CN113512562B - Method for improving plant stress resistance and yield by heterogeneously synthesizing gamma-polyglutamic acid in plant - Google Patents

Method for improving plant stress resistance and yield by heterogeneously synthesizing gamma-polyglutamic acid in plant Download PDF

Info

Publication number
CN113512562B
CN113512562B CN202110465460.1A CN202110465460A CN113512562B CN 113512562 B CN113512562 B CN 113512562B CN 202110465460 A CN202110465460 A CN 202110465460A CN 113512562 B CN113512562 B CN 113512562B
Authority
CN
China
Prior art keywords
corn
gamma
transgenic
callus
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110465460.1A
Other languages
Chinese (zh)
Other versions
CN113512562A (en
Inventor
夏涛
马海珍
李�灿
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qilu University of Technology
Original Assignee
Qilu University of Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qilu University of Technology filed Critical Qilu University of Technology
Priority to CN202110465460.1A priority Critical patent/CN113512562B/en
Priority to CN202210561451.7A priority patent/CN115725519A/en
Priority to PCT/CN2021/091993 priority patent/WO2022227102A1/en
Publication of CN113512562A publication Critical patent/CN113512562A/en
Application granted granted Critical
Publication of CN113512562B publication Critical patent/CN113512562B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
    • A01H4/001—Culture apparatus for tissue culture
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
    • A01H4/008—Methods for regeneration to complete plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
    • C12N9/0016—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4) with NAD or NADP as acceptor (1.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
    • C12Y104/01—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with NAD+ or NADP+ as acceptor (1.4.1)
    • C12Y104/01013—Glutamate synthase (NADPH) (1.4.1.13)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
    • C12Y104/01—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with NAD+ or NADP+ as acceptor (1.4.1)
    • C12Y104/01014—Glutamate synthase (NADH) (1.4.1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
    • C12Y104/07—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with an iron-sulfur protein as acceptor (1.4.7)
    • C12Y104/07001—Glutamate synthase (ferredoxin) (1.4.7.1)

Abstract

The invention discloses a method for improving the stress resistance and yield of plants by heterogeneously synthesizing gamma-polyglutamic acid in plants, which clones 3 key enzyme genes PgsA, PgsB and PgsC of gamma-PGA from a strain for producing the gamma-PGA, resynthesizes the gene sequences of the PgsA, the PgsB and the PgsC after codon optimization according to the codon preference in the plants, and links the gene sequences into a vector pU130-bar to obtain a plant expression vector PGA001, and transfers the gene sequences into the plants through agrobacterium mediation to obtain a new strain of transgenic plants for producing the gamma-polyglutamic acid. Experiments prove that the new strain transgenic corn obtained by the method not only can improve the drought resistance, but also can improve the salt resistance, and can obviously improve the biomass of the corn under the drought stress condition and the normal growth condition. The results indicate that the method is an effective way for solving the problem of stable yield or less yield reduction of crops under the stress of drought, water shortage and salt and alkali, is green, efficient and sustainable, and can be widely applied to drought resistance and salt tolerance molecular breeding and new variety cultivation of plants.

