CN113528484B - nCas3 single-stranded endonuclease and application thereof - Google Patents

Abstract

The invention belongs to the technical field of biology, and particularly relates to nCas3 single-stranded endonuclease and application thereof. The nCas3 single-strand endonuclease provided by the invention breaks the helicase activity region of Cas3 protein in a type I system to make the nCas3 single-strand endonuclease become nCas3 protein with single-strand nuclease activity, so that the aim of cutting one DNA single strand at a target site without damaging the other DNA single strand in a DNA molecule in the gene editing process is fulfilled. Therefore, the toxicity of the Cas3 protein to cells in the gene editing process is reduced, so that the transformation efficiency is improved, more transformants are obtained, and more edited target strains are obtained through screening.

Description

nCas3 single-stranded endonuclease and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to nCas3 single-stranded endonuclease and application thereof.

Background

CRISPR-Cas is a prokaryotic adaptive immune system widely found in most bacteria and archaea, and is used to prevent the invasion of exogenous genetic materials such as viruses or plasmids.

Recent studies have demonstrated that the CRISPR-Cas system structurally consists of two parts. First, there are regularly clustered spaced short palindromic repeats (CRISPRs) in which the host can store the invading genetic material information. Secondly, there are some CRISPR-associated proteins (Cas proteins). Cas proteins include helicases, nucleases, and structural proteins encoded by CRISPR-associated genes. After the foreign gene sequence stored in the CRISPR cluster is transcribed and processed into pre-crRNA with a specific structure, the Cas protein binds to the crRNA, and recognizes and cleaves the invading foreign gene sequence.

At present, the prokaryotic adaptive immune system is widely applied to various fields of microbiology, molecular biology and the like. To date, the hierarchy of classification of CRISPR-Cas systems has largely been divided into two major classes and six types in total. The class 1 system comprises type I, type III and type IV, and is characterized by being jointly formed by a plurality of Cas proteins. Type I and Type III are the most common and diverse, occurring in a large number of archaea, and less so in bacteria. Type IV systems lack the adaptation module of the CRISPR-Cas locus. Class 2 systems, including type II, V and VI, consist of a single, large, multi-domain Cas protein. There is a signature protein corresponding to each type of CRISPR-Cas system. For example, effector protein Cas9 with endonuclease activity in type II systems and effector protein Cpf1 in type V systems. In type i systems, the characteristic effector protein is the Cas3 protein.

Cas3 protein is a multifunctional protein encoded by Cas3 gene, having single-stranded dna (ssdna) -stimulated atpase activity, ATP-dependent helicase activity and a metal-dependent single-stranded nuclease activity simultaneously. In most cases, its helicase domain will be fused to the HD site in the nuclease domain at the n-terminus of the Cas3 protein and participate in the cleavage of the target DNA.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides an nCas3 single-stranded endonuclease and application thereof, and aims to solve part of problems in the prior art or at least alleviate part of problems in the prior art.

The nCas3 single-strand endonuclease is an nCas3 protein which causes mutation on a helicase functional domain of a wild-type Cas3 protein, enables the wild-type Cas3 protein to lose helicase activity and only has single-strand nuclease activity.

Further, the amino acid sequence of the wild-type Cas3 protein is shown as SEQ ID No. 1;

the nCas3 single-stranded endonuclease is K458A, or D608A, or R887A;

the amino acid sequence of K458A differs from that of SEQ ID NO.1 only by replacing the "K" at position 458 with an "A";

the amino acid sequence of D608A is different from that of SEQ ID NO.1 only in that "D" at position 608 is replaced with "A";

the amino acid sequence of R887A differs from that of SEQ ID NO.1 only by replacing the "R" at position 887 with an "A".

Further, the amino acid sequence of the nCas3 single-stranded endonuclease is the amino acid sequence which is formed by the substitution and/or deletion and/or insertion of a plurality of amino acid residues of the amino acid sequence of K458A, D608A or R887A and has the same protein function.

Further, the nucleotide sequence of the wild-type Cas3 protein is shown as SEQ ID No. 2;

the nucleotide sequence of K458A differs from that of SEQ ID NO.2 only by replacing "aa" at position 1372-1373 with "gc";

the nucleotide sequence of D608A is different from that of SEQ ID NO.2 only in that "a" at position 1823 is replaced by "c";

the nucleotide sequence of R887A differs from that of SEQ ID NO.2 only by replacing "cg" at position 2659-2660 with "gc".

Further, the nucleotide sequence of the nCas3 single-stranded endonuclease is a DNA sequence which hybridizes with the DNA sequence of K458A, or D608A, or R887A and encodes the same functional protein; or a DNA molecule which has more than 90% homology with the DNA sequence defined by K458A, D608A or R887A and encodes the same functional protein.

The invention also provides a transformant, which comprises the nucleotide sequence of the nCas3 single-stranded endonuclease.

Further, the transformant includes any one of a recombinant vector, an expression cassette, a transgenic cell, and a recombinant bacterium.

Further, the recombinant vector may be pET28 a; the recombinant bacterium may be Escherichia coli, such as BL21(DE3), and may be Zymomonas mobilis.

Further, the recombinant vector comprises at least one promoter.

Further, the promoter includes enhanced promoters and/or constitutive promoters, which may be used alone or in combination with other promoters.

Further, the recombinant vector may further comprise an enhancer.

Further, the enhancer includes a translational enhancer or a transcriptional enhancer. These enhancer regions may be the ATG initiation codon or adjacent regions initiation codon, etc., but must be in frame with the coding sequence to ensure proper translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene.

The invention also provides application of the nCas3 single-strand endonuclease in cutting of single DNA strands and/or gene editing.

Further, the gene editing includes any one of gene knockout, site-directed mutation, and insertion.

The invention also provides a method for producing the nCas3 single-stranded endonuclease, which comprises culturing the transformant and collecting the nCas3 single-stranded endonuclease from the culture product. The collected nCas3 single-stranded endonuclease can be further purified.

The invention also provides a primer pair for amplifying the full length of the coding gene of the exo-alpha-1, 4-glycosidase and any fragment thereof. The sequences of the primer pairs are shown as SEQ ID NO.3 and SEQ ID NO. 4.

The application of any one of the protein, the coding gene, the recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant bacterium in the internal cutting of the single-stranded DNA nucleic acid also belongs to the protection scope of the invention.

The invention also provides a strain DRM2 after genome transformation of Zymomonas mobilis ZM4(Seo et al 2005). The strain is obtained by replacing adenine nucleotide of 676,661 number in ZMO0681 gene of Cas3 protein with cytosine nucleotide in situ on the basis of original ZM4 strain.

The invention also provides application of the modified DRM2 strain, and when the modified I-F type CRISPR-Cas system endogenous to the strain is used for genome large fragment knockout, compared with the original strain, the modified DRM2 strain can enable DNA to generate single-strand break at a targeted site of a gene, and can remarkably improve the transformation efficiency and the editing efficiency of an editing plasmid.

In order to achieve the above purpose, the invention adopts the following measures:

by aligning the ZM4 strain with other strains which also carry the endogenous I-type CRISPR-Cas system and the coding gene sequence difference of the endogenous CRISPR related protein, the functional structure division of the Cas3 protein is found. And by exploring the working principle of the I-F type CRISPR-Cas system, one amino acid in the helicase domain of the Cas3 protein in the ZM4 strain is designed and replaced. The adenine nucleotide of 676,661 number in ZMO0681 gene which originally codes Cas3 protein on ZM4 strain is replaced by cytosine nucleotide in situ, so that Cas3 protein loses helicase activity and is converted into nCas3 protein which only carries single-stranded DNA endonuclease activity. Thus, the modified strain DRM2 was obtained.

