and is obtained by transforming GS115 strain after construction; or, it uses PAGR1 and PGFPF2 whose primer sequences are shown in SEQ ID NO.3 and SEQ ID NO.6 as primers to amplify green fluorescent protein GFP expressionThe GFP expression cassette, P, is framed by a one-step cloning kit ₀₄₇₂ Construction of the promoter into the pPIC 9K vector followed by transformation of the GS115 Strain, said P ₀₅₄₇ The sequence of the promoter is shown in 2416633 th to 2417632 th positions from the 5' end of NCBI accession NC_012963.1, said P ₀₄₇₂ The sequence of the promoter is shown as 874193 th to 875192 th from the 5' end of NCBI accession NC_ 012964.1.

6. A GS 115-promoter-AMY expression strain, characterized in that it is obtained by amplifying recombinant alpha-amylase expression cassette by PCR and amplifying the recombinant alpha-amylase expression cassette together with promoter P ₀₄₇₂ After construction, the GS115 strain is transformed and obtained by being connected to pPIC 9K vector; alternatively, it is amplified by PCR of a recombinant alpha-amylase expression cassette, and is combined with promoter P ₀₅₄₇ After construction of the vector together with pPIC 9K, the transformed GS115 strain is obtained, wherein the P ₀₅₄₇ The sequence of the promoter is shown in 2416633 th to 2417632 th positions from the 5' end of NCBI accession NC_012963.1, said P ₀₄₇₂ The sequence of the promoter is shown as 874193 th to 875192 th from the 5' end of NCBI accession NC_ 012964.1.

7. Use of a GS 115-promoter-GFP expression strain according to claim 5 for recombinant protein expression in large scale bioreactors and/or small scale bioreactors.

8. The use according to claim 7, wherein the large scale bioreactor is a 3-5L bioreactor; the small-scale bioreactor is a bioreactor which is more than or equal to 0.1L and less than 3L.

9. Use of a GS 115-promoter-AMY expression strain according to claim 6 for recombinant protein expression in large-scale and/or small-scale bioreactors.

10. The use according to claim 9, wherein the large scale bioreactor is a 3-5L bioreactor; the small-scale bioreactor is a bioreactor which is more than or equal to 0.1L and less than 3L.