Description

Method for improving plant stress resistance and yield by heterogeneously synthesizing gamma-polyglutamic acid in plant
Technical Field
The invention relates to a method for improving the stress resistance and yield of plants, in particular to a method for improving the stress resistance and yield of plants by heterogeneously synthesizing gamma-polyglutamic acid in the plants, belonging to the technical fields of genetic engineering, genetic breeding and synthetic biology.
Background
Abiotic stresses such as drought and soil salinization have become major limiting factors in crop production in many countries and regions of the world. In china, about half of the territory area is in arid and semi-arid regions. With the rise of global temperature, the shortage of water resources in China is increased, and the influence of drought on the crop yield is increased. In addition, soil salination is also a major environmental factor affecting crop yield. At present, about 20 percent of cultivated land and nearly 50 percent of irrigation land in the world are seriously damaged by salinization, and the salinized land in China accounts for about 10 percent of the global salinized soil area. The novel drought-resistant and salt-resistant high-quality and high-yield crop variety cultivated by the modern biological technology has important strategic significance, and is an important choice for improving the crop yield and guaranteeing the grain safety and the agricultural sustainable development. The development of high-quality genes with stress resistance and high yield and the transformation of crops through transgenic engineering are effective ways for avoiding the yield reduction under the stress condition.
The plant transgenic technology has wide application, and is mainly applied to the aspects of insect resistance, herbicide resistance, stress resistance, yield improvement and the like. With the approval of commercial planting of the first transgenic insect-resistant maize in the united states in 1995, more and more transgenic crops are beginning to be grown for large-area promotion in the united states, brazil and other countries.
At present, most of the international researches on transgenic drought-resistant crops come from genes related to synthesis of osmoregulation substances, transcription factors, related genes in a stress-resistant signal transduction pathway and the like, and also from genes related to aquaporin genes, chaperonin genes, related enzymes in an ABA synthesis pathway and the like. For example, in 2007, Qin et al over-expressed the transcription factor ZmDREB2A in maize significantly improved the maize ability to withstand drought and high temperatures; in 2010, Zhang and the like transfer a transcription factor TsCBF1 in Thellungiella halophila into corn so as to improve the drought resistance of the corn; the drought resistance of the corn is improved by transferring the enzymes GSMT2, DMT2 and betA A in the synthesis path of the bacterial osmoregulation substances betaine into the corn; the HAV1 gene of LEA protein family from barley is introduced into corn, so that the drought resistance of the corn is remarkably improved; the ZmCIPK2 can obviously improve the drought resistance of the corn after being over-expressed in the corn as a protein kinase in a signal path for responding to the stress; the arabidopsis LOS5 gene is heterologously expressed in the corn, so that the ABA content and the drought resistance in the corn can be obviously improved.
Research reports indicate that salt stress signaling pathways can be largely divided into osmotic and ionic balance signaling pathways, cellular injury and repair, and growth regulation processes. To date, many key stress tolerance genes involved in osmoprotectant synthesis, ion balance, reactive oxygen species scavenging, and transcription factors have been cloned and all of these genes have improved stress tolerance in transgenic plants to varying degrees. For example, after a CMO (choline monooxygenase) gene for synthesizing betaine is transferred into tobacco, the salt resistance of the tobacco can be remarkably improved (Wu et al, 2010); overexpression of Arabidopsis AtSOS1 significantly improved the salt tolerance of transgenic plants (Qiu et al, 2002; Shi et al, 2003); overexpression of Arabidopsis thaliana tonoplast Na+/H+The reverse transport protein (AtNHX1) gene can obviously improve the salt resistance of transgenic arabidopsis and tomato (Zhang and Blumwald, 2001; Zhang et al, 2001); the salt resistance of the transgenic plant can be obviously improved by over-expressing Arabidopsis ANAC019, ANAC055 and ANAC072/RD 26; overexpression of Arabidopsis H in Cotton+The PPase gene AtAVP1 increases the salt tolerance and drought resistance of the transgenic cotton (Pasapula et al, 2011); TsVP transgenic maize can significantly improve drought and salt tolerance of maize (wei et al, 2008). The research results show that although many plant salt-tolerant genes are cloned and expressed, the plant salt-tolerant genes are mainly concentrated in model plants such as arabidopsis, tobacco and tomato, and are not widely applied to crops.
Most of the reported transgenic stress-resistant corns are transformed with a single functional gene, and although some stress resistance of the corns is improved, few or no reports are made on the simultaneous improvement of the yield of the corns under the normal growth environment. Therefore, it is a focus to screen genes that can enhance crop stress resistance and maintain high yield under both normal and stress conditions.
Gamma-polyglutamic acid (gamma-PGA), a microbial fermentation product, was first found in natto. The gamma-PGA is prepared by dehydrating and condensing L-glutamic acid and D-glutamic acid, has straight-chain molecules, contains a large number of amido bonds and free carboxyl groups, is an anionic polymer, and is a white odorless powdery solid. Because gamma-PGA has the characteristics of good ductility, flexibility, biocompatibility, adhesiveness, stability, moisture retention, water absorbability, oxygen resistance, film forming property, biodegradability and the like, the gamma-PGA is a biodegradable high polymer material with great development potential, is widely applied to a plurality of fields of medicine, food, cosmetics, feed, agriculture, environmental protection and the like, and is a well-known green chemical product with great development potential.
In the agricultural field, a great deal of research finds that the gamma-PGA can be used as a synergist of pesticides and fertilizers, promotes the growth of crops under the condition of low nutrient, is beneficial to improving the vitality and the germination rate of seeds and promotes the growth and development of germs and radicles; the gamma-PGA can also improve the physicochemical and adsorption characteristics of soil, thereby promoting the absorption of plants on nutrients; the gamma-PGA has stronger adsorption property, can be used as an adsorbent or a chelating agent, has obvious chelating effect on toxic heavy metal ions in soil, and avoids crops from absorbing excessive toxic heavy metals from the soil; the gamma-PGA can also increase the biomass of the root system of the plant, thereby enhancing the absorption of the plant to nitrogen, phosphorus and potassium and promoting the growth of the plant. In addition, the gamma-PGA serving as a water-retaining agent can obviously improve the drought resistance of crops. The gamma-PGA has strong water absorbability and water retentivity due to a large amount of hydrophilic groups contained in the molecules, so that the important value of the gamma-PGA in the field of agricultural water conservation is determined.
As a novel green polymer biomaterial, although gamma-PGA has wide application prospect, the large-scale application of the gamma-PGA in agricultural production is limited due to the relatively high cost of producing the gamma-PGA by microbial fermentation. Meanwhile, as a polymer biomaterial, the ecological and environmental effects of the polymer biomaterial used in soil for a long time are lack of systematic and comprehensive research and evaluation.
Based on the prior art, the applicant clones key genes from microorganisms in the process of synthesizing gamma-polyglutamic acid, transfers the genes into plants by using synthetic biology and genetic engineering technology and taking corn as an implementation case, evaluates the expression of heterologous gamma-polyglutamic acid synthetic genes in the corn, the influence on the drought resistance, salt tolerance and yield of the corn and the improvement effect on other characters, and establishes a method for improving the stress resistance and yield of the plants by carrying out heterologous synthesis on the gamma-polyglutamic acid in the plants. The invention also measures the quality of the transgenic corn kernel, and finds that the synthesis of the gamma-PGA in the corn can improve the starch content and the amylose content in the corn kernel. Through retrieval, no report exists at present for heterogeneously synthesizing gamma-polyglutamic acid in crops and researching the influence of the gamma-polyglutamic acid on the drought resistance, the salt tolerance, the yield and the quality of the crops.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide a method for improving the stress resistance and yield of plants by heterogeneously synthesizing gamma-polyglutamic acid in the plants.
The method for improving the stress resistance and the yield of plants by heterogeneously synthesizing the gamma-polyglutamic acid in the plants comprises the following steps:
(1) cloning of the gene for synthesizing the gamma-polyglutamic acid: cloning 3 key enzyme genes PgsA, PgsB and PgsC for synthesizing gamma-PGA from a strain for producing gamma-polyglutamic acid; wherein, the amino acid sequence of the GenBank ID of the gene PgsA is shown as SEQ ID NO.1 as AIA 08848.1; the Genebank ID of the gene PgsB is AIA08846.1, and the amino acid sequence of the gene PgsB is shown as SEQ ID NO. 2; the Genebank ID of the gene PgsC is AIA08847.1, and the amino acid sequence of the gene PgsC is shown as SEQ ID NO. 3;
(2) codon optimization: finally determining optimized sequences by codon preference analysis in maize or other plants to be transgenic in accordance with the amino acid sequences of the PgsA, PgsB, PgsC genes and in combination with CpG nucleotides content, GC content, mRNA secondary structure, Crytic splicing sites, Prematch Poly A sites, Internal chip sites and ribosomal binding sites, New CpG islands, RNA availability motive (ARE), Repeat sequences (direct Repeat, reverse Repeat, and DyDydye Repeat), research sites present map with cloning, etc., and synthesizing the optimized PgsA, PgsB, PgsC genes de novo in accordance with the sequences;
(3) constructing a plant expression vector: connecting the PgsA, PgsB and PgsC genes after codon optimization into a plant expression vector pU130-bar containing a bar gene screening marker to obtain a plant expression vector containing a target gene, and naming the plant expression vector as plant expression vector PGA 001;
(4) obtaining transgenic plants with improved plant stress resistance and yield;
the method is characterized in that:
the strain for producing the gamma-polyglutamic acid in the step (1) is Bacillus licheniformis (Bacillus licheniformis) or Bacillus amyloliquefaciens (Bacillus amyloliquefaciens);
the nucleotide sequence of the PgsA gene after codon optimization in the step (2) is shown as SEQ ID NO. 4; the nucleotide sequence of the PgsB gene after codon optimization is shown as SEQ ID NO. 5; the nucleotide sequence of the PgsC gene after codon optimization is shown as SEQ ID NO. 6;
the nucleotide sequence of the plant expression vector PGA001 in the step (3) is shown as SEQ ID NO. 7; the functional elements of the expression vector are described as follows:
Figure BDA0003043668310000031
Figure BDA0003043668310000041
the transgenic plant with the improved plant stress resistance and yield in the step (4) is transgenic corn, and the method for obtaining the transgenic corn comprises the following steps:
1) preparation of Agrobacterium Strain containing plant expression vector PGA001
Selecting EH105 agrobacterium as a transforming strain, adding 3 mul of plasmid containing PGA001 expression vector into 50 mul of agrobacterium-infected cells, carrying out ice bath for 30 minutes, carrying out quick freezing for 5 minutes by liquid nitrogen, and carrying out water bath for 5 minutes at 37 ℃; then adding 800-; taking out a bacterial liquid, coating the bacterial liquid on a solid YEP culture medium containing rifampicin and kanamycin, placing the bacterial liquid in dark for inverted culture at 25-28 ℃ for 3-4 days, taking bacterial colonies for colony PCR verification, sequencing, and storing agrobacterium tumefaciens with correct sequencing for transformation;
2) preparation of callus
Selecting a maize inbred line KN5585 as a receptor inbred line, taking ears of 10-12d maize after pollination, removing bracts, processing for 5-6min by 70% alcohol in an aseptic workbench, washing for 4-5 times by using sterile water, stripping 1.5-2mm of young embryos, upwards placing scutellum on a young embryo induction culture medium, and culturing and inducing callus in the dark at 28 ℃; 2-3 weeks later, selecting embryogenic callus with high growth speed, soft texture, loose and fragile texture and bright color from the induced callus, transferring the embryogenic callus to a subculture medium for subculture, and subculturing once every 2 weeks for agrobacterium infection;
3) infection with Agrobacterium
Selecting an agrobacterium tumefaciens single colony containing a PGA001 expression vector, adding the agrobacterium tumefaciens single colony into 5-6mL of YEP (YEP) (Kan) culture medium, and culturing overnight; centrifuging at room temperature at 5000-; suspending the thallus in infection solution containing Acetosyringone (AS), and making OD600Mixing 0.6-0.8% of the powder; activating the prepared staining solution at 25-28 deg.C and shaking table at 180rpm for 1-2 hr for staining; collecting embryogenic callus of corn, placing into a sterile triangular flask, pouring the invasion dye solution, scattering and shaking large callus blocks to make callus fully contact with Agrobacterium, and infecting for 15-20 min; taking out the callus, sucking the redundant bacteria liquid on filter paper, then inoculating the callus on a co-culture medium, and culturing the callus in the dark at the temperature of 19-22 ℃ for 3 days;
4) recovery culture
Washing the surface of the callus with sterile water containing antibiotic for 3-5 times, pouring out the liquid when the added water is no longer turbid, transferring the callus into a plate paved with filter paper, drying the water on the surface of the callus in a super clean bench, transferring into a recovery culture medium, and performing dark culture at 28 ℃ for 7-10 days;
5) screening culture