The growth conditions and growth curves of the DRM2 strain and the wild-type Zymomonas mobilis ZM4 strain were the same.

In the process of completing a large-fragment gene knockout experiment on a genome by the DRM2 strain, compared with a wild ZM4 strain, the DRM2 strain can break a single strand of DNA at a targeted site of a gene, and can remarkably improve the transformation efficiency and the editing efficiency of editing plasmids.

In summary, the advantages and positive effects of the invention are:

1. generally, in the gene editing process of the type i CRISPR-Cas system, when the Cas3 protein damages a target fragment, the single-stranded nuclease activity is exerted first, and a nick is cut on a single-stranded DNA of a target region. Then, as the Cas3 protein moves downstream along the target DNA, its helicase activity is exerted, so that hydrogen bonds near the nick are broken and the DNA double helix is unwound. Then the other single strand is exposed, and contacts with the Cas3 protein again, and is broken, and finally a double strand break of the target DNA fragment is formed.

The nCas3 single-strand endonuclease provided by the invention breaks the helicase activity region of Cas3 protein in a type I system to make the nCas3 single-strand endonuclease become nCas3 protein with single-strand nuclease activity, so that the aim of cutting one DNA single strand at a target site without damaging the other DNA single strand in a DNA molecule in the gene editing process is fulfilled. Therefore, the toxicity of the Cas3 protein to cells in the gene editing process is reduced, so that the transformation efficiency is improved, more transformants are obtained, and more edited target strains are obtained through screening.

2. The editing efficiency of the CRISPR-Cas system is closely related to the molecular weight and the function of a target gene. Generally, longer genes are edited with correspondingly lower transformation efficiency when the genes are edited due to different difficulty of repair after genome damage, and the fewer transformants can be obtained, the lower the success rate of final editing is. At present, reports about the endogenous I-F type CRISPR-Cas system of ZM mobilis ZM4 indicate that the system can achieve nearly 100% efficiency when a single gene is knocked out and replaced. However, in the face of larger segments of the gene (about 5% o of the genome), the efficiency is only 50%.

In the application, functional structural division of the Cas3 protein is found by comparing the sequence difference of encoding genes of the endogenous CRISPR-related protein of ZM4 and other strains with the endogenous type I CRISPR-Cas system. And by researching the working principle of the I-F type CRISPR-Cas system, one amino acid in a Cas3 protein helicase domain in a ZM4 strain is designed and replaced, so that the helicase activity of the protein is lost, and the protein is converted into nCas3 protein only carrying single-strand DNA endonuclease activity.

This engineered strain was designated as DRM2 strain after engineering and was re-designed to be incorporated into experiments for knocking out large fragments of the genome. Finally, when the plasmid is edited for a large genome segment (about 5% o of the genome), the transformation efficiency of the edited plasmid is obviously improved (compared with a control, the transformation efficiency is improved by more than 100 times), and the final editing efficiency is also improved to be close to 100%.

Drawings

FIG. 1 is the result of SDS-PAGE in example 1;

FIG. 2 is a graph showing the effect of cleavage of circular DNA in example 2;

FIG. 3 is the Cas3 protein gene structure on the genome of ZM4 strain;

FIG. 4 shows the structural fragment analysis result of Cas3 protein as a colony PCR product in example 3;

FIG. 5 shows the results of electrophoresis of PCR products of the colonies in example 3;

FIG. 6 is the result of sequencing the PCR product in example 3;

FIG. 7 shows the results of transformation efficiency of the engineered strain in example 4;

FIG. 8 shows the editing efficiency results of the engineered strains in example 4.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples, and the equipment and reagents used in the examples and test examples are commercially available without specific reference. The specific embodiments described herein are merely illustrative of the invention and are not intended to be limiting.

Various modifications to the precise description of the invention will be readily apparent to those skilled in the art from the information contained herein without departing from the spirit and scope of the appended claims. It is to be understood that the scope of the invention is not limited to the procedures, properties, or components defined, as these embodiments, as well as others described, are intended to be merely illustrative of particular aspects of the invention. Indeed, various modifications of the embodiments of the invention which are obvious to those skilled in the art or related fields are intended to be covered by the scope of the appended claims.

For a better understanding of the invention, and not as a limitation on the scope thereof, all numbers expressing quantities, percentages, and other numerical values used in this application are to be understood as being modified in all instances by the term "about". Accordingly, unless expressly indicated otherwise, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. In the present invention, "about" means within 10%, preferably within 5% of a given value or range.

In the following examples of the present invention, the temperature is not particularly limited, and all of the conditions are normal temperature conditions. The normal temperature refers to the natural room temperature condition in four seasons, no additional cooling or heating treatment is carried out, and the normal temperature is generally controlled to be 10-30 ℃, preferably 15-25 ℃.

The genes, proteins or fragments thereof involved in the present invention may be naturally purified products, or chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, plants) using recombinant techniques.

The invention discloses an nCas3 single-stranded endonuclease and application thereof, and particularly relates to the following examples.

Example 1 preparation and function of proteins and their coding genes.

The nCas3 single-strand endonuclease is characterized in that after mutation is introduced to a helicase functional domain of a wild-type Cas3 protein, the helicase activity of the protein is lost, and the protein is converted into the nCas3 protein only having single-strand nuclease activity, and the single-strand endonuclease activity acts on one single strand of a target DNA double strand in a mode of endonucleo 1, 4-phosphodiester bond.

The amino acid sequence and the nucleotide sequence of the wild type (wide type) Cas3 protein related in the embodiment of the invention are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively. In this example, three different sequences of nCas3 single-stranded endonucleases are specifically shown, namely K458A (alanine is used to replace lysine at position 458 of wild-type Cas3 protein, and the amino acid sequence is different from SEQ ID NO.1 only by replacing "K" at position 458 with "A"; the nucleotide sequence is different from SEQ ID NO.2 only by replacing "aa" at position 1372 and 1373 with "gc"), D608A (alanine is used to replace aspartic acid proline at position 608 of wild-type Cas3 protein, and the amino acid sequence is different from SEQ ID NO.1 only by replacing "D" at position 608 with "A"; the nucleotide sequence is different from SEQ ID NO.2 only by replacing "a" at position 1823 with "c") and R887A (alanine is used to replace arginine at position 887 of wild-type Cas3 protein, and the amino acid sequence is different from SEQ ID NO.1, the only difference is that "R" at position 887 is replaced with "a"; the nucleotide sequence differs from that of SEQ ID NO.2 only by replacing "cg" at positions 2659-2660 with "gc".

1. The preparation of the template DNA can be carried out by the following two methods, respectively:

(1) extraction of total DNA of Zymomonas mobilis ZM 4: taking 20 g of fresh wet thalli of Zymomonas mobilis Zymomonas mobilis ZM4, suspending the fresh wet thalli in 10ml of 50mM Tris buffer solution (pH8.0), adding a small amount of lysozyme and 8 ml of 0.25mM EDTA (pH8.0), uniformly mixing, and standing at 37 ℃ for 20 min; then adding 2 ml of SDS with the mass fraction of 10%, standing at 55 ℃ for 5min, and respectively extracting once by using phenol and chloroform with the same volume; adding 2 times volume of ethanol into the supernatant solution of the last time, recovering DNA, and washing with 70% and absolute ethanol respectively; dissolving the precipitate in 0.5 mL TE buffer (pH8.0, 10mM Tris, 1mM EDTA), adding 10mg/mL RNase 3 μ L, incubating at 37 deg.C for 1 hr, and extracting with equal volume of phenol and chloroform respectively; adding 2 times volume of ethanol into the supernatant solution, recovering DNA, washing with 70% and anhydrous ethanol respectively, vacuum drying, and dissolving with deionized water.