Transferring the transformed callus to a screening culture medium added with glufosinate-ammonium after the culture is recovered, carrying out screening culture for two weeks, then replacing a new screening culture medium, carrying out dark culture at 25-28 ℃ for 15-20 days, scattering the callus, transferring the scattered callus into the new screening culture medium, continuously screening for 2 rounds in total, and culturing for 30-40 days;
6) differentiation and rooting
Transferring the resistant callus into a differentiation culture medium, performing dark culture at 25-28 ℃ for 7-10 days, then transferring into a light incubator at 25-28 ℃ for culture, and transferring into a rooting culture medium when the regeneration bud grows to 3-5 cm;
7) selfing seed harvest after hardening and transplanting
After a large number of strong roots grow, hardening seedlings for 2-3 days, cleaning a root culture medium, transplanting the seedlings into sterilized nutrient soil, hardening seedlings indoors for 7 days, and transplanting the seedlings to a field; during the period, young leaves are taken to carry out PAT/bar protein rapid detection test strip detection, and the transgenic positive maize is selfed to harvest seeds; obtaining T1 transgenic corn plants, and strictly selfing for two generations to finally obtain transgenic corn homozygous lines.
The culture medium related to the transgenic corn method is as follows:
Figure BDA0003043668310000051
Figure BDA0003043668310000061
the invention also provides a plant expression vector capable of heterogeneously synthesizing the gamma-polyglutamic acid in plants and improving the stress resistance and yield of the plants, which is characterized in that: the plant expression vector is named as plant expression vector PGA001, and the nucleotide sequence is shown in SEQ ID NO. 7.
The invention also discloses a method for improving the stress resistance and yield of plants by utilizing the gamma-polyglutamic acid to carry out heterologous synthesis in the plants and an obtained plant transgenic line.
Wherein: the plant transgenic line is preferably a transgenic maize homozygous line; the stress resistance refers to drought resistance and salt resistance.
(5) Detection of transgenic corn:
the detection method comprises the steps of PAT/bar protein rapid detection test strip (Artron, detailed steps are shown in the specification), PCR detection, RT-PCR detection and detection of the content of the product gamma-PGA. Wherein, the detection of the content of the gamma-PGA is carried out according to the NY/T3039-2016 method.
Vacuum drying corn plant at 60 deg.C, grinding, weighing 10g of uniformly mixed sample, and respectively determining the content of free glutamic acid hydrolyzed by hydrochloric acid and unhydrolyzed free glutamic acid in the sample, wherein the difference between the two is the content of polyglutamic acid.
The results showed that three genes, PgsA, PgsB, PgsC, had been successfully transferred into maize (fig. 1) and that γ -PGA was successfully detected in maize (table 1).
(6) And (3) phenotype identification of the transgenic corn:
transgenic positive maize lines were selected for the identification of their phenotype throughout the development phase, and for the determination of yield and seed quality (starch content and amylose content).
The results show that the transgenic positive corn line has better germination rate, higher plant height and more developed root system, and show that the synthesis of gamma-PGA in the corn can promote the growth of the corn, and can improve the yield of the corn under normal conditions, mainly the grain number of the corn ear, the grain weight of the corn ear and the grain weight of the corn hundred (Table 3), and also can improve the quality of the corn grains, mainly the starch content and the amylose content (Table 4).
(7) Detecting drought resistance and salt resistance of the transgenic corn in a germination stage and a seedling stage:
drought resistance detection of transgenic corn: and (3) respectively carrying out drought stress treatment on the transgenic positive corn and the transgenic negative control corn, and researching and analyzing the phenotypes of the transgenic positive corn and the transgenic negative control corn, wherein the drought stress treatment is realized by simulating the drought treatment and the water-break drought stress treatment through PEG.
The PEG simulation drought treatment mainly selects two periods of germination period and three-leaf period, the corn culture solution selects Hogland nutrient solution (Haiboza), and the concentrations of PEG6000 selected by the drought stress treatment in the germination period are 14% and 18% respectively. The concentration of PEG6000 selected by the seedling stage simulated drought treatment is 18 percent; and in the seedling stage, the drought treatment adopts potted plant water cut-off treatment, and the physiological and biochemical indexes such as the content of free proline, soluble sugar, chlorophyll, ABA and the like are measured.
In the resistance detection of the seedling stage, firstly, the surface of a corn seed is disinfected and then germinated, then, the germinated seedling is inserted into a nutrient solution (Hogland corn nutrient solution) for culture, when the plant grows to the trefoil stage, the plant is respectively transferred into the nutrient solution containing 200mmol/L NaCl or 18% PEG for treatment, the phenotype change is observed, and the biomass is measured.
And (3) drought test: selecting transgenic corn T3 generation seeds with uniform size and wild KN5585 seeds, sowing the seeds in small plastic flowerpots with the same size, and filling equal amount of fertile soil with uniform texture in the pots. Half of each tray was seeded with transgenic material and half with wild type material, 2 grains each, 3 trays per line. Normally watering until the plantlets grow to 3 leaves, then carrying out drought stress treatment, namely stopping watering after sufficient water is watered once, restoring watering until the wild plants die, and observing the growth condition of the transgenic plants under the drought condition and the survival rate and the restoring rate after restoring watering. A method for selecting water-break treatment before flowering in field drought treatment (the implementation place is the Yunnan breeding base) comprises the following specific implementation methods: water cut off for 15 days, rehydration once, water cut off for another 15 days until harvest, adverse phenotype and yield were measured.
The results show that transgenic positive maize still can germinate well under the PEG treatment, while germination of negative control maize is obviously inhibited (figure 3). The field drought and water break test result shows that the transgenic positive corn also shows good drought resistance under the field drought condition.
The transgenic corn salt resistance research comprises a germination stage and a seedling stage: NaCl solutions with different concentrations are selected for carrying out salt stress treatment on the corns in the germination period. Selecting seeds of the transgenic positive material and the transgenic negative control material, respectively germinating the seeds on filter paper containing 150mM NaCl and 200mM NaCl solution after surface disinfection, and observing the germination condition; the seedling-stage salt resistance test adopts a solution stress treatment method: the surface of the corn seed is disinfected and transferred to nutrient solution (Hogland corn nutrient solution) for culture after germination, the corn cultured to the trilobate stage is respectively transferred to the nutrient solution containing 200mM NaCl for culture, and the phenotypic change is counted.
The results show that the germination conditions of the transgenic corn seeds are better than those of the control negative corn under the conditions of low-concentration or high-concentration NaCl stress (fig. 7-8), which indicates that the transgenic corn has better salt resistance in the germination stage, and the water culture salt resistance test results in the seedling stage also show that the transgenic positive corn has obvious salt resistance.
(8) Yield analysis of transgenic maize under normal and drought conditions
Yield analysis was performed under field conditions, including normal irrigation conditions and drought and water break conditions. The normal irrigation condition is to keep the transgenic corn and the contrast inbred line to grow under the normal natural growth condition; the drought test mainly adopts a method of water cut-off treatment before flowering, and the specific implementation method comprises the following steps: cutting off water for 15 days, rehydrating once, cutting off water for 15 days again until harvesting, and measuring the yield and the related characters of the yield (the shape of the fruit cluster, the length of the fruit cluster, the weight of the fruit cluster, the number of grains of the fruit cluster, the weight of grains of hundred grains and the like).
The results show that under drought conditions, the yield of transgenic positive maize is significantly improved. Transgenic maize was less affected by drought than under normal irrigation conditions, whereas negative control maize had significantly reduced yield under drought conditions.
The invention discloses a method for improving the stress resistance and yield of plants by heterogeneously synthesizing gamma-polyglutamic acid in the plants, and simultaneously discloses a plant transgenic line obtained by the method for improving the stress resistance and yield of plants by heterogeneously synthesizing gamma-polyglutamic acid in the plants, preferably a transgenic corn homozygous line. The experiment proves that: the obtained transgenic corn for producing the gamma-polyglutamic acid not only obviously improves the drought resistance of the corn, but also obviously improves the salt resistance of the corn, and also obviously improves the biomass of the corn under the normal growth condition. The invention has the beneficial effects that: (1) the synthesis of the gamma-polyglutamic acid in plants is creatively realized, and the gamma-polyglutamic acid can be produced in the obtained transgenic corn. (2) The evaluation of the expression of the heterologous gamma-polyglutamic acid synthetic gene in the corn, the influence on the drought resistance, the salt tolerance and the yield of the corn and the improvement effect on other characters show that the transgenic plant obtained by the method of the invention has obvious drought resistance, salt tolerance and the improvement effect on the yield, and the method is proved to be an effective way for solving the problem of stable yield or less yield reduction of crops under the stress of drought, water shortage and salt and alkali, can be widely applied to drought resistance, salt tolerance molecular breeding and new variety cultivation of plants and crops, and has wide application prospect.
Drawings
FIG. 1 shows a schematic diagram of a plant expression vector map and detection of transgenic maize.
Wherein, A: map schematic of plant expression vector PGA 001; b: PAT/bar protein rapid detection of transgenic corn, CK: negative control inbred line KN 5585; 1-9: a transgenic positive maize line; c: PCR detection result of transgenic corn bar gene; m: DNA marker; CK: negative control inbred line KN 5585; 1-9, 12, 13, 15: a transgenic positive maize line; d: RT-PCR detection results of PgsA, PgsB and PgsC genes in transgenic corn; t1, T2, T5: a transgenic positive maize line.
FIG. 2 shows the phenotype of transgenic positive maize and negative control maize inbred lines under normal growth conditions.
Wherein, A: the situation of the transgenic positive corn and the negative control corn inbred line after germination for 30h under normal conditions; wherein CK: negative control inbred line KN5585, T: a transgenic positive maize line; b: the situation that the transgenic positive corn and the negative control corn inbred line germinate for 48 hours under normal conditions; wherein CK: negative control inbred line KN5585, T: a transgenic positive maize line; c: root development conditions of the transgenic positive corns and the transgenic negative control corns; wherein CK: negative control inbred lines KN5585, T1, T2, T5: a transgenic positive maize line; d: the growth conditions of the transgenic positive corn and the negative control corn in the seedling stage under the potting condition; wherein CK: negative control inbred line KN5585, T: a transgenic positive maize line; e: the growth conditions of the transgenic positive corn and the negative control corn in the seedling stage under the potting condition; f: fruit phenotypes of transgenic positive maize and negative control maize; wherein CK: negative control inbred lines KN5585, T1, T2, T5, T6: a transgenic positive maize line.
FIG. 3 shows drought resistance detection in germination period of transgenic maize and wild type control maize inbred lines.
Figure 4 shows transgenic positive plants and negative control maize PEG simulated drought test.
Wherein, A: transgenic positive (endogenously synthesized gamma-PGA) corn, gamma-PGA exogenously treated and untreated negative control corn PEG simulation drought contrast test; b: comparing the fresh weight of the overground part of the transgenic positive (endogenously synthesized gamma-PGA) corn, the gamma-PGA exogenously treated and untreated negative control corn under the normal condition and the PEG treatment condition; c: transgenic positive (endogenously synthesized γ -PGA) maize, γ -PGA exogenously treated and untreated negative control maize were compared to the fresh weight of the lower parts under normal conditions and PEG treated conditions.
FIG. 5 shows a potted drought water-break test of transgenic maize.
Wherein, A: detecting results of the transgenic positive plants and the negative control inbred line bar gene test paper; b: drought and water-break test results of the transgenic positive corn pot culture.
FIG. 6 shows drought and water break tests and yield analysis of transgenic positive maize under field conditions.
Wherein, A: phenotype of transgenic positive corn and negative control corn after water cut off for 8 days in seedling stage; b: phenotype of transgenic positive corn and negative control corn after drought and water break for 8 days before flowering; c: analyzing the yield of the transgenic positive corn and the negative control corn under the drought condition; wherein CK: negative control inbred line KN 5585; t1, T2, T5, T6, T8, T9, T12, T13: a transgenic positive maize line.
FIG. 7 shows the detection of salt resistance in germination stage of inbred lines of transgenic maize and wild type control maize.
FIG. 8 shows the seedling-stage salt-resistance test of transgenic positive lines and negative control plants.
Wherein, CK: negative control inbred line KN 5585; t1, T2, T5: transgenic positive inbred line KN 5585.
FIG. 9 shows comparative drought and salt resistance tests of transgenic positive (endogenously synthesized γ -PGA) maize versus a wild type control maize exogenously treated with γ -PGA.
Wherein, A: comparing transgenic positive (endogenously synthesized gamma-PGA) corns with wild type control corns which are exogenously processed by the gamma-PGA corns for salt resistance; b: comparing the fresh weight of the overground parts of the transgenic positive (endogenously synthesized gamma-PGA) corn, the wild type control corn which is exogenously processed by the gamma-PGA and the wild type control corn under the normal condition and the salt stress processing condition; c: comparing the fresh weight of underground parts of transgenic positive (endogenously synthesized gamma-PGA) corns, gamma-PGA exogenously treated wild type control corns and wild type control corns under normal conditions and salt stress treatment conditions; wherein CK: negative control inbred line KN 5585; t1, T2: transgenic positive inbred line.
FIG. 10 is a schematic diagram of a map of plant expression vector pU 130-bar.
Detailed Description
The present invention will be described in detail with reference to the following detailed drawings and examples. The following examples are only preferred embodiments of the present invention, and it should be noted that the following descriptions are only for the purpose of illustrating the present invention and are not to be construed as limiting the present invention in any way, and any simple modifications, equivalent changes and modifications made to the embodiments according to the technical spirit of the present invention are within the scope of the technical solution of the present invention.
In the following examples, materials, reagents and the like used were obtained commercially unless otherwise specified.
Example 1: obtaining of amino acid sequences pgsA, pgsB and pgsC
Cloning 3 key enzyme genes PgsA, PgsB and PgsC for synthesizing gamma-PGA from a strain Bacillus licheniformis (Bacillus licheniformis) for producing gamma-polyglutamic acid by a known method; wherein, the amino acid sequence of the GenBank ID of the gene PgsA is shown as SEQ ID NO.1 as AIA 08848.1; the Genebank ID of the gene PgsB is AIA08846.1, and the amino acid sequence of the gene PgsB is shown as SEQ ID NO. 2; the gene PgsC Genebank ID of AIA08847.1 has the amino acid sequence shown in SEQ ID No. 3.
Example 2: codon optimization
According to the amino acid sequences of the obtained PgsA, PgsB and PgsC genes, the optimized sequences ARE finally determined by the codon preference analysis in corn or other plants to be transgenic and combined with CpG nucleotides, GC contents, mRNA secondary structure, Crytic splicing sites, Prematch Poly A sites, Internal chi sites and ribosomal binding sites, New CpG islands, RNA induced mobility (ARE), Repeat sequences (direct Repeat, Repeat, and dye Repeat), and recovery sites present identity interface with cloning and the like, and the optimized PgsA, PgsB and PgsC genes ARE artificially synthesized de novo according to the sequences; wherein the nucleotide sequence of the PgsA gene after codon optimization is shown as SEQ ID NO. 4; the nucleotide sequence of the PgsB gene after codon optimization is shown as SEQ ID NO. 5; the nucleotide sequence of the PgsC gene after codon optimization is shown as SEQ ID NO. 6.
Example 3: plant expression vector construction
The codon-optimized PgsA, PgsB and PgsC genes are connected into a plant expression vector pU130-bar containing a bar gene screening marker by a known method (a vector map is shown in figure 10), so as to obtain a plant expression vector containing a target gene, namely a plant expression vector PGA001, wherein the vector map is shown in figure 1; wherein the nucleotide sequence of the plant expression vector PGA001 is shown as SEQ ID NO. 7; the functional elements of the expression vector are described as follows:
Figure BDA0003043668310000101
Figure BDA0003043668310000111
the construction of the plant expression vector PGA001 adopts a multi-fragment recombinase method, and comprises the following specific construction steps:
mu.g of vector pU130-bar was digested with restriction enzymes Hindlll and Spel, reacted at 37 ℃ for 1. + -. 0.2 hours, and the digested vector product was recovered using DC301 kit (commercially available PCR gel recovery kit).
The codon-optimized PCR products of pgsA, pgsB, and pgsC in example 2 were 35S + pgsA + Tnos,35S + pgsB + Tnos, and 35S + pgsC + Tnos, and were synthesized directly by bio-companies.
Recombination is then carried out. The recombinant ligation system was as follows: the PCR products pgsA + pgsB + pgsC were synthesized in an amount of 3. mu.l each; the vector product was digested, 3. mu.l; recombinase, 2 μ l; recombinant buffer, 4. mu.l; h2O, 2. mu.l. Storing at 37 deg.C for 30min on ice or at 4 deg.C;
coli DH5 α was then transformed: mu.l of ligation product + 100. mu.l of E.coli competent.
Taking out from a competent DH5 alpha refrigerator, rapidly placing on ice, 5min later, adding ligation product when the strain mass is dissolved, standing on ice for 25min, heat shocking at 42 deg.C for 45s, standing on ice for 2min (without shaking), adding antibiotic-free LB 100 μ l, 37 deg.C, 200rpm, shaking for 1h, plating, LB + K+The cells were cultured at 37 ℃ for one day.
Then, colony PCR is carried out, and detection primers are as follows:
QC-F:GCGGCCGAGCCCCTCATCGAGAA
QC-R:GATCAGGCCCGGCACGATGATG
positive colonies were sequenced. The plasmid with correct sequencing result is used for transforming agrobacterium.
Example 4: acquisition of Gamma-PGA transgenic maize
(1) Obtaining maize embryogenic callus
Selecting a maize inbred line KN5585 as a receptor inbred line, taking ears of 10-12D maize after pollination, removing bracts, treating the ears with 70% alcohol for 5min in an aseptic workbench, washing the ears with aseptic water for 4-5 times, stripping 1.5-2mm of young embryos, placing the young embryos on an induction culture medium (MS +1mg/L2,4-D +1.38g/L L-proline +0.5g/L hydrolyzed casein +30g/L sucrose +7g/L agar, pH5.8) with scutellum upwards, and culturing the induced callus in the dark at 28 ℃. After 2-3 weeks, selecting embryogenic callus with high growth speed, soft texture, loose and fragile, and bright color from the induced callus, transferring to a subculture medium (MS +1mg/L2,4-D +0.69g/L L-proline +0.5g/L hydrolyzed casein +30g/L sucrose +7g/L agar, pH5.8) for subculture, and subculturing once every 2 weeks for agrobacterium infection.
(2) Preparation of Agrobacterium containing plant expression vector
Selecting EH105 agrobacterium as a transforming strain, adding 3 mul of plasmid containing PGA001 expression vector into 50 mul of EHA105 commercial agrobacterium competent cell (Bomaide), ice-bathing for 30 minutes, quick-freezing for 5 minutes by liquid nitrogen, and water-bathing for 5 minutes at 37 ℃; adding 800 μ l YEP liquid culture medium, and performing shaking culture at 28 deg.C and 250rpm for 3 hr; taking out a bacterial liquid, coating the bacterial liquid on a solid YEP culture medium containing rifampicin and kanamycin, placing the bacterial liquid in the dark for inverted culture for 3-4 days at the temperature of 28 ℃, taking bacterial colonies for colony PCR verification, sequencing, and storing agrobacterium tumefaciens with correct sequencing for transformation;
(3) infection and co-culture of agrobacterium
Selecting an agrobacterium tumefaciens single colony containing a PGA001 expression vector, adding the agrobacterium tumefaciens single colony into 5mL of YEP (YEP) (Kan) culture medium, and culturing overnight; centrifuging at room temperature at 6000rpm for 5min, and collecting thallus; the cells were suspended in an infecting solution (MS +1mg/L2,4-D +68.5g/L sucrose +36g/L glucose +100mM AS, pH5.2) containing 100mM Acetosyringone (AS) and OD was adjusted600Mixing 0.6-0.8% of the powder; activating the prepared staining solution for 1 hour at 25 ℃ by a shaking table at 180rpm for staining; collecting embryogenic callus of corn, placing into a sterile triangular flask, pouring infection liquid, scattering large callus blocks, shaking to make callus fully contact with Agrobacterium, and infecting for 15 min; the callus was taken out, excess bacterial solution was blotted on filter paper, and then inoculated on a co-culture medium (MS +1mg/L2,4-D +100mM AS +0.5g/L MES +20g/L sucrose +7.5g/L agar, pH5.2) and cultured in the dark at 22 ℃ for 3 days.
(4) Recovery culture and selection of resistant callus
Washing the surface of the callus with sterile water containing antibiotics for 3-5 times, pouring off the liquid when the added water is no longer turbid, transferring the callus into a plate paved with filter paper, and drying the water on the surface of the callus in a super clean bench. Transferring into recovery culture medium (MS +1mg/L2,4-D +0.69g/L L-proline +0.5g/L hydrolyzed casein +20g/L sucrose +250mg/L cephamycin +7.5g/L agar, pH5.8), and dark culturing at 28 deg.C for 7-10 days. After the recovery culture, transferring the transformed callus to a screening culture medium (MS +1mg/L2,4-D +0.69g/L L-proline +0.5g/L hydrolyzed casein +20g/L sucrose +250mg/L cefamycin +10mg/L PPT +7.5g/L agar, pH5.8) added with glufosinate-ammonium (PPT), starting screening culture for two weeks, then replacing a new screening culture medium, carrying out dark culture at 25-28 ℃ for 15 days, scattering the callus, transferring the callus into the new screening culture medium, and continuing screening for 2 rounds in total.
(5) Differentiation and rooting of resistant calli
Transferring the resistant callus into a differentiation culture medium (MS +0.5mg/L6-BA +0.5g/LMES +10mg/LPPT +250-300mg/L cefuromycin +20g/L sucrose +7g/L agar, pH5.8), dark culturing for 7-10 days at 25-28 ℃, then transferring into a light culture box for culturing at 25-28 ℃ until the regeneration bud grows to 3-5cm, and transferring into a rooting culture medium (MS +20g/L sucrose +7g/L agar, pH 5.8). After a large amount of strong roots grow, hardening seedlings for 2-3 days, cleaning root culture medium, transplanting in sterilized nutrient soil, hardening seedlings indoors for 7 days, and transplanting to a field (covering a flowerpot with a thin film to increase humidity during hardening seedlings).
(6) And (3) taking young leaves of the transplanted and survived transgenic seedlings to carry out PAT/bar protein rapid detection test paper (Artron) detection, and selfing the transgenic positive corns to harvest seeds. Obtaining T1 transgenic corn plants, and strictly selfing for two generations to finally obtain transgenic corn homozygous lines.
Example 5: detection of transgenic maize
The transgenic detection method comprises PAT/bar protein rapid detection test strip detection, PCR detection, RT-PCR detection and detection of the content of the product gamma-PGA.
The rapid detection test strip (Artron) for the PAT/bar protein is carried out according to the instruction of a kit; PCR, RT-PCR detection reference (effect of leucining maize ubiquitin receptor ZmDA1, ZmDAR1 on grain development [ D ]. university of shandong, 2017.) the method described. The detection of the gamma-PGA content of the product is carried out according to the NY/T3039-2016 method.
Vacuum drying corn plant at 60 deg.C, grinding, weighing 10g of uniformly mixed sample, and respectively determining the content of free glutamic acid hydrolyzed by hydrochloric acid and unhydrolyzed free glutamic acid in the sample, wherein the difference between the two is the content of polyglutamic acid.
The test results are shown in FIG. 1 and Table 1
TABLE 1 content of γ -PGA in transgenic maize material (mg/100g dry weight)
Figure BDA0003043668310000131
From the above results, it can be seen that three genes, PgsA, PgsB, PgsC, have been successfully transferred into maize (fig. 1), and γ -PGA has been successfully detected in transgenic maize.
Example 6: phenotypic characterization of transgenic maize
Transgenic positive maize lines are selected to identify the phenotype of the seeds and the entire development stage (germination stage, seedling stage, jointing stage, etc.).
The test results are shown in fig. 2 and table 3, and the phenotype of the transgenic positive corn and the negative control corn under the normal growth condition is observed to determine the influence of the gamma-PGA heterologously synthesized in the corn on the growth and development of the corn, and the results are shown in fig. 2.
The result shows that the transgenic positive corn line has better germination rate, higher plant height and more developed root system, which indicates that the synthesis of gamma-PGA in the corn can promote the growth of the corn; the inventors also evaluated their yields under normal irrigation conditions and found that the synthesis of γ -PGA in maize could improve maize yield under normal growth conditions, mainly ear grain number, ear grain weight, and hundred grain weight (table 3).
Example 7 transgenic maize stress resistance identification
Drought resistance assay for transgenic maize
Drought stress treatment is respectively carried out on the transgenic positive corn and the transgenic negative control corn, and the phenotype of the transgenic positive corn and the transgenic negative control corn is researched. The drought treatment is divided into PEG simulation drought treatment and water-break drought stress treatment.
The PEG simulation drought treatment mainly selects two periods of germination period and three-leaf period, the corn culture solution selects Hogland nutrient solution (Haiboza), and the concentrations of PEG6000 selected by the drought stress treatment in the germination period are 14% and 18% respectively. Selecting transgenic materials and control materials, sterilizing the surfaces of seeds, germinating on filter paper containing 0mmol/L, 12% PEG and 14% PEG solution, counting the germination rate, and observing the growth potential. The concentration of PEG6000 selected by the seedling stage simulated drought treatment is 18 percent; during seedling stage drought treatment, water cut-off treatment of potted plants is adopted, and physiological and biochemical indexes such as free proline, soluble sugar, chlorophyll content and ABA content are measured. The field drought treatment implementation place is a China-Yunnan breeding base, and a water-breaking treatment method before flowering is selected, and the specific implementation method comprises the following steps: water cut off for 15 days, rehydration once, water cut off for another 15 days until harvest, adverse phenotype and yield were measured.
The determination of the content of free proline, soluble sugars, chlorophyll, ABA is carried out with reference to the methods (Wang B, Li Z, Ran Q, et al ZmNF-YB16 Overexpression drug Resistance and Yield by enhancement Photosynthesis and the impedance Capacity of Maize Plants [ J ]. Frontiers in Plant Science,2018,9: 709; Li Z, Liu C, Zhang Y, et al HLH family member ZmP 1 regulation drug in main texture by promoter point and ABA synthesis [ J ]. Journal of expression Bolay, 2019: 19).
The results of the drought resistance analysis are shown in FIGS. 3-5.