(2) DNA fragments of the nucleotide sequences of three nCas3 single-stranded endonucleases were artificially synthesized. The synthesis was performed in Kinry Biotechnology, Inc.

2. PCR amplification Using primers

The primer pairs were designed based on the target nucleotide sequence as follows:

a forward primer: 5'-CTTTAAGAAGGAGATATACCATATGAATGTTCTATTCGTTTCGC-3', as shown in SEQ ID NO. 3;

reverse primer: 5'-GATCTCAGTGGTGGTGGTGGTGGTGACTATGATATCTGGAAAATC-3', as shown in SEQ ID NO. 4;

the PCR amplification is carried out by using the total DNA of Zymomonas mobilis ZM4 or the nucleotide sequence of artificially synthesized nCas3 single-stranded endonuclease as a template and using a designed primer pair.

And (3) PCR reaction system: 5 μ L of 10 Xbuffer; 4. mu.L dNTP; 0.5 μ L of ExTaq DNA polymerase; 1 μ L of forward primer; 1 μ L reverse primer; 0.5 μ L template; 38 μ L of water.

And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5min, followed by denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 1min30s, extension at 72 ℃ for 2min, 30 cycles, and final extension at 72 ℃ for 10 min.

The PCR product was checked for yield and specificity by agarose gel electrophoresis and purified using a DNA purification kit. Sequencing the purified PCR product, and naming the mutant sequence as ncas3 fragment, wherein the sequence of the PCR product is in accordance with the expected sequence.

3. Construction of recombinant expression vectors

(1) The correct PCR product was purified and recovered by agarose gel electrophoresis.

(2) Plasmid pET28a (Cat. N069864-3, Novogen) was double digested with Nco I and Xho I, and the digested product was recovered by agarose electrophoresis.

(3) And (3) connecting the recovered product in the step (1) with the enzyme digestion product in the step (2), electrically shocking the connecting product to transform escherichia coli DH5 alpha, coating the escherichia coli DH5 alpha on an LB (lysogeny broth) plate containing 50 mu g/mL kanamycin, culturing overnight at 37 ℃, carrying out colony PCR on the obtained transformant by using the forward primer and the reverse primer, screening a recombinant bacterium containing the ncas3 gene, extracting a plasmid of the recombinant bacterium, and carrying out sequencing verification. As a result, the ncas3 gene fragment was inserted between the Nco I and Xho I cleavage sites of pET28a in the correct direction, and the recombinant plasmid was designated as pET28a-ncas 3.

4. Preparation of engineering bacteria

Escherichia coli BL21(DE3) (Cat. N0 CD801, all-Co., Ltd.) was transformed with plasmid pET28a-ncas3 by electric shock, spread on LB plate containing 50. mu.g/mL kanamycin, and cultured overnight at 37 ℃ to obtain an engineered bacterium containing plasmid pET28a-ncas3, which was designated as BL21/pET28a-ncas 3.

Coli BL21(DE3) was transformed with pET28a in place of pET28a-ncas3, and the same procedure as above gave an empty recombinant bacterium containing pET28a as a control bacterium. The strain transformed into pET28a was designated BL21/pET28 a.

5. Preparation and purification of nCas3 single-stranded endonuclease

Culturing the positive recombinant bacterium BL21/pET28a-nCas3 prepared in the step 4 in an LB culture medium containing 50 mu g/mL kanamycin, and culturing for 3h at 37 ℃; when OD600 is 0.7, IPTG is added to a final concentration of 0.8mM in LB medium, and the medium is turned to 18 ℃ for further culture for 16 h. Centrifuging at 3800rpm for 15min to collect thallus, suspending in PBS (20mM Tris-HCl, pH7.4, 0.5M NaCl), ultrasonic disrupting in ice bath (60w, 10 min; ultrasonic for 1s, stopping for 2s), centrifuging at 12000rpm for 10min to remove cell debris, and collecting supernatant; the supernatant was passed through a His60 Ni Superflow resin purification column, washed with 5mL of ultra-pure water, then rinsed with 10mL of solution A (50mM NaH2PO4-Na2HPO4, pH7.0, 25m M imidazole), and finally eluted with 5mL of solution B (50mM NaH2PO4-Na2HPO4, pH7.0, 500mM imidazole), and the eluate was collected. Then, the eluate was desalted by a Desalting column GE HiTrap desaling, eluted with a solution C (50mM Tris-HCl, pH 7.0), and the obtained eluate was further passed through an anion exchange column GE HiTrap Q FF, wherein the solution D (20mM Tris-HCl, pH7.9) was used for eluting the hetero protein, and the solution E (20mM Tris-HCl, 0.5M NaCl, pH7.9) was used for eluting the target protein, thereby obtaining a nCas3 single-stranded endonuclease pure enzyme solution.

And (4) culturing and purifying the control bacteria prepared in the step (4) by adopting the same steps, and taking the obtained solution as a control enzyme solution.

SDS-PAGE electrophoresis showed that the molecular weight of the purified nCas3 protein was approximately 130kDa, consistent with the theoretical extrapolation of 130.0 kDa. The results are shown in FIG. 1, lane M shows protein molecular weight standards (180, 130, 95, 72, 55 kDa); lane wt shows a positive control served by wild type (wide type) Cas3 protein; lanes K458A, D608A, and R887A show that the wild-type Cas3 protein is converted to nCas3 protein with single-strand nuclease activity only by introducing mutation into the helicase domain and then losing helicase activity; lane ck shows the protein solution purified from BL21/pET28a empty vector expression in step 4 above, as a negative control.

Example 2 verification of protein function Using circular DNA as substrate

The pL2R plasmid (Zheng et al,2019) was chosen as the substrate for the reaction, the total length of the plasmid was 3283 bp. The reaction system contained 150ng of pL2R circular plasmid; 2mM MgCl 2; 0.5mM ATP; 250nM Cascade protein; 250nM of one of the purified Cas3 or nCas3 protein variants described above; one carrying a 32nt crRNA targeting the 5 '-CCC-3' PAM sequence on the pL2R plasmid. The crRNA is synthesized by Kinsley Biotechnology, Inc., and has a sequence shown in SEQ ID NO. 5. After reaction at 30 ℃ for 15, 30 and 60 minutes, the reaction products were run on agarose gel electrophoresis.

The results are shown in FIG. 2, and the leftmost lane in FIG. 2 shows the nucleic acid molecular weight standards (5.0, 3.0, 2.0 kb); the right-most Reaction time axis represents the Reaction duration (15, 30, 60 min); the right OC, L, SC represent the state of the circular DNA molecule after the reaction, [ OC (open circle open); l (linear); SC (stimulated supercoiled); the DNA alone lane shows the state of the circular plasmid when no Cas3 protein or nCas3 protein is added in the reaction system, and the plasmid keeps a supercoiled state unchanged along with the increase of the reaction time, which shows that the structure of the plasmid DNA is not damaged; the wt lane shows the state of the circular plasmid when wild type (tide type) Cas3 protein is added into the reaction system, and the plasmid is gradually changed into a semi-open loop from a supercoiled loop and then changed into a linear loop until the linear loop disappears along with the increase of the reaction time, which shows that the plasmid DNA is subjected to double-strand break successively under the action of the wild type Cas3 protein and is gradually degraded; lanes K458A, D608A and R887A show that after mutation is introduced to the helicase functional domain of the wild-type Cas3 protein in the reaction system, the wild-type Cas3 protein loses helicase activity, and then is converted into nCas3 protein with single-strand nuclease activity, as the reaction time increases, the plasmid gradually changes from a supercoiled state into an open-loop state, and the open-loop state is maintained until the final time of the reaction and does not progress to linearity or degradation, which shows that the plasmid DNA only completes the single-strand break of the DNA molecule under the action of the modified single-strand nuclease nCas3 protein, and the result is in line with experimental expectation.