The results show that transgenic positive maize still can germinate well under the PEG treatment, while germination of negative control maize is obviously inhibited (figure 3). In the PEG simulated drought treatment test at the seedling stage, the inventors applied 50mg/L γ -PGA exogenously to a part of transgenic negative control maize, and cultured the other part as a control in the 18% PEG solution treatment simultaneously with the transgenic positive maize, and the results showed that the growth of the negative control maize was significantly inhibited under the 18% PEG solution treatment condition, while the growth conditions of the transgenic positive maize and the treatment group exogenously applied γ -PGA were significantly better than the control material (fig. 4A). The inventor carries out fresh weight statistics on the overground part and the underground part of a transgenic positive corn strain, a negative corn strain externally applied with gamma-PGA and a negative control strain after being treated by 18 percent PEG for 5 days, and finds that the biomass of the transgenic positive corn strain is obviously higher than that of the negative control corn under the PEG treatment condition, even slightly higher than that of a corn group externally applied with the gamma-PGA (figures 4B-4C). The heterogenous synthesis of the gamma-PGA in the corn can achieve the effect of improving the drought resistance of the corn by applying the gamma-PGA from an external source. This indicates that the improved stress resistance of transgenic maize was due to the production of γ -PGA.
The inventors also performed potting water cut-off treatment tests on transgenic positive maize and negative control maize in the trefoil stage. It was found that under early drought stress conditions, transgenic positive maize showed a better growth state than transgenic negative control maize. After 8 days of water cut-off treatment, the negative control maize almost wilted and died, the watering was resumed, the transgenic positive maize could still rapidly resume growth, while the control maize almost died (fig. 5). The contents of ABA, soluble sugar, proline and chlorophyll of leaves subjected to water-break treatment for 6 days are measured, and the results show that the contents of ABA, soluble sugar, proline and chlorophyll in the leaves of the corn can be remarkably improved by heterogeneously synthesizing gamma-PGA in the corn under the drought stress condition, so that the drought resistance of the corn is improved (Table 2).
TABLE 2 Effect of drought treatment on ABA, Soluble sugar (Soluble sugar), Proline (Proline), Chlorophyll (chlorophyl) content in transgenic positive and negative control maize
Figure BDA0003043668310000141
The results of the field drought and water break test are shown in figure 6. The result shows that the transgenic positive corn also shows good drought resistance under the field drought condition.
The transgenic corn salt resistance research comprises a germination stage and a seedling stage: NaCl solutions with different concentrations are selected for carrying out salt stress treatment on the corns in the germination period. Selecting the surfaces of the seeds of the transgenic positive material and the negative control material, sterilizing, germinating on filter paper containing 150mM NaCl and 200mM NaCl solution respectively, and observing the germination condition; the salt resistance test in the seedling stage adopts solution stress treatment: and (3) sterilizing the surface of the corn seed, transferring the corn seed to a nutrient solution (Hogland corn nutrient solution) for culturing after the corn seed germinates, transferring the corn cultured to the trefoil stage to the nutrient solution containing 200mM NaCl for culturing respectively, and counting the phenotypic change.
The results of the salt resistance analysis are shown in FIGS. 7-8. The result shows that the germination condition of the transgenic corn seeds is better than that of the control negative corn under the condition of low concentration or high concentration NaCl, which indicates that the transgenic corn has better salt resistance in the germination stage, and the water culture salt resistance test result in the seedling stage also shows that the transgenic positive corn has obvious salt resistance.
Comparing the salt resistance and the drought resistance of transgenic positive (endogenously synthesized gamma-PGA) corns and wild type control corns which are exogenously processed by the gamma-PGA: a contrast test of drought resistance and salt resistance of wild inbred lines which are treated by transgenic positive (endogenously synthesized gamma-PGA) corns and gamma-PGA exogenous sources adopts a solution stress treatment method. Firstly, corn seeds are disinfected and germinated, then the germinated seedlings are inserted into nutrient solution (Hogland corn nutrient solution) for culture, when the plants grow to the three-leaf stage, the treatment is started, the transgenic corn strains are respectively transferred into the nutrient solution containing 18% PEG or 200mmol/LNaCl for treatment, the control corn inbred lines are respectively transferred into the nutrient solution containing 20mg/L gamma-PGA, 18% PEG +20mg/L gamma-PGA, 200mmol/L NaCl, 200mmol/LNaCl +20mg/L gamma-PGA for treatment, wild corn and transgenic positive corn strains which are not treated are used as controls, the phenotype change is observed in the period, and finally, the biomass measurement is carried out.
The results are shown in FIG. 9. The result shows that the drought resistance and salt resistance of the transgenic corn strain is equivalent to those of wild corn treated by exogenous gamma-PGA, even better than those of wild corn added with exogenous gamma-PGA, and the result shows that the transgenic PgsA, PgsB and PgsC genes enable the transgenic corn strain to endogenously synthesize gamma-PGA in the corn, so that the transgenic corn strain has better effect on improving the drought resistance and salt resistance of the corn.
Example 8: yield analysis of transgenic maize under normal and drought conditions
The drought treatment is carried out on the transgenic positive corn plants and the transgenic negative control corn plants planted in the field before flowering, and the specific implementation method comprises the steps of water cut-off for 15 days, rehydration, water cut-off for 15 days and rehydration. And finally, counting the yield.
The results are shown in FIG. 2F, FIG. 6C, Table 3.
The results show that under drought conditions, the yield of transgenic positive maize is significantly improved. Transgenic maize was less affected by drought than under normal irrigation conditions, whereas negative control maize had significantly reduced yield under drought conditions.
TABLE 3 statistics of yields of transgenic positive and negative control maize under normal irrigation conditions and drought conditions
Figure BDA0003043668310000151
Example 9: content detection of starch and amylose in transgenic positive corn and negative control corn seeds
The content of starch and amylose in transgenic positive and negative control maize seeds was determined using a method reference (luminon maize ubiquitin receptor ZmDA1, ZmDAR1 effect on grain development [ D ]. university of shandong, 2017.).
The content detection comparison of starch and amylose in the transgenic positive corn and the negative control corn seeds shows that the content of starch and amylose in the corn seeds can be obviously improved by the transgenic corn.
The results are shown in Table 4.
TABLE 4 starch and amylose content in transgenic Positive and negative control corn seeds
Figure BDA0003043668310000161
In conclusion, the invention provides a method for synthesizing gamma-PGA in plants by using synthetic biology original and genetic engineering technology for the first time, and the successful detection of the synthesis of the gamma-PGA in transgenic maize proves that the gamma-PGA can be heterogeneously synthesized in the plants; the main grain crop corn is selected as a test material, and the obtained transgenic corn proves that the drought resistance and the salt resistance of the corn can be obviously improved, and the yield of the corn can be obviously improved under the drought condition; yield under normal irrigation conditions under non-stress is not reduced, even slightly increased; the invention also measures the quality of the transgenic corn kernel, and finds that the synthesis of the gamma-PGA in the corn can improve the starch content and the amylose content in the corn kernel. The research results suggest that the method can be widely applied to the aspects of crop stress-resistant molecular breeding, crop biological quantity improvement and the like, and has important theoretical significance and great economic value.
Sequence listing
<110> university of Qilu Industrial science
Method for improving stress resistance and yield of plants by heterogeneously synthesizing gamma-polyglutamic acid in plants
<141> 2021-04-23
<160> 7
<210> 1
<211> 389
<212> PRT
<213> Bacillus licheniformis (Bacillus licheniformis)
<221> amino acid sequence of PgsA Gene
<222>（1）…（389）
<400> 1
MKKQLNFQEK LLKLTKQEKK KTNKHVFIVL PVIFCLMFVF TWVGSAKTPS QMDKKEDAKL 60
TATFVGDIMM GRNVEKVTNL HGSESVFKNV KPYFNVSDFI TGNFENPVTN AKDYQEAEKN 120
IHLQTNQESV ETLKKLNFSV LNFANNHAMD YGEDGLKDTL NKFSNENLEL VGAGNNLEDA 180
KQHVSYQNVN GVKIATLGFT DVYTKNFTAK KNRGGVLPLS PKIFIPMIAE ASKKADLVLV 240
HVHWGQEYDN EPNDRQKDLA KAIADAGADV IIGAHPHVLE PIEVYNGTVI FYSLGNFVFD 300
QGWSRTRDSA LVQYHLMNDG KGRFEVTPLN IREATPTPLG KSDFLKRKAI FRQLTKGTNL 360
DWKEENGKLT FEVDHADKLK NNKNGVVNK 389
<210> 2
<211> 393
<212> PRT
<213> Bacillus licheniformis (Bacillus licheniformis)
<221> amino acid sequence of PgsB Gene
<222>（1）…（393）
<400> 2
MWVMLLACVI VVGIGIYEKR RHQQNIDALP VRVNINGIRG KSTVTRLTTG ILIEAGYKTV 60
GKTTGTDARM IYWDTPEEKP IKRKPQGPNI GEQKEVMKET VERGANAIVS ECMAVNPDYQ 120
IIFQEELLQA NIGVIVNVLE DHMDVMGPTL DEIAEAFTAT IPYNGHLVIT DSEYTDFFKQ 180
IAKERNTKVI VADNSKITDE YLRQFEYMVF PDNASLALGV AQALGIDEET AFKGMLNAPP 240
DPGAMRILPL MNAKNPGHFV NGFAANDAAS TLNIWKRVKE IGYPTDQPIV IMNCRADRVD 300
RTQQFAEDVL PYIEASELVL IGETTEPIVK AYEAGKIPAD KLFDFEHKST EEIMFMLKNK 360
LEGRVIYGVG NIHGAAEPLI EKIQDYKIKQ LVS 393
<210>3
<211> 149
<212> PRT
<213> Bacillus licheniformis (Bacillus licheniformis)
<221> amino acid sequence of PgsC gene
<222>（1）…（149）
<400> 3
MFGSDLYIAL ILGVLLSLIF AEKTGIVPAG LVVPGYLGLV FNQPIFMLLV LFVSLLTYVI 60
VKFGLSKIMI LYGRRKFAAM LITGILLKIG FDFIYPVMPF EIAEFRGIGI IVPGLIANTI 120
QRQGLTITLG STLLLSGATF VIMYAYYLI 149
<210> 4
<211> 1170
<212> DNA
<213> Artificial sequence
<221> codon-optimized nucleotide sequence of PgsA gene
<222>（1）…（1170）
<400> 4
atgaagaagc agctcaactt ccaggagaag ctcctgaagc tgaccaagca ggagaagaag 60
aagaccaaca agcacgtctt catcgtgctc ccggtcatct tctgcctgat gttcgtgttc 120
acctgggtgg gctcggctaa gaccccaagc cagatggaca agaaggagga cgcgaagctc 180
accgccacgt tcgtcggcga catcatgatg ggccgcaacg tggagaaggt caccaacctg 240
cacggctccg agagcgtgtt caagaacgtc aagccgtact tcaacgtgtc cgacttcatc 300
accggcaact tcgagaaccc cgtcacgaac gcgaaggact accaggaggc cgagaagaac 360
atccacctcc agaccaacca ggagtccgtg gagacgctca agaagctgaa cttcagcgtc 420
ctgaacttcg cgaacaacca cgccatggac tacggcgagg acggcctcaa ggacaccctg 480
aacaagttct ccaacgagaa cctcgagctg gtgggcgccg gcaacaacct cgaggacgcc 540
aagcagcacg tcagctacca gaacgtgaac ggcgtcaaga tcgcgaccct gggcttcacg 600
gacgtgtaca ccaagaactt caccgccaag aagaaccgcg gcggcgtcct ccccctgtcc 660
cccaagatct tcatcccgat gatcgccgag gcgagcaaga aggcggacct cgtgctggtc 720
cacgtgcact ggggccagga gtacgacaac gagcccaacg acaggcagaa ggacctcgct 780
aaggccatcg cggacgccgg cgcggacgtg atcatcggcg cccaccccca cgtcctggag 840
cccatcgagg tgtacaacgg caccgtcatc ttctactccc tgggcaactt cgtgttcgac 900
cagggctggt ccaggaccag ggacagcgcc ctcgtccagt accacctgat gaacgacggc 960
aagggcaggt tcgaggtgac cccgctgaac atcagggagg ccacgcccac gcccctcggc 1020
aagagcgact tcctgaagcg caaggccatc ttcaggcagc tcaccaaggg cacgaacctg 1080
gactggaagg aggagaacgg caagctcacg ttcgaggtgg accacgccga caagctgaag 1140
aacaacaaga acggcgtggt caacaagtag 1170
<210> 5
<211> 1182
<212> DNA
<213> Artificial sequence
<221> codon-optimized nucleotide sequence of PgsB gene
<222>（1）…（1182）
<400> 5
atgtgggtca tgctcctggc ctgcgtgatc gtggtcggca tcggcatcta cgagaagcgc 60
aggcaccagc agaacatcga cgcgctcccc gtgagggtca acatcaacgg catccgcggc 120
aagtccaccg tgacgaggct caccacgggc atcctgatcg aggccggcta caagacggtg 180
ggcaagacca ccggcaccga cgcccgcatg atctactggg acaccccgga ggagaagccc 240
atcaagcgga agccccaggg cccaaacatc ggcgagcaga aggaggtcat gaaggagacg 300
gtggagaggg gcgccaacgc gatcgtctcc gagtgcatgg ccgtgaaccc ggactaccag 360
atcatcttcc aggaggagct cctgcaggcg aacatcggcg tgatcgtcaa cgtgctcgag 420
gaccacatgg acgtgatggg cccaaccctg gacgagatcg cggaggcgtt caccgccacg 480
atcccgtaca acggccacct cgtcatcacc gacagcgagt acacggactt cttcaagcag 540
atcgccaagg agcgcaacac caaggtcatc gtggcggaca actccaagat cacggacgag 600
tacctgaggc agttcgagta catggtgttc ccggacaacg ctagcctggc cctgggcgtg 660
gctcaggccc tgggcatcga cgaggagacc gccttcaagg gcatgctgaa cgccccgcca 720
gaccccggcg ccatgcgcat cctccccctg atgaacgcga agaaccccgg ccacttcgtg 780
aacggcttcg ctgccaacga cgctgcctcc accctgaaca tctggaagag ggtcaaggag 840
atcggctacc cgacggacca gcccatcgtc atcatgaact gcagggcgga ccgggtggac 900
aggacccagc agttcgcgga ggacgtcctc ccctacatcg aggcgtccga gctcgtgctg 960
atcggcgaga ccacggagcc catcgtcaag gcttacgagg ccggcaagat ccccgctgac 1020
aagctgttcg acttcgagca caagagcacg gaggagatca tgttcatgct caagaacaag 1080
ctggagggga gggtcatcta cggcgtgggc aacatccacg gcgcggccga gcccctcatc 1140
gagaagatcc aggactacaa gatcaagcag ctggtgagct ag 1182
<210> 6
<211> 450
<212> DNA
<213> Artificial sequence
<221> codon-optimized nucleotide sequence of PgsC gene
<222>（1）…（450）
<400> 6
atgttcggct ccgacctgta catcgccctg atcctcggcg tgctcctgag cctcatcttc 60
gccgagaaga cgggcatcgt ccccgccggc ctggtggtcc ccggctacct gggcctcgtg 120
ttcaaccagc cgatcttcat gctcctggtg ctcttcgtct ccctcctgac ctacgtgatc 180
gtcaagttcg gcctgagcaa gatcatgatc ctctacggcc gcaggaagtt cgccgcgatg 240
ctgatcacgg gcatcctcct gaagatcggc ttcgacttca tctacccggt catgcccttc 300
gagatcgccg agttccgcgg catcggcatc atcgtgccgg gcctgatcgc gaacacgatc 360
cagaggcagg gcctgaccat caccctgggc tccaccctcc tgctctcggg cgctaccttc 420
gtcatcatgt acgcgtacta cctcatctag 450
<210> 7
<211> 13793
<212> DNA
<213> Artificial sequence
<221> nucleotide sequence of plant expression vector PGA001
<222>（1）…（13793）
<400> 7
aattgacgct tagacaactt aataacacat tgcggacgtt tttaatgtac tgaattaacg 60
ccgaattaat tcgggggatc tggattttag tactggattt tggttttagg aattagaaat 120
tttattgata gaagtatttt acaaatacaa atacatacta agggtttctt atatgctcaa 180
cacatgagcg aaaccctata ggaaccctaa ttcccttatc tgggaactac tcacacatta 240
ttatggagaa actcgaaatt cgagctcagt caaatctcgg tgacgggcag gaccggacgg 300
ggcggtaccg gcaggctgaa gtccagctgc cagaaaccca cgtcatgcca gttcccgtgc 360
ttgaagccgg ccgcccgcag catgccgcgg ggggcatatc cgagcgcctc gtgcatgcgc 420
acgctcgggt cgttgggcag cccgatgaca gcgaccacgc tcttgaagcc ctgtgcctcc 480
agggacttca gcaggtgggt gtagagcgtg gagcccagtc ccgtccgctg gtggcggggg 540
gagacgtaca cggtcgactc ggccgtccag tcgtaggcgt tgcgtgcctt ccaggggccc 600
gcgtaggcga tgccggcgac ctcgccgtcc acctcggcga cgagccaggg atagcgctcc 660
cgcagacgga cgaggtcgtc cgtccactcc tgcggttcct gcggctcggt acggaagttg 720
accgtgcttg tctcgatgta gtggttgacg atggtgcaga ccgccggcat gtccgcctcg 780
gtggcacggc ggatgtcggc cgggcgtcgt tctgggctca tggtagactc gatcctctag 840
agtcgacctg cagaagtaac accaaacaac agggtgagca tcgacaaaag aaacagtacc 900
aagcaaataa atagcgtatg aaggcagggc taaaaaaatc cacatatagc tgctgcatat 960
gccatcatcc aagtatatca agatcaaaat aattataaaa catacttgtt tattataata 1020
gataggtact caaggttaga gcatatgaat agatgctgca tatgccatca tgtatatgca 1080
tcagtaaaac ccacatcaac atgtatacct atcctagatc gatatttcca tccatcttaa 1140
actcgtaact atgaagatgt atgacacaca catacagttc caaaattaat aaatacacca 1200
ggtagtttga aacagtattc tactccgatc tagaacgaat gaacgaccgc ccaaccacac 1260
cacatcatca caaccaagcg aacaaaaagc atctctgtat atgcatcagt aaaacccgca 1320
tcaacatgta tacctatcct agatcgatat ttccatccat catcttcaat tcgtaactat 1380
gaatatgtat ggcacacaca tacagatcca aaattaataa atccaccagg tagtttgaaa 1440
cagaattcta ctccgatcta gaacgaccgc ccaaccagac cacatcatca caaccaagac 1500
aaaaaaaagc atgaaaagat gacccgacaa acaagtgcac ggcatatatt gaaataaagg 1560
aaaagggcaa accaaaccct atgcaacgaa acaaaaaaaa tcatgaaatc gatcccgtct 1620
gcggaacggc tagagccatc ccaggattcc ccaaagagaa acactggcaa gttagcaatc 1680
agaacgtgtc tgacgtacag gtcgcatccg tgtacgaacg ctagcagcac ggatctaaca 1740
caaacacgga tctaacacaa acatgaacag aagtagaact accgggccct aaccatggac 1800
cggaacgccg atctagagaa ggtagagagg ggggggggga ggacgagcgg cgtaccttga 1860
agcggaggtg ccgacgggtg gatttggggg agatctggtt gtgtgtgtgt gcgctccgaa 1920
caacacgagg ttggggaaag agggtgtgga gggggtgtct atttattacg gcgggcgagg 1980
aagggaaagc gaaggagcgg tgggaaagga atcccccgta gctgccggtg ccgtgagagg 2040
aggaggaggc cgcctgccgt gccggctcac gtctgccgct ccgccacgca atttctggat 2100
gccgacagcg gagcaagtcc aacggtggag cggaactctc gagaggggtc cagaggcagc 2160
gacagagatg ccgtgccgtc tgcttcgctt ggcccgacgc gacgctgctg gttcgctggt 2220
tggtgtccgt tagactcgtc gacggcgttt aacaggctgg cattatctac tcgaaacaag 2280
aaaaatgttt ccttagtttt tttaatttct taaagggtat ttgtttaatt tttagtcact 2340
ttattttatt ctattttata tctaaattat taaataaaaa aactaaaata gagttttagt 2400
tttcttaatt tagaggctaa aatagaataa aatagatgta ctaaaaaaat tagtctataa 2460
aaaccattaa ccctaaaccc taaatggatg tactaataaa atggatgaag tattatatag 2520
gtgaagctat ttgcaaaaaa aaaggagaac acatgcacac taaaaagata aaactgtaga 2580
gtcctgttgt caaaatactc aattgtcctt tagaccatgt ctaactgttc atttatatga 2640
ttctctaaaa cactgatatt attgtagtac tatagattat attattcgta gagtaaagtt 2700
taaatatatg tataaagata gataaactgc acttcaaaca agtgtgacaa aaaaaatatg 2760
tggtaatttt ttataactta gacatgcaat gctcattatc tctagagagg ggcacgaccg 2820
ggtcacgctg cactgcaggc atgctgagac ttttcaacaa agggtaatat ccggaaacct 2880
cctcggattc cattgcccag ctatctgtca ctttattgtg aagatagtgg aaaaggaagg 2940
tggctcctac aaatgccatc attgcgataa aggaaaggcc atcgttgaag atgcctctgc 3000
cgacagtggt cccaaagatg gacccccacc cacgaggagc atcgtggaaa aagaagacgt 3060
tccaaccacg tcttcaaagc aagtggattg atgtgatatc tccactgacg taagggatga 3120
cgcacaatcc cactatcctt cgcaagaccc ttcctctata taaggaagtt catttcattt 3180
ggagagaaca ggatcatgaa gaagcagctc aacttccagg agaagctcct gaagctgacc 3240
aagcaggaga agaagaagac caacaagcac gtcttcatcg tgctcccggt catcttctgc 3300
ctgatgttcg tgttcacctg ggtgggctcg gctaagaccc caagccagat ggacaagaag 3360
gaggacgcga agctcaccgc cacgttcgtc ggcgacatca tgatgggccg caacgtggag 3420
aaggtcacca acctgcacgg ctccgagagc gtgttcaaga acgtcaagcc gtacttcaac 3480
gtgtccgact tcatcaccgg caacttcgag aaccccgtca cgaacgcgaa ggactaccag 3540
gaggccgaga agaacatcca cctccagacc aaccaggagt ccgtggagac gctcaagaag 3600
ctgaacttca gcgtcctgaa cttcgcgaac aaccacgcca tggactacgg cgaggacggc 3660
ctcaaggaca ccctgaacaa gttctccaac gagaacctcg agctggtggg cgccggcaac 3720
aacctcgagg acgccaagca gcacgtcagc taccagaacg tgaacggcgt caagatcgcg 3780
accctgggct tcacggacgt gtacaccaag aacttcaccg ccaagaagaa ccgcggcggc 3840
gtcctccccc tgtcccccaa gatcttcatc ccgatgatcg ccgaggcgag caagaaggcg 3900
gacctcgtgc tggtccacgt gcactggggc caggagtacg acaacgagcc caacgacagg 3960
cagaaggacc tcgctaaggc catcgcggac gccggcgcgg acgtgatcat cggcgcccac 4020
ccccacgtcc tggagcccat cgaggtgtac aacggcaccg tcatcttcta ctccctgggc 4080
aacttcgtgt tcgaccaggg ctggtccagg accagggaca gcgccctcgt ccagtaccac 4140
ctgatgaacg acggcaaggg caggttcgag gtgaccccgc tgaacatcag ggaggccacg 4200
cccacgcccc tcggcaagag cgacttcctg aagcgcaagg ccatcttcag gcagctcacc 4260
aagggcacga acctggactg gaaggaggag aacggcaagc tcacgttcga ggtggaccac 4320
gccgacaagc tgaagaacaa caagaacggc gtggtcaaca agtaggatcg ttcaaacatt 4380
tggcaataaa gtttcttaag attgaatcct gttgccggtc ttgcgatgat tatcatataa 4440
tttctgttga attacgttaa gcatgtaata attaacatgt aatgcatgac gttatttatg 4500
agatgggttt ttatgattag agtcccgcaa ttatacattt aatacgcgat agaaaacaaa 4560
atatagcgcg caaactagga taaattatcg cgcgcggtgt catctatgtt actagatcgg 4620
atcctgagac ttttcaacaa agggtaatat ccggaaacct cctcggattc cattgcccag 4680
ctatctgtca ctttattgtg aagatagtgg aaaaggaagg tggctcctac aaatgccatc 4740
attgcgataa aggaaaggcc atcgttgaag atgcctctgc cgacagtggt cccaaagatg 4800
gacccccacc cacgaggagc atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc 4860
aagtggattg atgtgatatc tccactgacg taagggatga cgcacaatcc cactatcctt 4920
cgcaagaccc ttcctctata taaggaagtt catttcattt ggagagaaca atgtgggtca 4980
tgctcctggc ctgcgtgatc gtggtcggca tcggcatcta cgagaagcgc aggcaccagc 5040
agaacatcga cgcgctcccc gtgagggtca acatcaacgg catccgcggc aagtccaccg 5100
tgacgaggct caccacgggc atcctgatcg aggccggcta caagacggtg ggcaagacca 5160
ccggcaccga cgcccgcatg atctactggg acaccccgga ggagaagccc atcaagcgga 5220
agccccaggg cccaaacatc ggcgagcaga aggaggtcat gaaggagacg gtggagaggg 5280
gcgccaacgc gatcgtctcc gagtgcatgg ccgtgaaccc ggactaccag atcatcttcc 5340
aggaggagct cctgcaggcg aacatcggcg tgatcgtcaa cgtgctcgag gaccacatgg 5400
acgtgatggg cccaaccctg gacgagatcg cggaggcgtt caccgccacg atcccgtaca 5460
acggccacct cgtcatcacc gacagcgagt acacggactt cttcaagcag atcgccaagg 5520
agcgcaacac caaggtcatc gtggcggaca actccaagat cacggacgag tacctgaggc 5580
agttcgagta catggtgttc ccggacaacg ctagcctggc cctgggcgtg gctcaggccc 5640
tgggcatcga cgaggagacc gccttcaagg gcatgctgaa cgccccgcca gaccccggcg 5700
ccatgcgcat cctccccctg atgaacgcga agaaccccgg ccacttcgtg aacggcttcg 5760
ctgccaacga cgctgcctcc accctgaaca tctggaagag ggtcaaggag atcggctacc 5820
cgacggacca gcccatcgtc atcatgaact gcagggcgga ccgggtggac aggacccagc 5880
agttcgcgga ggacgtcctc ccctacatcg aggcgtccga gctcgtgctg atcggcgaga 5940
ccacggagcc catcgtcaag gcttacgagg ccggcaagat ccccgctgac aagctgttcg 6000
acttcgagca caagagcacg gaggagatca tgttcatgct caagaacaag ctggagggga 6060
gggtcatcta cggcgtgggc aacatccacg gcgcggccga gcccctcatc gagaagatcc 6120
aggactacaa gatcaagcag ctggtgagct aggatcgttc aaacatttgg caataaagtt 6180
tcttaagatt gaatcctgtt gccggtcttg cgatgattat catataattt ctgttgaatt 6240
acgttaagca tgtaataatt aacatgtaat gcatgacgtt atttatgaga tgggttttta 6300
tgattagagt cccgcaatta tacatttaat acgcgataga aaacaaaata tagcgcgcaa 6360
actaggataa attatcgcgc gcggtgtcat ctatgttact agatcaagct ttgagacttt 6420
tcaacaaagg gtaatatccg gaaacctcct cggattccat tgcccagcta tctgtcactt 6480
tattgtgaag atagtggaaa aggaaggtgg ctcctacaaa tgccatcatt gcgataaagg 6540
aaaggccatc gttgaagatg cctctgccga cagtggtccc aaagatggac ccccacccac 6600
gaggagcatc gtggaaaaag aagacgttcc aaccacgtct tcaaagcaag tggattgatg 6660
tgatatctcc actgacgtaa gggatgacgc acaatcccac tatccttcgc aagacccttc 6720
ctctatataa ggaagttcat ttcatttgga gagaacaatg ttcggctccg acctgtacat 6780
cgccctgatc ctcggcgtgc tcctgagcct catcttcgcc gagaagacgg gcatcgtccc 6840
cgccggcctg gtggtccccg gctacctggg cctcgtgttc aaccagccga tcttcatgct 6900
cctggtgctc ttcgtctccc tcctgaccta cgtgatcgtc aagttcggcc tgagcaagat 6960
catgatcctc tacggccgca ggaagttcgc cgcgatgctg atcacgggca tcctcctgaa 7020
gatcggcttc gacttcatct acccggtcat gcccttcgag atcgccgagt tccgcggcat 7080
cggcatcatc gtgccgggcc tgatcgcgaa cacgatccag aggcagggcc tgaccatcac 7140
cctgggctcc accctcctgc tctcgggcgc taccttcgtc atcatgtacg cgtactacct 7200
catctagggt gaccgatcgt tcaaacattt ggcaataaag tttcttaaga ttgaatcctg 7260
ttgccggtct tgcgatgatt atcatataat ttctgttgaa ttacgttaag catgtaataa 7320
ttaacatgta atgcatgacg ttatttatga gatgggtttt tatgattaga gtcccgcaat 7380
tatacattta atacgcgata gaaaacaaaa tatagcgcgc aaactaggat aaattatcgc 7440
gcgcggtgtc atctatgtta ctagatcgcg tttaaactat cagtgtttga caggatatat 7500
tggcgggtaa acctaagaga aaagagcgtt tattagaata atcggatatt taaaagggcg 7560
tgaaaaggtt tatccgttcg tccatttgta tgtgcatgcc aaccacaggg ttcccctcgg 7620
gatcaaagta ctttgatcca acccctccgc tgctatagtg cagtcggctt ctgacgttca 7680
gtgcagccgt cttctgaaaa cgacatgtcg cacaagtcct aagttacgcg acaggctgcc 7740
gccctgccct tttcctggcg ttttcttgtc gcgtgtttta gtcgcataaa gtagaatact 7800
tgcgactaga accggagaca ttacgccatg aacaagagcg ccgccgctgg cctgctgggc 7860
tatgcccgcg tcagcaccga cgaccaggac ttgaccaacc aacgggccga actgcacgcg 7920
gccggctgca ccaagctgtt ttccgagaag atcaccggca ccaggcgcga ccgcccggag 7980
ctggccagga tgcttgacca cctacgccct ggcgacgttg tgacagtgac caggctagac 8040
cgcctggccc gcagcacccg cgacctactg gacattgccg agcgcatcca ggaggccggc 8100
gcgggcctgc gtagcctggc agagccgtgg gccgacacca ccacgccggc cggccgcatg 8160
gtgttgaccg tgttcgccgg cattgccgag ttcgagcgtt ccctaatcat cgaccgcacc 8220
cggagcgggc gcgaggccgc caaggcccga ggcgtgaagt ttggcccccg ccctaccctc 8280
accccggcac agatcgcgca cgcccgcgag ctgatcgacc aggaaggccg caccgtgaaa 8340
gaggcggctg cactgcttgg cgtgcatcgc tcgaccctgt accgcgcact tgagcgcagc 8400
gaggaagtga cgcccaccga ggccaggcgg cgcggtgcct tccgtgagga cgcattgacc 8460
gaggccgacg ccctggcggc cgccgagaat gaacgccaag aggaacaagc atgaaaccgc 8520
accaggacgg ccaggacgaa ccgtttttca ttaccgaaga gatcgaggcg gagatgatcg 8580
cggccgggta cgtgttcgag ccgcccgcgc acgtctcaac cgtgcggctg catgaaatcc 8640
tggccggttt gtctgatgcc aagctggcgg cctggccggc cagcttggcc gctgaagaaa 8700
ccgagcgccg ccgtctaaaa aggtgatgtg tatttgagta aaacagcttg cgtcatgcgg 8760
tcgctgcgta tatgatgcga tgagtaaata aacaaatacg caaggggaac gcatgaaggt 8820
tatcgctgta cttaaccaga aaggcgggtc aggcaagacg accatcgcaa cccatctagc 8880
ccgcgccctg caactcgccg gggccgatgt tctgttagtc gattccgatc cccagggcag 8940
tgcccgcgat tgggcggccg tgcgggaaga tcaaccgcta accgttgtcg gcatcgaccg 9000
cccgacgatt gaccgcgacg tgaaggccat cggccggcgc gacttcgtag tgatcgacgg 9060
agcgccccag gcggcggact tggctgtgtc cgcgatcaag gcagccgact tcgtgctgat 9120
tccggtgcag ccaagccctt acgacatatg ggccaccgcc gacctggtgg agctggttaa 9180
gcagcgcatt gaggtcacgg atggaaggct acaagcggcc tttgtcgtgt cgcgggcgat 9240
caaaggcacg cgcatcggcg gtgaggttgc cgaggcgctg gccgggtacg agctgcccat 9300
tcttgagtcc cgtatcacgc agcgcgtgag ctacccaggc actgccgccg ccggcacaac 9360
cgttcttgaa tcagaacccg agggcgacgc tgcccgcgag gtccaggcgc tggccgctga 9420
aattaaatca aaactcattt gagttaatga ggtaaagaga aaatgagcaa aagcacaaac 9480
acgctaagtg ccggccgtcc gagcgcacgc agcagcaagg ctgcaacgtt ggccagcctg 9540
gcagacacgc cagccatgaa gcgggtcaac tttcagttgc cggcggagga tcacaccaag 9600
ctgaagatgt acgcggtacg ccaaggcaag accattaccg agctgctatc tgaatacatc 9660
gcgcagctac cagagtaaat gagcaaatga ataaatgagt agatgaattt tagcggctaa 9720
aggaggcggc atggaaaatc aagaacaacc aggcaccgac gccgtggaat gccccatgtg 9780
tggaggaacg ggcggttggc caggcgtaag cggctgggtt gcctgccggc cctgcaatgg 9840
cactggaacc cccaagcccg aggaatcggc gtgagcggtc gcaaaccatc cggcccggta 9900
caaatcggcg cggcgctggg tgatgacctg gtggagaagt tgaaggccgc gcaggccgcc 9960
cagcggcaac gcatcgaggc agaagcacgc cccggtgaat cgtggcaagc ggccgctgat 10020
cgaatccgca aagaatcccg gcaaccgccg gcagccggtg cgccgtcgat taggaagccg 10080
cccaagggcg acgagcaacc agattttttc gttccgatgc tctatgacgt gggcacccgc 10140
gatagtcgca gcatcatgga cgtggccgtt ttccgtctgt cgaagcgtga ccgacgagct 10200
ggcgaggtga tccgctacga gcttccagac gggcacgtag aggtttccgc agggccggcc 10260
ggcatggcca gtgtgtggga ttacgacctg gtactgatgg cggtttccca tctaaccgaa 10320
tccatgaacc gataccggga agggaaggga gacaagcccg gccgcgtgtt ccgtccacac 10380
gttgcggacg tactcaagtt ctgccggcga gccgatggcg gaaagcagaa agacgacctg 10440
gtagaaacct gcattcggtt aaacaccacg cacgttgcca tgcagcgtac gaagaaggcc 10500
aagaacggcc gcctggtgac ggtatccgag ggtgaagcct tgattagccg ctacaagatc 10560
gtaaagagcg aaaccgggcg gccggagtac atcgagatcg agctagctga ttggatgtac 10620
cgcgagatca cagaaggcaa gaacccggac gtgctgacgg ttcaccccga ttactttttg 10680
atcgatcccg gcatcggccg ttttctctac cgcctggcac gccgcgccgc aggcaaggca 10740
gaagccagat ggttgttcaa gacgatctac gaacgcagtg gcagcgccgg agagttcaag 10800
aagttctgtt tcaccgtgcg caagctgatc gggtcaaatg acctgccgga gtacgatttg 10860
aaggaggagg cggggcaggc tggcccgatc ctagtcatgc gctaccgcaa cctgatcgag 10920
ggcgaagcat ccgccggttc ctaatgtacg gagcagatgc tagggcaaat tgccctagca 10980
ggggaaaaag gtcgaaaagg tctctttcct gtggatagca cgtacattgg gaacccaaag 11040
ccgtacattg ggaaccggaa cccgtacatt gggaacccaa agccgtacat tgggaaccgg 11100
tcacacatgt aagtgactga tataaaagag aaaaaaggcg atttttccgc ctaaaactct 11160
ttaaaactta ttaaaactct taaaacccgc ctggcctgtg cataactgtc tggccagcgc 11220
acagccgaag agctgcaaaa agcgcctacc cttcggtcgc tgcgctccct acgccccgcc 11280
gcttcgcgtc ggcctatcgc ggccgctggc cgctcaaaaa tggctggcct acggccaggc 11340
aatctaccag ggcgcggaca agccgcgccg tcgccactcg accgccggcg cccacatcaa 11400
ggcaccctgc ctcgcgcgtt tcggtgatga cggtgaaaac ctctgacaca tgcagctccc 11460
ggagacggtc acagcttgtc tgtaagcgga tgccgggagc agacaagccc gtcagggcgc 11520
gtcagcgggt gttggcgggt gtcggggcgc agccatgacc cagtcacgta gcgatagcgg 11580
agtgtatact ggcttaacta tgcggcatca gagcagattg tactgagagt gcaccatatg 11640
cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc gcatcaggcg ctcttccgct 11700
tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac 11760
tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga 11820
gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat 11880
aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac 11940
ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct 12000
gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg 12060
ctttctcata gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg 12120
ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt 12180
cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg 12240
attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac 12300
ggctacacta gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga 12360
aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt 12420
gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt 12480
tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgcat 12540
tctaggtact aaaacaattc atccagtaaa atataatatt ttattttctc ccaatcaggc 12600
ttgatcccca gtaagtcaaa aaatagctcg acatactgtt cttccccgat atcctccctg 12660
atcgaccgga cgcagaaggc aatgtcatac cacttgtccg ccctgccgct tctcccaaga 12720
tcaataaagc cacttacttt gccatctttc acaaagatgt tgctgtctcc caggtcgccg 12780
tgggaaaaga caagttcctc ttcgggcttt tccgtcttta aaaaatcata cagctcgcgc 12840
ggatctttaa atggagtgtc ttcttcccag ttttcgcaat ccacatcggc cagatcgtta 12900
ttcagtaagt aatccaattc ggctaagcgg ctgtctaagc tattcgtata gggacaatcc 12960
gatatgtcga tggagtgaaa gagcctgatg cactccgcat acagctcgat aatcttttca 13020
gggctttgtt catcttcata ctcttccgag caaaggacgc catcggcctc actcatgagc 13080
agattgctcc agccatcatg ccgttcaaag tgcaggacct ttggaacagg cagctttcct 13140
tccagccata gcatcatgtc cttttcccgt tccacatcat aggtggtccc tttataccgg 13200
ctgtccgtca tttttaaata taggttttca ttttctccca ccagcttata taccttagca 13260
ggagacattc cttccgtatc ttttacgcag cggtattttt cgatcagttt tttcaattcc 13320
ggtgatattc tcattttagc catttattat ttccttcctc ttttctacag tatttaaaga 13380
taccccaaga agctaattat aacaagacga actccaattc actgttcctt gcattctaaa 13440
accttaaata ccagaaaaca gctttttcaa agttgttttc aaagttggcg tataacatag 13500
tatcgacgga gccgattttg aaaccgcggt gatcacaggc agcaacgctc tgtcatcgtt 13560
acaatcaaca tgctaccctc cgcgagatca tccgtgtttc aaacccggca gcttagttgc 13620
cgttcttccg aatagcatcg gtaacatgag caaagtctgc cgccttacaa cggctctccc 13680
gctgacgccg tcccggactg atgggctgcc tgtatcgagt ggtgattttg tgccgagctg 13740
ccggtcgggg agctgttggc tggctggtgg caggatatat tgtggtgtaa aca 13793