Example 3 preparation of engineered bacteria comprising nCas3 Single-stranded Endonuclease

In this example, D608A was used as an example to prepare an engineered bacterium containing nCas3 single-stranded endonuclease.

1. Design and construction of Single base editing plasmids

(1) According to the experimental requirements, the target site on the genome is edited by utilizing an I-F type CRISPR-Cas editing system endogenous in the ZM4 strain.

As shown in FIG. 3, through careful analysis of the Cas3 protein encoding gene on the genome of ZM4 strain, it was found that 5 '-TCC-3' PAM sequence existed in the Cas3 gene sequence, and thus the 32-nt sequence downstream thereof was designed as a protospacer. To avoid the CRISPR-Cas system disrupting the transferred donor plasmid and complete the in situ substitution of adenine nucleotide to cytosine nucleotide at 676,661 within the ZMO0681 gene, a total of three nucleotide changes were introduced on the donor DNA. For clarity, the position numbers of the original spacer sequences are set as: the position immediately downstream of the PAM sequence is referred to as 1, followed by positions 2, 3, etc., up to 32; and the positions in the middle of the PAM sequence are called-1, -2, -3, where-1 is the position closest to the spacer sequence. Thus, the positions of the three nucleotide changes on the donor DNA were C-1T, C3T and T25G. Wherein C-1T and C3T destroy the PAM sequence and the Seed sequence in the original spacer sequence, respectively, and are used for protecting donor plasmid and ensuring the survival of the edited cells. And the nucleotide substitutions of the two sites do not cause the change of corresponding amino acid, so the original protein sequence is not damaged. The mutation of T25G is to replace the 676,661 adenine nucleotide in ZMO0681 gene with cytosine nucleotide in situ, so that the GAT codon of aspartic acid (D) is replaced with GCT codon of alanine (A). Moreover, in order to conveniently screen positive transformants after editing, C3T introduces a new restriction enzyme site Dra I (TTTAAA) while breaking the Seed sequence, so that strains with expected editing can be quickly screened by treating the PCR product of the colony as shown in FIG. 4.

Similarly, engineering bacteria can be prepared aiming at K458A and R887A, and the engineering bacteria are respectively as follows:

in situ replacing an adenine nucleotide at position 676,209 with a guanine nucleotide and an adenine nucleotide at position 676,209 with a cytosine nucleotide within a ZMO0681 gene encoding a Cas3 protein;

the replacement of cytosine nucleotide No. 677,497 to guanine nucleotide and guanine nucleotide No. 677,498 to cytosine nucleotide in situ within the ZMO0681 gene encoding Cas3 protein.

The changes of two bases of C-1T and C3T fall within the scope of codon degeneracy, and do not affect the translation of the protein. But only for the operation of in-situ replacement, and has no relation with the property of engineering bacteria.

(2) According to the design in (1), a single-base editing plasmid pNS-cas3 was constructed as shown in FIG. 3. Based on the plasmid pL2R, the original spacer sequence S (D608) and cas3 containing three nucleotide substitutions as specified were introduced separately above.

Wherein the original spacer sequence S is obtained by a primer annealing process, 1. mu.L of each of the primers S (D608) -F and S (D608) -R is mixed into a reaction buffer (10. mu.L of the system: 1. mu.L of the primer S (D608) -F, 1. mu.L of the primer S (D608) -R, 1. mu.L of the buffer, and 7. mu.L of water), reacted at 95 ℃ for 5 minutes by a PCR instrument and then cooled to room temperature for reaction for 10 minutes, and the original spacer sequence S (D608) is obtained, and the sequence is shown as SEQ ID NO. 16.

S(D608)-F：GAAAGAATCTTTGCGGGGCGGGCGACAAATCGCACC；SEQ ID NO.6；

S(D608)-R：GAACGGTGCGATTTGTCGCCCGCCCCGCAAAGATTC；SEQ ID NO.7。

The cas3 gene sequence (shown in SEQ ID NO. 17) after nucleotide substitution is obtained by cloning ZM4 genome in primers cas3-F, D608A-R, D608A-F, cas3-R (the underlined parts in the sequence are EcoR I and Xba I restriction enzyme cutting sites respectively). The specific process is as follows: the UP (D608A) and DOWN (D608A) were linked as cas3(D608A) by using cas3-F and D608A-R to amplify the upper half UP (D608A), the DOWN (D608A) by using D608A-F and cas3-R to amplify the lower half DOWN (D608A), and finally performing overlap PCR with cas3-F and cas 3-R.

cas3-F：AGGTCACCAGCTCACCGTCTGAATTCATGAATGTTCTATTCGTTTC；SEQ ID NO.8；

D608A-R：CTTTTAAATCATAATCATCCAATTCAGCTAAAACGAGATCAGCCCCC；SEQ ID NO.9；

D608A-F：GCTGAATTGGATGATTATGATTTAAAAGATTTACCCGCCTTAACTCG；SEQ ID NO.10；

cas3-R：CTCGAGAGATCTGATATCACTCTAGATTAACTATGATATCTGGAAA；SEQ ID NO.11。

Plasmid pL2R was digested with Bsa I endonuclease at 37 ℃ for 4 hours, and then purified and recovered by agarose gel electrophoresis. The recovered product is assembled and connected with S (D608) by a T4 DNA enzyme linking technology. The ligation product was digested with EcoR I and Xba I endonucleases at 37 ℃ for 4 hours, and then purified and recovered by agarose gel electrophoresis. Finally, the recovered product is connected and assembled with a cas3 gene sequence after nucleotide replacement to obtain a single-base editing plasmid pNS-cas 3.

2. Construction of engineered Strain DRM2 Using editing plasmids

(1) The single-base editing plasmid pNS-cas3 constructed as described above was transformed into the DRM1 strain (Zheng et al,2019) prepared as competent cells by means of heat shock transformation. The conversion steps are as follows: mixing the plasmid and competent cells on ice, placing the mixture into a water bath at 42 ℃ for heat shock for 35s, then adding 1ml of LB liquid culture medium, culturing the mixture at 37 ℃ for 1 hour, centrifuging the mixture to collect bacteria, and coating the bacteria on a plate with spectinomycin resistance.

(2) Transformants on the medium after antibiotic selection were collected and colony PCR was performed using primers cas3-Chk-F and cas 3-Chk-R.

cas3-Chk-F：GATCACGGAAATTATTTGGCTTATGGCCTTGGTGCTACTGCGAC；SEQ ID NO.12；

cas3-Chk-R：

GAAGACATCCAAGGCGGCGGCATTACCGACAACATCTATATCAAAATTTTC；SEQ ID NO.13。

(3) To the PCR product obtained in step (2), Dra I restriction endonuclease (supplied by NEB) was added, and agarose gel electrophoresis was performed after 2 hours of digestion. The results of electrophoresis are shown in FIG. 5, in which the leftmost lane M represents the nucleic acid molecular weight standards (2.0, 1.0, 0.75 kb); the rightmost panel is labeled as the nucleic acid band molecular weight in the gel plot; ck represents that the gene group of the DRM1 strain is used as a template, and a product obtained by enzyme digestion after amplification is used as a control group; 1. lanes 2, 3 and 4 are four transformants picked on the plate.

(4) Comparing the actual result obtained after the experiment of FIG. 5 with the expected band pattern obtained in FIG. 4, it is found that the band patterns after enzyme digestion corresponding to lanes 1, 2, 3 are all consistent with the band pattern which should be generated after the expected editing; the band pattern in lane 4 is the same as that in the control group. Indicating that the expected designed nucleotide substitutions were made on the genome in the transformants corresponding to lanes 1, 2 and 3.

(5) After subculture, one of the strains was selected and its corresponding PCR product was sent to sequencing company for detection (completed by kasei biotechnology limited), and the sequencing result is shown in fig. 6, where the peak pattern is single and matches the expected sequence. The construction of the DRM2 engineering strain was successful.

Example 4 application of engineering bacteria in Large fragment genome knock-out

1. Through the analysis of the genome of the ZM4 strain, the gene No.1,858,251-1,868,309 on the ZM4 genome, namely the ZMO1815-ZMO1822 gene is selected as a knockout target, and the sequence of the knockout fragment totals 10058 nucleotides. The method comprises the steps of designing and constructing 3 knockout plasmids of different sites in a target region, namely pKO-1, pKO-2 and pKO-3 (three editing plasmids all carry an artificial CRISPR cluster and a Donor sequence serving as a homology arm, wherein the CRISPR cluster comprises a spacer sequence designed for the target region, the three plasmids are only different in the spacer sequence, so that different sites in the target region are targeted, and the Donor sequences of the three plasmids are completely identical and are combined by respectively cutting 300bp sequences on the upstream and the downstream of the target region on a genome). Wherein each knockout plasmid carries two spacer sequences for the targeting sequence DNA coding strand and the template strand, respectively.

2. The editing plasmids pKO-1, pKO-2 and pKO-3 constructed in the above steps are transformed into the DRM2 strain by electroporation. The electroporation transformation procedure was as follows: the plasmid was well mixed with the DRM2 strain competence and ice, and then added to an electric cuvette having a diameter of 0.1 cm. And (3) performing electrotransformation in an electrotransfer under the condition of 1.6kv, adding RMG liquid culture medium, recovering for 6 hours, and then collecting bacteria and coating plates with RMG resistance.

3. And (3) placing the plate subjected to electroporation transformation in the step into an incubator at 30 ℃ for culturing for 48 hours, taking out the plate, and counting the number of the transformants on the plate. The transformation efficiency of each edited plasmid into the DRM2 strain was calculated and compared with the transformation efficiency of each edited plasmid into the DRM1 strain.

Transformation efficiency results are shown in fig. 7, which is a graph showing the relative ratio of transformation efficiency of the edited plasmids into DRM1 and DRM2 strains, respectively, to transformation efficiency of the empty vector (pEZ15a) into the strain. Wherein wt represents the transformation efficiency of the blank vector into the DRM1 and DRM2 strains, respectively, and is set to 1.0. The experiment was repeated three times and the error bars represent the standard error of the mean. As shown in the results of fig. 7, the transformation efficiency of the three edited plasmids into the DRM2 strain is significantly improved relative to the transformation efficiency of the three edited plasmids into the DRM1 strain, and the improvement amplitude is about 100 times.

4. Transformants on the above plate were collected and colony PCR was performed using primers 10k-Chk-F and 10 k-Chk-R. And judging whether the target fragment is successfully knocked out by the edited plasmid or not according to the colony PCR result.

10k-Chk-F：GACAAGAGCGGAATCCGCGT；SEQ ID NO.14

10k-Chk-R：GAGGTAATAACCCCGCGACC；SEQ ID NO.15。

The editing efficiency is counted, and the result is shown in fig. 8, after the three editing plasmids are transformed into the DRM2 strain, the gene editing efficiency of the three editing plasmids for the target site is significantly improved, even up to 100%, compared with the editing efficiency after the three editing plasmids are transformed into the DRM1 strain. The DRM2 strain is proved to be capable of effectively improving the transformation efficiency of the edited plasmid when used for knocking out a large-fragment genome, obtaining more transformants and further greatly improving the editing efficiency.

Although K458A, R887A and D608A are three different mutation sites, the goal is to silence the helicase domain of Cas3 protein in the wild type strain, so that the wild type strain is converted into endonuclease with single-strand cleavage activity. The fundamental principle of the technical effect (improving the transformation efficiency of editing plasmids and successfully knocking out large-fragment genome) is that the single-strand cleavage characteristic of the modified Cas3 protein is utilized, so that the method is different from the traditional method of directly cutting off a DNA double strand, and only one cut is left. The damage to the genome of the strain to be edited is reduced, so that the conversion efficiency is improved, and the knockout of a large fragment which is difficult to realize is possible. Therefore, the engineering bacteria constructed by in-situ genome replacement at D608A can improve the transformation efficiency of the edited plasmid and successfully knock out large-fragment genome, and it can be concluded that the engineering strains constructed by the same principle for K458A and R887A can achieve the same technical effect.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> university of Hubei

<120> nCas3 single-stranded endonuclease and application thereof

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1146

<212> PRT

<213> Zymomonas mobilis (Zymomonas mobilis)