Claims (3)

1. The application of the gamma-polyglutamic acid in the corn for improving the starch content and the amylose content in corn kernels through heterologous synthesis is as follows:
(1) cloning of the Gene for synthesizing Gamma-polyglutamic acid: cloning of 3 key enzyme genes for synthesizing gamma-PGA from gamma-polyglutamic acid producing strainPgsA、PgsB、PgsC(ii) a Wherein, the genePgsAThe amino acid sequence of the GenBank ID of (1) is shown in SEQ ID NO.1 of AIA 08848.1; genePgsBThe Genebank ID of (1) is AIA08846.1, and the amino acid sequence of the Genebank ID is shown as SEQ ID NO. 2; genePgsCThe Genebank ID of (1) is AIA08847.1, and the amino acid sequence of the Genebank ID is shown as SEQ ID NO. 3; wherein the strain producing gamma-polyglutamic acid is Bacillus licheniformis (Bacillus licheniformis)Bacillus licheniformis) Or Bacillus amyloliquefaciens (Bacillus amyloliquefaciens）；
(2) Codon optimization: according toPgsA、PgsB、PgsCThe amino acid sequence of the gene is artificially synthesized and optimized through codon preference analysis in cornPgsA、PgsB、PgsCA gene; wherein, after codon optimizationPgsAThe gene nucleotide sequence is shown as SEQ ID NO. 4; after codon optimizationPgsBNucleotide sequence of geneShown as SEQ ID NO. 5; after codon optimizationPgsCThe gene nucleotide sequence is shown as SEQ ID NO. 6;
(3) constructing a plant expression vector: after codon optimizationPgsA、PgsB、PgsCThe gene is linked intobarA plant expression vector pU130-bar of the gene screening marker is used for obtaining a plant expression vector containing a target gene, which is named as plant expression vector PGA001, and the nucleotide sequence of the plant expression vector PGA001 is shown in SEQ ID NO. 7;
(4) the method for obtaining the transgenic corn with the starch content and the amylose content in the corn kernel improved comprises the following steps:
1) preparation of Agrobacterium Strain containing plant expression vector PGA001
Selecting EHA105 agrobacterium as a transformation strain, adding 3 mul of PGA001 expression vector into 50 mul of agrobacterium-infected cells, carrying out ice bath for 30 minutes, carrying out quick freezing for 5 minutes by liquid nitrogen, and carrying out water bath for 5 minutes at 37 ℃; then adding 800-; taking out a bacterial liquid, coating the bacterial liquid on a solid YEP culture medium containing rifampicin and kanamycin, placing the bacterial liquid in dark for inverted culture at 25-28 ℃ for 3-4 days, taking bacterial colonies for colony PCR verification, sequencing, and storing agrobacterium tumefaciens with correct sequencing for transformation;
2) preparation of callus
Selecting a maize inbred line KN5585 as a receptor inbred line, taking ears of 10-12d maize after pollination, removing bracts, processing for 5-6min by 70% alcohol in an aseptic workbench, washing for 4-5 times by using sterile water, stripping 1.5-2mm of young embryos, upwards placing scutellum on a young embryo induction culture medium, and culturing and inducing callus in the dark at 28 ℃; 2-3 weeks later, selecting embryogenic callus with high growth speed, soft texture, loose and fragile, and bright color, transferring to a subculture medium for subculture, and subculturing once every 2 weeks for agrobacterium infection;
3) infection with Agrobacterium
Selecting an agrobacterium tumefaciens single colony containing a PGA001 expression vector, adding the agrobacterium tumefaciens single colony into 5-6mL of a YEP culture medium containing Kan, and culturing overnight; centrifuging at room temperature at 5000-(ii) a Suspending the thallus in infection solution containing acetosyringone, and making OD600=0.6-0.8, mixing evenly for standby; activating the prepared staining solution at 25-28 deg.C and shaking table at 180rpm for 1-2 hr for staining; collecting embryogenic callus of corn, placing into a sterile triangular flask, pouring the invasion dye solution, scattering and shaking large callus blocks to make callus fully contact with Agrobacterium, and infecting for 15-20 min; taking out the callus, sucking the redundant bacteria liquid on filter paper, and then inoculating the callus to a co-culture medium for 3 days at 19-22 ℃ in the dark;
4) recovery culture
Washing the surface of the callus with sterile water containing antibiotic for 3-5 times, pouring out the liquid when the added water is no longer turbid, transferring the callus into a plate paved with filter paper, drying the water on the surface of the callus in a super clean bench, transferring into a recovery culture medium, and performing dark culture at 28 ℃ for 7-10 days;
5) screening culture
Transferring the transformed callus to a screening culture medium added with glufosinate-ammonium after the culture is recovered, carrying out screening culture for two weeks, then replacing a new screening culture medium for dark culture for 15-20 days at 25-28 ℃, scattering the callus, transferring the scattered callus to the new screening culture medium for continuous screening, carrying out 2 rounds of screening in total, and carrying out culture for 30-40 days;
6) differentiation and rooting
Transferring the resistant callus into a differentiation culture medium, performing dark culture at 25-28 ℃ for 7-10 days, then transferring into a light incubator at 25-28 ℃ for culture, and transferring into a rooting culture medium when the regeneration bud grows to 3-5 cm;
7) selfing seed harvest after hardening and transplanting
After a large number of strong roots grow, hardening seedlings for 2-3 days, cleaning a root culture medium, transplanting the seedlings into sterilized nutrient soil, hardening seedlings indoors for 7 days, and transplanting the seedlings to a field; during the period, young leaves are taken to carry out PAT/bar protein rapid detection test strip detection, and the transgenic positive maize is selfed to harvest seeds; obtaining T1 transgenic corn plants, and strictly selfing for two generations to finally obtain transgenic corn homozygous lines.
2. The use of the gamma-polyglutamic acid of claim 1 for the heterologous synthesis in corn to increase the starch content and the amylose content in corn kernels, wherein: the formula of the screening culture medium in the screening culture is as follows: MS +1mg/L2,4-D +0.69g/L L-proline +0.5g/L hydrolyzed casein +20g/L sucrose +250mg/L cefamycin +10mg/L glufosinate +7.5g/L agar, pH 5.8.
3. The use of the gamma-polyglutamic acid of claim 1 for the heterologous synthesis in corn to increase the starch content and the amylose content in corn kernels, wherein: the formula of the differentiation medium in the differentiation rooting is as follows: MS +0.5mg/L6-BA +0.5g/LMES +10mg/L glufosinate +250-300mg/L cephamycin +20g/L sucrose +7g/L agar, pH 5.8.
CN202110465460.1A 2021-04-28 2021-04-28 Method for improving plant stress resistance and yield by heterogeneously synthesizing gamma-polyglutamic acid in plant Active CN113512562B (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN202110465460.1A CN113512562B (en) 2021-04-28 2021-04-28 Method for improving plant stress resistance and yield by heterogeneously synthesizing gamma-polyglutamic acid in plant
CN202210561451.7A CN115725519A (en) 2021-04-28 2021-04-28 Method for improving plant stress resistance and yield by heterogeneously synthesizing gamma-polyglutamic acid in plant
PCT/CN2021/091993 WO2022227102A1 (en) 2021-04-28 2021-05-07 METHOD FOR IMPROVING PLANT STRESS RESISTANCE AND YIELD BY HETEROLOGOUS SYNTHESIS OF γ-POLYGLUTAMIC ACID IN PLANT