<400> 1

Met Asn Val Leu Phe Val Ser Gln Cys Asp Asn Asn Ala Leu Lys Glu

1 5 10 15

Thr Arg Arg Ile Leu Asp Gln Phe Ala Glu Arg Lys Gly Ser Arg Ser

20 25 30

Trp Gln Thr Pro Ile Thr Gln Ile Gly Leu Ala Thr Val Gln Lys Leu

35 40 45

Leu Arg Lys Thr Ala Arg Arg Asn Thr Ser Val Ala Cys His Trp Leu

50 55 60

His Gly Gly Gly Gln Cys Asp Leu Leu Trp Ile Val Gly Asp Ala Ser

65 70 75 80

Arg Phe Asn Asn Glu Gly Ala Val Pro Thr Asn Ser Thr Thr Arg Asn

85 90 95

Ile Leu Arg Gln Gln Asp Glu Asn Asp Trp Ile Thr Ala Glu Asp Ile

100 105 110

Gln Met Leu Ala Gln Met Ala Ala Leu Leu His Asp Leu Gly Lys Ala

115 120 125

Ser Lys Ala Phe Gln Arg Arg Leu Gln Ser Arg Glu Lys Ser Arg Asn

130 135 140

Leu Tyr Arg His Glu Trp Val Ser Leu Arg Leu Phe Gln Ala Phe Val

145 150 155 160

Gly Glu Asp Thr Asp Glu Val Trp Leu Thr Arg Leu Leu Glu Gly Asn

165 170 175

Tyr Ser Ile Lys Asp Trp Val Ala Lys Lys Arg Tyr Lys Lys Asp Gly

180 185 190

Val Asp Ala Leu Asn Gly Glu Asp Cys Tyr Pro Phe Lys Ser Leu Pro

195 200 205

Pro Leu Ala Ala Ala Ile Gly Trp Leu Ile Val Ser His His Arg Ile

210 215 220

Pro Leu Leu Pro Val Tyr Ile Glu Lys Lys Asp Arg Arg Glu Gln Ala

225 230 235 240

Tyr Leu Gly Lys Lys Pro Gln Ser Val Arg Leu Gly Ile Leu Thr Asp

245 250 255

Pro Leu Asn Lys Ile Thr Ser Leu Trp Asn Glu Ile Thr Asp Asn Gln

260 265 270

Ala Ser Pro Ala Gln Ile Lys Ala Tyr Trp Asp Ile Asp Lys Lys Glu

275 280 285

Lys Phe Pro Val Leu Leu Pro Glu Trp Gln Lys Gln Ala Ser Arg Ile

290 295 300

Ala Lys Arg Leu Leu Ala Leu Ala Lys Lys Lys Asp Ile Gly Lys Asn

305 310 315 320

Gly Leu Asp Asn Pro Tyr Leu Met His Leu Ala Arg Leu Ser Leu Met

325 330 335

Leu Ala Asp His Tyr Tyr Ser Ser Leu Pro Pro Glu Ser Lys Asp Arg

340 345 350

Met Ala Ala Thr Lys Glu Leu Ser Tyr Ser Gly Asp Asp Phe Leu Tyr

355 360 365

Ala Asn Thr Asp Ser Gln Gly Glu Arg Lys Gln Gly Leu Ser Glu His

370 375 380

Leu Leu Gly Val Ala Arg Asp Ala Gly Ile Ile Ala His Ala Leu Pro

385 390 395 400

Asn Phe Ser Glu Tyr Leu Pro Arg Leu Ala Lys His Lys Gly Leu Lys

405 410 415

Lys Arg Ser Gln Asn Pro Arg Phe Ser Trp Gln Asp Lys Ala Ala Asp

420 425 430

Met Ala Thr Ala Leu Arg Glu Lys Thr Glu Arg Gln Gly Ala Phe Cys

435 440 445

Val Cys Met Ala Ser Thr Gly Thr Gly Lys Thr Leu Ala Ser Ala Arg

450 455 460

Ile Ile Asn Ala Met Ala Asn Pro Glu Lys Gly Met Arg Leu Thr Tyr

465 470 475 480

Ala Leu Gly Leu Arg Ala Leu Thr Leu Gln Thr Gly Lys Ser Tyr Gln

485 490 495

Lys Asp Leu His Leu Asn Asp Asn Asp Leu Ala Ile Leu Val Gly Gly

500 505 510

Ser Ala Ser Lys Thr Leu Phe Asp Tyr Tyr Ser Asp Lys Ala Glu Glu

515 520 525

Ser Gly Ser Ala Ser Ser Leu Asp Leu Leu Glu Glu Asp Ser Tyr Ile

530 535 540

Ser Tyr Glu Gly Cys Glu Ala Ser His Pro Leu Leu Ser Arg Leu Gly

545 550 555 560

His Asp Pro Arg Ile Arg Ser Leu Leu Ser Ala Pro Val Leu Val Cys

565 570 575

Thr Val Asp His Leu Val Pro Ala Thr Glu Ser Leu Arg Gly Gly Arg

580 585 590

Gln Ile Ala Pro Met Leu Arg Leu Met Gly Ala Asp Leu Val Leu Asp

595 600 605

Glu Leu Asp Asp Tyr Asp Leu Lys Asp Leu Pro Ala Leu Thr Arg Leu

610 615 620

Val Tyr Trp Ala Gly Leu Leu Gly Ser Arg Val Leu Leu Ser Ser Ala

625 630 635 640

Thr Leu Pro Pro Ser Leu Val Ser Gly Met Tyr Gln Ala Tyr Leu Ala

645 650 655

Gly Arg Lys Cys Tyr Gln Leu Asn His Asp Pro Ser Leu Ser Leu Ala

660 665 670

Ala Gln Asp Ile Pro Cys Leu Trp Ile Asp Glu Phe Gly Thr Thr His

675 680 685

Ala Asp Cys Ala Asp Ala Asn Gln Phe Glu Gln Ala His Asp Asp Phe

690 695 700

Val Lys Arg Arg Lys Gln Lys Leu Leu Lys Ser Asp Ala Ile Cys Lys

705 710 715 720

Gly Glu Ile Val Pro Leu Asp Glu Val Val Gly Thr Pro Asp Asp Lys

725 730 735

Val Leu Tyr Lys Asn Phe Ala Ser Ile Leu Arg Lys Thr Ala Leu Asp

740 745 750

Leu His Glu Gly Phe Ala Glu Lys Asp Pro Ile Thr Gly Arg Lys Val

755 760 765

Ser Phe Gly Leu Ile Arg Met Ala Asn Ile Glu Pro Leu Phe His Val

770 775 780

Ala Lys Asp Phe Phe Ala Leu Gly Gly Arg Arg Asp Thr His Ile His

785 790 795 800

Leu Cys Val Tyr His Ala Arg Phe Pro Leu Ile Gln Arg Ser Ala Ile

805 810 815

Glu Asn Met Leu Asp Arg Val Leu Asn Arg Arg Glu Ala Asp Phe Val

820 825 830

Tyr His His Ala Asp Ile Arg Glu Ile Leu Asp Asn Asn Pro Glu Gln

835 840 845

Asp His Ala Phe Ile Ile Leu Ala Ser Pro Val Cys Glu Val Gly Arg

850 855 860

Asp Trp Asp Leu Asp Trp Ala Ile Thr Glu Pro Ser Ser Met Arg Ala

865 870 875 880

Leu Ile Gln Leu Ala Gly Arg Val Gln Arg His Arg Arg Lys Ser Ala

885 890 895

Glu Lys Pro Asn Ile Ala Ile Leu Asn Thr Ala Leu Arg Tyr Phe Lys

900 905 910

Asn Pro Ala Gly Ala Val Phe Trp His Pro Gly Phe Glu Lys Pro Lys

915 920 925

Thr Pro Tyr Gly Asp Asn Arg Phe Tyr Leu Glu Asn His Trp Leu Ser

930 935 940

Lys Ile Leu Arg Pro Glu Glu Tyr Lys Ile Ile Thr Ala Leu Pro Arg

945 950 955 960

Ile Ala Pro Gln Pro Lys Glu Glu Arg His Ser Gln Glu Arg Met Ser

965 970 975

Asp Leu Glu Gln Ala Arg Ile Cys Glu Ser Met Leu Pro Glu Lys Asn

980 985 990

Leu Gly Glu Val Val Gly Gly Ser Ser Arg Ser Pro Lys Lys Leu Glu

995 1000 1005

Pro Lys Glu Glu Met Ala Ala Leu Cys Trp Gln Tyr Pro Gln Ala Ser

1010 1015 1020

Leu Thr Gly Val Leu Pro Gln Trp Gln Pro Phe Arg Glu Lys Thr Leu

1025 1030 1035 1040

Arg Glu Glu Thr Leu Leu Phe Leu Pro Asp Glu Asp Gly Glu Lys Leu

1045 1050 1055

Glu Leu Tyr Gln Glu Tyr Lys Asn Pro Glu Asn Ser His Asn Pro Tyr

1060 1065 1070

Ile Leu Val Glu Arg Glu Lys Lys His Pro Val Glu Ile Asp Tyr Gly

1075 1080 1085

Ser Asp Ile Thr Ala Trp Gln Ala Asp Ser Leu Glu Asn Leu Leu Glu

1090 1095 1100

Glu Gln Ser Glu Asn Leu Gly Ile Ser Leu Tyr Lys Cys Ala Glu Tyr

1105 1110 1115 1120

Met Thr Lys Val Asn Val Leu Glu Ser Ile Ser Gly Tyr Asn Tyr Asn

1125 1130 1135

Asp Ile Leu Gly Phe Ser Arg Tyr His Ser

1140 1145

<210> 2

<211> 3441

<212> DNA

<213> Zymomonas mobilis (Zymomonas mobilis)

<400> 2

atgaatgttc tattcgtttc gcaatgcgac aacaatgctc tgaaagaaac tcggcgaatc 60

cttgatcagt ttgctgaacg gaagggaagt cgaagctggc aaacgcctat cacgcaaata 120

ggcttggcta ctgttcaaaa attattgaga aaaacagcaa ggcgaaatac ttctgttgcc 180

tgtcattggt tacatggggg tgggcagtgt gatttacttt ggatagttgg ggacgccagc 240

cgttttaata atgaaggcgc tgtcccgacc aatagcacta cccgaaatat tttacgccaa 300

caggatgaaa atgattggat aactgctgaa gatattcaga tgttggcgca aatggctgct 360

ttgttgcatg atttaggaaa ggccagcaaa gcttttcaaa ggcgtctgcg gtcaagagaa 420

aaatctcgca atttataccg tcatgaatgg gtttctttac ggttatttca ggctttcgtc 480

gggggggata cggatgaggt ctggctaacc cgtctgttag aaggcaacta ttcaataaaa 540

gactgggtgg cgaaaaaacg gtataaaaaa gatggagtcg atgccttgaa tggtgaagac 600

tgttatcctt ttaaatcttt accgcctttg gcggcggcga ttgggtggtt aatcgtttct 660

catcatcgta ttccgttgct gcctgtttat attgataaaa aagaccgtag ggaacaggcc 720

tatttgggta aaaaaaccca atcggtaaga cttgggattc tcaaagatcc attagataag 780

ataacctctt tatggaatga aataaccgaa aatggggctt cctcatctaa ggtaaaagac 840

tattgggata ttgacaaaaa agaaaaattt ccggttttgt taccggaatg gcaaaaacag 900

gcttccagaa tagcgaagcg tttattggct ttgaacaaga agaaagacat ccaaaaaaac 960

gggcttgata atccttatct tatgcatttg gcacgtttga gtctgatgtt ggcggatcac 1020

tattattcga gtcttcctcc ggaatcaaaa gaccggatat ccgctgccaa agaattatct 1080

tctagcggag atgattttct ttatgccaac acagacagtc aaggtgagcg gaaacaaggc 1140

ttgagtgagc atctattggg tgtggcaaga gatgccggaa ttatcgccca tgctttgccg 1200

aatttttccg aatatttgcc ccgtttagcc aaacataaag gattaaagaa gagaagccag 1260

aacccccgtt tttcgtggca ggataaggct gctgatatgg cgatagccct gcgcgaaaaa 1320

accgaaaggc aaggagcttt ctgtgtctgt atggcctcta cgggaacagg aaaaactctt 1380

gctagtgctc gtattatcaa tgccatggcc aaccctgaaa aagggatgcg tctgacctat 1440

gcgttgggat tgagaacact cactttgcaa accggaaaat cttatcaaaa agatttacat 1500

ctgaatgaca atgatctggc tattttagtt ggaggaagtg ccagtaaaac cctatttgac 1560

tattattcag ataaggctga agaatccggt tcagcttcct ctttggatct attggaagaa 1620

gatagctata tttcatatga aggctgtgaa gccagccatc ctttattgag ccgtttgggg 1680

catgatccta gaatacgaag ccttttatcc gcaccagttc tggtttgtac cgttgatcat 1740

ctggttcctg cgaccgaatc tttgcggggc gggcgacaaa tcgcacccat gctgcgtttg 1800

atgggggctg atctcgtttt agatgaattg gatgattatg atttgaagga tttacccgcc 1860

ttaactcgat tggtctattg ggcaggtctg ttgggtagtc gtgttttatt gtcttcagcc 1920

acattaccgc cttccttggt ttcgggtatg tatcaggctt atcttgccgg tcggaaatgc 1980

tatcaattaa atcatgaccc tagtctatct ctggcagcgc aggatatccc ttgtttgtgg 2040

atagacgaat ttggaactac tcatgctgat tgtgctgatg ccaatcagtt tgagcaggcg 2100

catgatgatt ttgtaaagcg gcgtaagcag aagcttttga aaagtgaagc tatctgtaaa 2160

ggcgaaatcg tgcctttgga tgaggtggtt ggaacgccag acgataaggc attatataaa 2220

aattttgctt caatattacg caagactgcc ttggatttgc atgaaggctt tgctgaaaaa 2280

gacccgatta caggaagaaa agttagtttc ggtctgatca gaatggctaa tattgaaccg 2340

ctatttcatg tcgcaaaaga tttttttgcc ttaggtggtc gccgtgatac gcatatccat 2400

ttatgtgtct accatgcgcg tttccctcta atccagcgtt cagctatcga aaatatgctg 2460

gatagggtgc tgaatcgccg cgaggctgac tttgtctatt atcatgcgga tatccgagag 2520

attttggata acaatccaga acaggatcac gcctttatta tattagcatc gcctgtttgc 2580

gaggtagggc gtgattggga tttggattgg gcgattaccg agccttcttc tatgcgcgcg 2640

ctcatccaat tggcagggcg tgtccagcga catagaagaa aagctgctca gaaaccgaat 2700

atcgctattt tgaatactgc tttgcgttat tttaaaaatc ctgctggggc tgtcttctgg 2760

catccgggat tcgaaaaacc taaaacacca tatggcgata atcgattcta tcttgaaaac 2820

cattggttaa gcgaaatttt aagaccagaa gaatataaaa ttattacagc tttgcctcga 2880

atagcgccct tacccaaaga agagcggcat agccaagaaa gaatgtctga tctggaacaa 2940

gcgcgtattt gtgaatctat gttgccagag aaaaaccttg gagaagttgt gggggggagt 3000

agccgttctc ccaaaaaagt ggaaccaaaa gaggaaatgg cagctctttg ttggcaatat 3060

ccgcaggcta gtctgacggg tgttttgccc caatggcagc catttagaga aaaaacctta 3120

agagaagaga cccttctatt tttacctgac gaagatggcg atgggttaga actttatcag 3180

gaaaataaga atcccgaaaa tagtcataat ccgtatattc ttgttgaacg ggaaaaaaaa 3240

catcaggtcg aaattgatta tggttcagat ataaccgcat ggcaggctga taatcttgaa 3300

aatttattag aaaagcagtc tgaaaatctt ggtatttctc tgtataagtg tgctgaatat 3360

atgacaaaag taaatgtttt agaaaataca tctggatata attataatga tattcttgga 3420

ttttccagat atcatagtta a 3441

<210> 3

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctttaagaag gagatatacc atatgaatgt tctattcgtt tcgc 44

<210> 4

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gatctcagtg gtggtggtgg tggtgactat gatatctgga aaatc 45

<210> 5

<211> 60

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cuuagaaacc uggcggcucc cucgugcgcu cuccuguucc guucacugcc gcacaggcag 60

<210> 6

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gaaagaatct ttgcggggcg ggcgacaaat cgcacc 36

<210> 7

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gaacggtgcg atttgtcgcc cgccccgcaa agattc 36

<210> 8

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aggtcaccag ctcaccgtct gaattcatga atgttctatt cgtttc 46

<210> 9

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cttttaaatc ataatcatcc aattcagcta aaacgagatc agccccc 47

<210> 10

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gctgaattgg atgattatga tttaaaagat ttacccgcct taactcg 47

<210> 11

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ctcgagagat ctgatatcac tctagattaa ctatgatatc tggaaa 46

<210> 12

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gatcacggaa attatttggc ttatggcctt ggtgctactg cgac 44

<210> 13

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gaagacatcc aaggcggcgg cattaccgac aacatctata tcaaaatttt c 51

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gacaagagcg gaatccgcgt 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gaggtaataa ccccgcgacc 20

<210> 16

<211> 32

<212> DNA

<213> Zymomonas mobilis (Zymobacter palmae)

<400> 16

ttcaaatcat aatcatccaa ttcatctaaa ac 32

<210> 17

<211> 3441

<212> DNA

<213> Zymomonas mobilis (Zymobacter palmae)

<400> 17

atgaatgttc tattcgtttc gcaatgcgac aacaatgctc tgaaagaaac tcggcgaatc 60

cttgatcagt ttgctgaacg gaagggaagt cgaagctggc aaacgcctat cacgcaaata 120

ggcttggcta ctgttcaaaa attattgaga aaaacagcaa ggcgaaatac ttctgttgcc 180

tgtcattggt tacatggggg tgggcagtgt gatttacttt ggatagttgg ggacgccagc 240

cgttttaata atgaaggcgc tgtcccgacc aatagcacta cccgaaatat tttacgccaa 300

caggatgaaa atgattggat aactgctgaa gatattcaga tgttggcgca aatggctgct 360

ttgttgcatg atttaggaaa ggccagcaaa gcttttcaaa ggcgtctgcg gtcaagagaa 420

aaatctcgca atttataccg tcatgaatgg gtttctttac ggttatttca ggctttcgtc 480

gggggggata cggatgaggt ctggctaacc cgtctgttag aaggcaacta ttcaataaaa 540

gactgggtgg cgaaaaaacg gtataaaaaa gatggagtcg atgccttgaa tggtgaagac 600

tgttatcctt ttaaatcttt accgcctttg gcggcggcga ttgggtggtt aatcgtttct 660

catcatcgta ttccgttgct gcctgtttat attgataaaa aagaccgtag ggaacaggcc 720

tatttgggta aaaaaaccca atcggtaaga cttgggattc tcaaagatcc attagataag 780

ataacctctt tatggaatga aataaccgaa aatggggctt cctcatctaa ggtaaaagac 840

tattgggata ttgacaaaaa agaaaaattt ccggttttgt taccggaatg gcaaaaacag 900

gcttccagaa tagcgaagcg tttattggct ttgaacaaga agaaagacat ccaaaaaaac 960

gggcttgata atccttatct tatgcatttg gcacgtttga gtctgatgtt ggcggatcac 1020

tattattcga gtcttcctcc ggaatcaaaa gaccggatat ccgctgccaa agaattatct 1080

tctagcggag atgattttct ttatgccaac acagacagtc aaggtgagcg gaaacaaggc 1140

ttgagtgagc atctattggg tgtggcaaga gatgccggaa ttatcgccca tgctttgccg 1200

aatttttccg aatatttgcc ccgtttagcc aaacataaag gattaaagaa gagaagccag 1260

aacccccgtt tttcgtggca ggataaggct gctgatatgg cgatagccct gcgcgaaaaa 1320

accgaaaggc aaggagcttt ctgtgtctgt atggcctcta cgggaacagg aaaaactctt 1380

gctagtgctc gtattatcaa tgccatggcc aaccctgaaa aagggatgcg tctgacctat 1440

gcgttgggat tgagaacact cactttgcaa accggaaaat cttatcaaaa agatttacat 1500

ctgaatgaca atgatctggc tattttagtt ggaggaagtg ccagtaaaac cctatttgac 1560

tattattcag ataaggctga agaatccggt tcagcttcct ctttggatct attggaagaa 1620

gatagctata tttcatatga aggctgtgaa gccagccatc ctttattgag ccgtttgggg 1680

catgatccta gaatacgaag ccttttatcc gcaccagttc tggtttgtac cgttgatcat 1740

ctggttcctg cgaccgaatc tttgcggggc gggcgacaaa tcgcacccat gctgcgtttg 1800

atgggggctg atctcgtttt agctgaattg gatgattatg atttgaagga tttacccgcc 1860

ttaactcgat tggtctattg ggcaggtctg ttgggtagtc gtgttttatt gtcttcagcc 1920

acattaccgc cttccttggt ttcgggtatg tatcaggctt atcttgccgg tcggaaatgc 1980

tatcaattaa atcatgaccc tagtctatct ctggcagcgc aggatatccc ttgtttgtgg 2040

atagacgaat ttggaactac tcatgctgat tgtgctgatg ccaatcagtt tgagcaggcg 2100

catgatgatt ttgtaaagcg gcgtaagcag aagcttttga aaagtgaagc tatctgtaaa 2160

ggcgaaatcg tgcctttgga tgaggtggtt ggaacgccag acgataaggc attatataaa 2220

aattttgctt caatattacg caagactgcc ttggatttgc atgaaggctt tgctgaaaaa 2280

gacccgatta caggaagaaa agttagtttc ggtctgatca gaatggctaa tattgaaccg 2340

ctatttcatg tcgcaaaaga tttttttgcc ttaggtggtc gccgtgatac gcatatccat 2400

ttatgtgtct accatgcgcg tttccctcta atccagcgtt cagctatcga aaatatgctg 2460

gatagggtgc tgaatcgccg cgaggctgac tttgtctatt atcatgcgga tatccgagag 2520

attttggata acaatccaga acaggatcac gcctttatta tattagcatc gcctgtttgc 2580

gaggtagggc gtgattggga tttggattgg gcgattaccg agccttcttc tatgcgcgcg 2640

ctcatccaat tggcagggcg tgtccagcga catagaagaa aagctgctca gaaaccgaat 2700

atcgctattt tgaatactgc tttgcgttat tttaaaaatc ctgctggggc tgtcttctgg 2760

catccgggat tcgaaaaacc taaaacacca tatggcgata atcgattcta tcttgaaaac 2820

cattggttaa gcgaaatttt aagaccagaa gaatataaaa ttattacagc tttgcctcga 2880

atagcgccct tacccaaaga agagcggcat agccaagaaa gaatgtctga tctggaacaa 2940

gcgcgtattt gtgaatctat gttgccagag aaaaaccttg gagaagttgt gggggggagt 3000

agccgttctc ccaaaaaagt ggaaccaaaa gaggaaatgg cagctctttg ttggcaatat 3060

ccgcaggcta gtctgacggg tgttttgccc caatggcagc catttagaga aaaaacctta 3120

agagaagaga cccttctatt tttacctgac gaagatggcg atgggttaga actttatcag 3180

gaaaataaga atcccgaaaa tagtcataat ccgtatattc ttgttgaacg ggaaaaaaaa 3240

catcaggtcg aaattgatta tggttcagat ataaccgcat ggcaggctga taatcttgaa 3300

aatttattag aaaagcagtc tgaaaatctt ggtatttctc tgtataagtg tgctgaatat 3360

atgacaaaag taaatgtttt agaaaataca tctggatata attataatga tattcttgga 3420

ttttccagat atcatagtta a 3441

Claims (7)

1. An nCas3 single-stranded endonuclease characterized by: the nCas3 single-strand endonuclease is nCas3 protein which initiates mutation on a helicase functional domain of wild-type Cas3 protein, enables the wild-type Cas3 protein to lose helicase activity and only has single-strand nuclease activity;

the amino acid sequence of the wild-type Cas3 protein is shown as SEQ ID NO. 1;

the nCas3 single-stranded endonuclease is K458A, or D608A, or R887A;

the amino acid sequence of K458A differs from that of SEQ ID NO.1 only by replacing the "K" at position 458 with an "A";

the amino acid sequence of D608A is different from that of SEQ ID NO.1 only in that "D" at position 608 is replaced with "A";

the amino acid sequence of R887A differs from that of SEQ ID NO.1 only by replacing the "R" at position 887 with an "A".

2. The nCas3 single-stranded endonuclease of claim 1, wherein: the nucleotide sequence of the wild-type Cas3 protein is shown as SEQ ID NO. 2;

the nucleotide sequence of K458A differs from that of SEQ ID NO.2 only by replacing "aa" at position 1372-1373 with "gc";

the nucleotide sequence of D608A is different from that of SEQ ID NO.2 only in that "a" at position 1823 is replaced by "c";

the nucleotide sequence of R887A differs from that of SEQ ID NO.2 only by replacing "cg" at position 2659-2660 with "gc".

3. A transformant, characterized in that: a nucleotide sequence comprising an nCas3 single-stranded endonuclease as set forth in claim 2.

4. The transformant according to claim 3, wherein: the transformant comprises any one of a recombinant vector, an expression cassette, a transgenic cell and a recombinant bacterium.

5. The transformant according to claim 4, wherein: the recombinant vector comprises at least one promoter.

6. Use of an nCas3 single-stranded endonuclease of claim 1 for cleaving single strands of DNA.

7. Use of an nCas3 single-stranded endonuclease of claim 1 in gene editing.

Images