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110465460.1A CN113512562B (en) 2021-04-28 2021-04-28 Method for improving plant stress resistance and yield by heterogeneously synthesizing gamma-polyglutamic acid in plant

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CN202210561451.7A Division CN115725519A (en) 2021-04-28 2021-04-28 Method for improving plant stress resistance and yield by heterogeneously synthesizing gamma-polyglutamic acid in plant

Publications (2)

Publication Number Publication Date
CN113512562A CN113512562A (en) 2021-10-19
CN113512562B true CN113512562B (en) 2022-05-17

Family

ID=78063749

Family Applications (2)

Application Number Title Priority Date Filing Date
CN202210561451.7A Pending CN115725519A (en) 2021-04-28 2021-04-28 Method for improving plant stress resistance and yield by heterogeneously synthesizing gamma-polyglutamic acid in plant
CN202110465460.1A Active CN113512562B (en) 2021-04-28 2021-04-28 Method for improving plant stress resistance and yield by heterogeneously synthesizing gamma-polyglutamic acid in plant

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CN202210561451.7A Pending CN115725519A (en) 2021-04-28 2021-04-28 Method for improving plant stress resistance and yield by heterogeneously synthesizing gamma-polyglutamic acid in plant

Country Status (2)

Country Link
CN (2) CN115725519A (en)
WO (1) WO2022227102A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115725519A (en) * 2021-04-28 2023-03-03 齐鲁工业大学 Method for improving plant stress resistance and yield by heterogeneously synthesizing gamma-polyglutamic acid in plant

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101033472A (en) * 2005-03-04 2007-09-12 三得利株式会社 Transformed plant capable of producing polyglutamic acid
CN102181475A (en) * 2011-03-04 2011-09-14 天津大学 Method for screening Bar gene transferred into corn
CN107384840A (en) * 2017-09-07 2017-11-24 北京农业生物技术研究中心 One plant of drought resisting growth-promoting composite bacteria agent and its application

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115725519A (en) * 2021-04-28 2023-03-03 齐鲁工业大学 Method for improving plant stress resistance and yield by heterogeneously synthesizing gamma-polyglutamic acid in plant

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101033472A (en) * 2005-03-04 2007-09-12 三得利株式会社 Transformed plant capable of producing polyglutamic acid
CN102181475A (en) * 2011-03-04 2011-09-14 天津大学 Method for screening Bar gene transferred into corn
CN107384840A (en) * 2017-09-07 2017-11-24 北京农业生物技术研究中心 One plant of drought resisting growth-promoting composite bacteria agent and its application

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
Biosynthesis of poly-gamma-glutamic acid in plants: transient expression of poly-gamma-glutamate synthetase complex in tobacco leaves;Yutaka Tarui等;《JOURNAL OF BIOSCIENCE AND BIOENGINEERING》;20051031;第100卷(第4期);第443-448页，参见全文 *
gamma polyglutamic acid biosynthesis synthase A [Bacillus licheniformis];登录号：AIA08848.1;《GenBank》;20140526;参见序列及相关信息 *
gamma polyglutamic acid biosynthesis synthase B [Bacillus licheniformis];登录号：AIA08846.1;《GenBank》;20140526;参见序列及相关信息 *
gamma polyglutamic acid biosynthesis synthase C [Bacillus licheniformis];登录号：AIA08847.1;《GenBank》;20140526;参见序列及相关信息 *
产聚谷氨酸菌株的筛选及菌株发酵液对玉米幼苗抗旱性的作用;贾艳萍;《生物技术通报》;20171031;第135-142页，参见全文 *
喷施γ-聚谷氨酸提高夏玉米产量和养分吸收的机制;张静静等;《植物营养与肥料学报》;20191130;第25卷(第11期);第1856-1867页，参见摘要、第1857页右栏第1段、表1-6 *
聚谷氨酸保水剂对玉米的影响;任淑华;《现代农业》;20130630;第48页，参见全文 *

Also Published As

Publication number Publication date
CN113512562A (en) 2021-10-19
CN115725519A (en) 2023-03-03
WO2022227102A1 (en) 2022-11-03

Similar Documents

Publication Publication Date Title
CN108948164B (en) Salt-tolerant drought-resistant sweet potato related protein IbbZIP1 as well as encoding gene and application thereof
CN107541520B (en) OsSAUR11 gene related to rice root development and stress resistance, coding protein and application
CN101062943B (en) Rice stress tolerance related DREB transcription factor and its coding gene and application
CN106350526A (en) Glycine max(L.)Merr Shengdou No.9 MYB transcription factor family gene GmMYB84 and application thereof
CN113512562B (en) Method for improving plant stress resistance and yield by heterogeneously synthesizing gamma-polyglutamic acid in plant
CN105002212B (en) Applications of the gene OsPIL13 in Under Salt Stress in Rice patience is improved
CN112626084B (en) Strawberry MYB transcription factor FvMYB24 gene, expression protein and application
US20170022513A1 (en) Gene implicated in abiotic stress tolerance and growth accelerating and use thereof
CN108165579B (en) Optimized method for identifying VIGS silencing system of China rose RhPDS gene
CN101899449B (en) Application of gene PHYB for controlling rice drought stress toleration
CN111424037B (en) Cymbidium CgWRKY70 gene and application thereof
CN106754916B (en) A kind of ABA evoked promoters of No. 9 GmNAC15 genes of soybean sage beans
CN102533802B (en) Tobacco drought response gene NtRHF1 and application of encoding protein thereof
Dubrovna et al. Water deficiency tolerance of genetically modified common wheat cv. Zymoyarka, containing a heterologous ornithine-δ-aminotransferase gene
CN107266542B (en) Thick boisiana IpLEA gene and its coding albumen and application
CN113929758B (en) Potassium ion transporter protein HbRSAR1 and application thereof in regulating potassium transport of plants
CN110923235B (en) Non-coding gene for controlling corn grain filling and application thereof
CN111454966B (en) Cymbidium CgWRKY4 gene and application thereof
CN115197951A (en) Tea tree flavonol synthesis candidate gene CsNAC086 and application thereof
CN102796747A (en) Application of Zea mays L. drought-induced protein (ZmDIP1) gene and its encoding protein
CN111304222A (en) Cymbidium CgWRKY11 gene and application thereof
CN111304220A (en) Cymbidium CgWRKY3 gene and application thereof
CN104531716A (en) Gene OsABAR1 and application thereof in improvement of drought and salt stress tolerance of rice
KR101677482B1 (en) Antibiotic marker-free transgenic rice with over-expressed high affinity phosphate transporter OsPT4 gene from Oryza sativa
KR101602883B1 (en) Antibiotic marker-free transgenic rice with over-expressed high affinity phosphate transporter OsPT7 gene from Oryza sativa

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant