CN113512088B - Device and method for continuously producing protein - Google Patents
Device and method for continuously producing protein Download PDFInfo
- Publication number
- CN113512088B CN113512088B CN202110497773.5A CN202110497773A CN113512088B CN 113512088 B CN113512088 B CN 113512088B CN 202110497773 A CN202110497773 A CN 202110497773A CN 113512088 B CN113512088 B CN 113512088B
- Authority
- CN
- China
- Prior art keywords
- liquid
- chamber
- reaction
- protein
- phase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/14—Extraction; Separation; Purification
- C07K1/34—Extraction; Separation; Purification by filtration, ultrafiltration or reverse osmosis
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D61/00—Processes of separation using semi-permeable membranes, e.g. dialysis, osmosis or ultrafiltration; Apparatus, accessories or auxiliary operations specially adapted therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D2311/00—Details relating to membrane separation process operations and control
- B01D2311/10—Temperature control
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/141—Feedstock
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Water Supply & Treatment (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Analytical Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a device and a method for continuously producing protein, which comprises a reaction chamber and a supply chamber which are separated, wherein the supply chamber is matched with a supply unit of a liquid phase supplement system to form a working loop which can supply the liquid phase supplement system to circularly flow; the aeration unit comprises a liquid conveying chamber and a gas conveying chamber which are separated, the liquid conveying chamber is matched with the reaction chamber and a supply unit of the liquid-phase cell-free protein synthesis reaction system to form a working loop for the liquid-phase cell-free protein synthesis reaction system to circularly flow, and an inlet of the gas conveying chamber is communicated with a gas source and is used for inputting working gas containing oxygen; and a reaction temperature control unit at least used for regulating and controlling the temperature of the material exchange unit and the aeration unit. The continuous protein production device and the method provided by the invention enable the continuous exchange type cell-free protein reaction to be more flexible, can greatly improve the ventilation condition in the reaction process, and improve the yield of the protein.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a device and a method for continuously producing protein.
Background
In order to solve the expression problems of cytotoxic proteins, misfolded proteins, and aggregative proteins, a Cell-free protein synthesis (CFPS) system has been developed. The cell-free protein synthesis system is used as an in vitro expression system, uses exogenous DNA or mRNA as a template, utilizes a protein synthesis machine and related enzyme systems in cell extracts, and only adds substances such as amino acid, energy and the like to complete the process of protein synthesis and translation in vitro. Compared with a living cell expression system, the cell-free protein synthesis system does not need to maintain the growth of cells, so the cell-free protein synthesis system has great advantages for expressing cytotoxic protein, and secondly, the reaction system of the cell-free protein synthesis system is simple, the operation is convenient, and the rapid sampling and the direct control of the protein synthesis process can be realized. Therefore, the cell-free protein synthesis system has great application prospect in the aspects of large-scale expression of recombinant drugs, preparation of protein chips and the like.
In 1958, Zamecnik et al demonstrated for the first time that translation machinery, etc. extracted from cells, can regulate in vitro protein synthesis independent of cell structure; in 2001, Roche developed a commercial cell-free protein expression system. The production modes of cell-free protein expression systems can be generally divided into 5 types: batch (Batch), Fed-Batch (Fed-Batch), two-phase (Bilayer), Continuous flow (Continuos-flow), and Continuous exchange (Continuous-exchange). The one-pot production mode is to add various energies, substrates, cell extracts and the like required by protein synthesis into the system at one time, and Nirenberg and the like use the production mode to carry out protein synthesis in 1966, and the yield is generally mu g/mL; the material-supplementing batch-type production mode is that substances consumed by energy, substrates and the like are added into a one-pot reaction system after the reaction of the one-pot reaction system for a period of time; the continuous feeding type production mode is to continuously add substances and energy required by the reaction and remove products or byproducts in the reaction at regular time, and in 1988, Spirin et al use the production mode to prolong the reaction time to 20 hours; the continuous exchange type production mode consists of a reaction solution and a supplementary solution containing energy, a substrate and the like, the reaction solution and the supplementary solution are separated by a semi-permeable membrane, in 1996, Kim et al use a continuous exchange type reactor to prolong the reaction of Catalase (CAT) protein to 14h and produce 1.2mg/mL of Catalase (CAT) protein; the two-layer phase type is produced by coating the reaction solution with a supplement solution of energy and substrate, and the yield of protein is also increased to the mg level by Endo et al in 2002.
In order to solve the problems of short one-pot type cell-free reaction time, low yield and the like, researchers develop reaction modes such as fed-batch and continuous exchange to prolong the cell-free protein production time and improve the protein yield. To date, several commercial cell-free protein expression kits have been available. For example, E.coli S30 Extract System, Premega corporation, MyTXTL from Arbor Biosciences, iPE-Quick Kit from Sigma-Aldrich, and AccuRapid from Bioneer; an Expressway Mini/Maxi kit from Thermo Fisher Scientific, belonging to a fed batch production mode; RTS 100/500/9000e.coli HY kit belonging to biotechrabit corporation which is a continuous exchange type production system.
Most of the current commercialized cell-free protein expression kits are kits in batch production mode, the protein expression system is 50 muL mostly, the reaction time is about 3h, the RTS 100/500/9000E. coli HY kit belonging to the continuous exchange production mode comprises reaction reagents and reaction containers which are expensive, a constant temperature oscillator (Thermo Mixer or RTS ProteoMaster) is required to be matched for reaction, and the reaction volume limited by instruments is 10mL at most; in addition, the reaction vessel provided in the current commercial continuous exchange type cell-free protein kit comprises a reaction chamber and a supply chamber, which are separated by a semi-permeable membrane, and the reaction vessel has no gas exchange with the outside while the reaction is performed, which greatly affects the yield of the protein.
Disclosure of Invention
The invention mainly aims to provide a device and a method for continuously producing protein, so as to overcome the defects in the prior art.
In order to achieve the above object, the embodiment of the present invention adopts a technical solution comprising:
the embodiment of the invention provides a continuous protein production device, which comprises:
the material exchange unit (3) comprises a reaction chamber (31) and a supply chamber (32) which are separated by a semipermeable membrane (2), wherein the reaction chamber (31) is at least used for accommodating a liquid-phase cell-free protein synthesis reaction system, the supply chamber (32) is at least used for accommodating a liquid-phase supplement system, and the supply chamber (32) and a supply unit of the liquid-phase supplement system are matched to form a working loop which can supply the liquid-phase supplement system to circularly flow;
the aeration unit (5) comprises a liquid conveying chamber (51) and a gas conveying chamber (52) which are separated by a separation mechanism (4) formed by a gas-permeable hydrophobic material, the liquid conveying chamber (51), the reaction chamber (31) and a supply unit of the liquid-phase cell-free protein synthesis reaction system are matched to form a working loop for the liquid-phase cell-free protein synthesis reaction system to circularly flow, the inlet of the gas conveying chamber (52) is communicated with a gas source (10) and is used for inputting working gas containing oxygen, and the outlet of the gas conveying chamber is used for discharging waste gas containing carbon dioxide; and
a reaction temperature control unit (9) at least used for regulating and controlling the temperature of the substance exchange unit (3) and the aeration unit (5).
Further, the supply unit of the liquid-phase cell-free protein synthesis reaction system comprises a container (7) for accommodating the liquid-phase cell-free protein synthesis reaction system, the inlet of the reaction chamber (31) is communicated with the inlet of the liquid conveying chamber (51) through a liquid conveying pump (1), the outlet of the reaction chamber is communicated with the inlet of the liquid conveying chamber (51), and the outlet of the liquid conveying chamber (51) is communicated with the container (7); and/or the supply unit of the liquid phase supplement system comprises a container (8) for accommodating the liquid phase supplement system, and the inlet and the outlet of the supply chamber (32) are communicated with the container (8).
Further, the substance exchange unit (3) has a chamber which is divided into a reaction chamber (31) and a supply chamber (32) by a semipermeable membrane (2), and the chamber wall of the chamber is formed by a gas-permeable hydrophobic material; and/or the ventilation unit (5) is provided with a chamber which is divided into a liquid conveying chamber (51) and a gas conveying chamber (52) by a separating mechanism (4), and the chamber wall of the chamber is formed by air-permeable hydrophobic materials.
Further, the gas source (10) is communicated with the inlet of the gas conveying chamber (52) through a gas conveying pump (6).
The embodiment of the invention also provides a method for continuously producing the protein, which comprises the following steps:
providing the continuous protein production device;
injecting the liquid-phase cell-free protein synthesis reaction system provided by the supply unit of the liquid-phase cell-free protein synthesis reaction system into the reaction chamber (31) and the liquid conveying chamber (51), and circularly performing protein expression in the reaction chamber (31) and the liquid conveying chamber (51);
injecting the liquid phase supplement system provided by the supply unit of the liquid phase supplement system into the supply chamber (32) to exchange substances with the liquid phase cell-free protein synthesis reaction system in the reaction chamber (31);
working gas is input into the gas conveying chamber (52) by a gas source (10) so as to provide oxygen for the liquid-phase cell-free protein synthesis reaction system in the liquid conveying chamber (51) and remove carbon dioxide in the liquid-phase cell-free protein synthesis reaction system; and
the temperature of the material exchange unit (3) and the aeration unit (5) is regulated and controlled by a reaction temperature control unit (9).
Further, in the case of performing the protein expression, the reaction temperature used is 0 to 60 ℃.
Further, the working gas contains 0-100v/v% oxygen, and the balance nitrogen.
Further, the liquid-phase cell-free protein synthesis reaction system circulates in the reaction chamber (31) and the liquid conveying chamber (51) for protein expression for 2-48 h.
Compared with the prior art, the invention has the following beneficial effects:
(1) the device and the method for continuously producing the protein combine a continuous exchange reaction mode with aeration, oxygen can continuously enter a reaction system to participate in the expression of substrate protein while continuously providing energy and removing reaction byproducts, carbon dioxide generated by the reaction can be quickly removed from a flow system through an aeration unit, and the expression temperature is controlled by a heating or cooling reaction container; the continuous exchange type cell-free protein reaction is more flexible, the aeration condition in the reaction process can be greatly improved, and the yield of the protein is improved.
(2) The protein continuous production device can carry out continuous exchange type cell-free protein reaction without purchasing an expensive kit under the condition of the existing cell-free protein expression reagent, and the reaction can be carried out by a liquid delivery pump without the limitation of the volume of a matched instrument, so that the reaction volume can be randomly enlarged, and a protein expression system is enlarged.
Drawings
In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the description below are only some embodiments described in the present application, and other drawings can be obtained by those skilled in the art without creative efforts.
FIG. 1 is a schematic view of a protein continuous production apparatus according to an embodiment of the present application.
FIG. 2 is a map of an expression plasmid in one embodiment of the present application.
FIG. 3 is a polyacrylamide gel electrophoresis (SDS-PAGE) of the synthesized fluorescent protein sfGFP-hUTI (Marker on the left is a protein molecular weight standard, 1 is a protein band of the fluorescent protein sfGFP-hUTI of example, 2 is a protein band of the fluorescent protein sfGFP-hUTI of comparative example 1, and 3 is a protein band of the fluorescent protein sfGFP-hUTI of comparative example 2).
FIG. 4 is a polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis chart of the synthesis of various proteins of interest (Marker on the left is a protein molecular weight standard, 1 is recombinant human urinary trypsin inhibitor (rhUTI), 2 is phi29DNA polymerase, 3 is T7RNA polymerase, 4 is recombinant disulfide isomerase (DsbC), and 5 is FKBP-type peptidyl prolyl cis-trans isomerase (FkpA)).
Description of reference numerals: 1. the device comprises a liquid delivery pump, a semi-permeable membrane, a substance exchange unit, a reaction chamber, a substance supply chamber, a gas-permeable hydrophobic material separation mechanism, a gas ventilation unit, a liquid delivery chamber 51, a gas delivery chamber 52, a gas delivery chamber 6, a gas delivery pump 7, a container for containing a liquid-phase cell-free protein synthesis reaction system, a container 8 for containing a liquid-phase supplement system, a reaction temperature control unit 9, a reaction temperature control unit 10 and a gas source.
Detailed Description
The present invention will be more fully understood from the following detailed description, which should be read in conjunction with the accompanying drawings. Detailed embodiments of the present invention are disclosed herein; however, it is to be understood that the disclosed embodiments are merely exemplary of the invention, which may be embodied in various forms. Therefore, specific functional details disclosed herein are not to be interpreted as limiting, but merely as a basis for the claims and as a representative basis for teaching one skilled in the art to variously employ the present invention in virtually any appropriately detailed embodiment.
In view of the problems of limited volume of a reaction vessel, limited gas circulation rate in the cell-free synthesis process and incapability of timely removing carbon dioxide generated in the synthesis process in the prior art, the inventor of the invention has made extensive research and practice to provide the technical scheme of the invention, which mainly combines a continuous exchange type reaction mode with aeration, so that oxygen can continuously enter a reaction system to participate in the expression of substrate protein while continuously providing energy and removing reaction byproducts, and carbon dioxide generated by the reaction can be rapidly removed from the flow system through an aeration unit, wherein the expression temperature is controlled by heating or cooling the reaction vessel. The technical solution, its implementation and principles will be further explained as follows.
Example 1
Referring to fig. 1, a protein continuous production apparatus according to an embodiment of the present invention includes a substance exchange unit 3, an aeration unit 5, a liquid supply unit, a reaction temperature control unit 9, and a gas source 10; the substance exchange unit 3 comprises a reaction chamber 31 and a supply chamber 32 which are separated by a semipermeable membrane (cellulose lipidic membrane) 2 with the aperture of 10KDa, wherein the reaction chamber 31 is at least used for accommodating a liquid-phase cell-free protein synthesis reaction system, the supply chamber 32 is at least used for accommodating a liquid-phase supplement system, and the supply chamber 32 and a supply unit of the liquid-phase supplement system are matched to form a working loop which can supply the liquid-phase supplement system to circularly flow.
The aeration unit 5 comprises a liquid conveying chamber 51 and a gas conveying chamber 52 which are separated by a separation mechanism 4 formed by a gas-permeable hydrophobic material (polydimethylsiloxane (PDMS)), the liquid conveying chamber 51, the reaction chamber 31 and a supply unit of the liquid-phase cell-free protein synthesis reaction system are matched to form a working loop for the liquid-phase cell-free protein synthesis reaction system to circularly flow, the inlet of the gas conveying chamber 52 is communicated with a gas source 10 and used for inputting working gas containing oxygen, the outlet of the gas conveying chamber is used for discharging waste gas containing carbon dioxide, and the gas source 10 is communicated with the inlet of the gas conveying chamber 52 through a gas conveying pump 6; and a reaction temperature control unit 9 for regulating at least the temperatures of the substance exchange unit 3 and the aeration unit 5.
In the present embodiment, the supply unit of the liquid-phase cell-free protein synthesis reaction system includes a container 7 for accommodating the liquid-phase cell-free protein synthesis reaction system, the inlet of the reaction chamber 31 is communicated with the inlet of the liquid conveying chamber 51 via the liquid conveying pump (peristaltic pump) 1, the outlet is communicated with the inlet of the liquid conveying chamber 51, and the outlet of the liquid conveying chamber 51 is communicated with the container 7; the supply unit of the liquid phase replenishment system includes a container 8 for accommodating the liquid phase replenishment system, and the inlet and the outlet of the supply chamber 32 are both communicated with the container 8.
In the specific implementation, the substance exchange unit 3 has a chamber, which is divided into a reaction chamber 31 and a supply chamber 32 by the semipermeable membrane 2, and the chamber wall of the chamber is formed by gas-permeable hydrophobic material (polydimethylsiloxane); the aeration unit 5 has a chamber partitioned into a liquid transport chamber 51 and a gas transport chamber 52 by the partition mechanism 4, and the chamber wall of the chamber is formed of a gas-permeable hydrophobic material (polydimethylsiloxane).
Example 2: human urinary trypsin inhibitor (hUTI) expression with fluorescent protein (sfGFP)
As an example of the protein continuous production method, the continuous exchange method using the protein continuous production apparatus shown in example 1 was performed, and protein synthesis was performed using an E.coli extract.
1. Expression vector
In the present invention, the sfGFP-hUTI gene expression vector is used for the production of cell-free proteins. The sfGFP-rhUTI expression vector was used to confirm the feasibility of the application of the present invention to the production of cell-free proteins.
The expression vector construction process is as follows:
(1) searching cDNA of a human urinary trypsin inhibitor in GeneBank, adding a histidine tag and sfGFP base at the N terminal, and carrying out gene synthesis on the genes, wherein the gene synthesis sequence is shown as SEQ ID NO: 1.
(2) as pIJ 8660F: GGTGACGAAGAACTGCTGtaaGGATCCGAATTCAAGCTTtg and pIJ 8660R: GCTGTGATGATGATGATGATGCATGGTATATCTCCTTCTTAAAG are upstream and downstream primers (homologous complementary segments are introduced respectively), and PCR amplification is carried out with the vector pIJ8660 as a template. 1.0uL of the template, 2.5 uL of 10 uM upstream and downstream primers, 25 uL of LPCR polymerase Q5High-Fidelity2XMastermix (NEB, USA), and sterile water were added to the reaction mixture to a volume of 50 uL. Pre-denaturation at 98 ℃ for 30s, then denaturation at 98 ℃ for 10s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 2min and final extension at 72 ℃ for 2min, wherein the whole PCR reaction system is subjected to 35 cycles. After the amplified product is treated by DpnI enzyme to eliminate the template, DNA gel cutting purification is carried out after 1% agarose gel electrophoresis inspection, and a linear plasmid pIJ8660 (the map is shown in figure 2) is obtained.
(3) And (3) a linear plasmid pIJ8660 which is similar to the synthetic gene SEQ ID NO: 1 Gibson assembly: 10 μ g of lgipsonassembymastemix (2X) (NEB, USA), the linear plasmid pIJ8660 described above, seq id no: 1 is added according to the molar ratio of 1: 3, the reaction solution is fixed to 20 mu L by using sterile water, and the temperature is kept for 1h at 50 ℃.
(4) And (3) transforming the ligation product obtained in the step (3) into an escherichia coli competent cell DH5 alpha, culturing at 37 ℃ for 16h, selecting a positive clone, and obtaining a recombinant plasmid pIJ8660-sfGFP-hUTI after the positive clone is verified to be correct by sequencing.
2. Preparation of cell lysate
Escherichia coli BL21(DE3) was cultured in 1L of 2 × YT medium (16g of peptone, 10g of yeast extract, 5g of sodium chloride, 7g of dipotassium hydrogenphosphate, 3g of monopotassium hydrogenphosphate, pH 7.2) at 37 ℃ and 220rpm until OD600 reached 0.6-0.8, 1mM of isopropyl-. beta. -D thiogalactopyranoside (IPTG) was added to induce expression of T7RNA polymerase, and when OD600 reached 3-3.5, 5000g of the mixture was centrifuged for 15min to harvest the cells, and the supernatant was discarded. The cells were washed 3 times with BufferA (10mM Tris, 14mM magnesium acetate, 60mM potassium glutamate, 2mM dithiothreitol, pH 8.2), weighed for wet weight, and stored in a freezer at-80 ℃. 1.1 mM LBufferb (10mM Tris, 14mM magnesium acetate, 60mM potassium glutamate, 1mM dithiothreitol, pH 8.2) is taken to suspend 1g of thallus again, the thallus is crushed by a high pressure homogenizer, the thallus is centrifuged for 10min at 4 ℃ and 12000g, the supernatant is taken to be kept still at 37 ℃ for incubation for 30min, then the thallus is centrifuged for 10min at 4 ℃ and 12000g, and the supernatant is taken as an Escherichia coli lysate. Store to-80 ℃ freezer until cell lysate is used.
3. Preparation of continuous cell-free protein expression system solution
3-1: preparation of the solution of the reaction System
The expression system comprises the following components: 40 ng/. mu.LpIJ 8660-sfGFP-hUTI, 10mM phosphate buffer, 1.2mM ATP, 0.85mM UTP, 0.85mM CTP, 0.85mM GTP, 280mM potassium glutamate, 8mM magnesium glutamate, 2.7mM potassium oxalate, 2mM amino acid mixture, 25% by volume of Escherichia coli extract.
3-2: preparation of solutions of make-up systems
The makeup solution composition was as follows: 10mM phosphate buffer, 1.2mM ATP, 0.85mM UTP, 0.85mM CTP, 0.85mM GTP, 280mM potassium glutamate, 8mM magnesium glutamate, 2.7mM potassium oxalate, 2mM amino acid mixture, 25% by volume of BufferB (10mM tris, 14mM magnesium acetate, 60mM potassium glutamate, 1mM dithiothreitol, pH 8.2). The volume ratio of the reaction system to the supplement system is 1: 10.
4. Continuous exchange type cell-free protein expression sfGFP-hUTI protein expression
3mL of reaction system and 30mL of supplementary liquid system for synthesizing fluorescent protein are respectively and continuously injected into the reaction chamber 31 and the supply chamber 32 of the substance exchange unit 3 through the peristaltic pump 1, wherein the reaction chamber 31 is connected with the liquid conveying chamber 51 of the aeration unit 5, the reaction liquid circulates in the substance exchange unit 3 and the aeration unit 5 through the liquid conveying pump (peristaltic pump) 1, the peristaltic speed is 1.5mL/min, the gas source device 10 is filled with a gas mixture with the oxygen volume fraction of 21% at 40mL/min, and the reaction temperature is maintained at 30 ℃. And after 24 hours of expression, taking out the reaction system, centrifuging, and separating supernatant and precipitate, wherein the supernatant contains the expressed fluorescent protein.
5. Purification of sfGFP-hUTI proteins
Taking 500 mu L of nickel column, centrifuging 6000g for 30s, and removing supernatant; resuspend the nickel column with 250. mu.L phosphate buffered saline, centrifuge at 6000g for 30s and repeat washing 2 times, add 500. mu.L washed nickel column to the reaction supernatant, shake slowly on a shaker at 4 ℃ for 1h to bind the histidine-tagged target protein sufficiently. After 1h, centrifuging to remove the supernatant, adding 1mL of 20mM imidazole wash (50mM sodium dihydrogen phosphate, 300mM sodium chloride, 20mM imidazole) to resuspend the gel, centrifuging to remove the supernatant, and repeating the washing 5 times; 500 μ L of 500mM imidazole eluent (50mM sodium dihydrogen phosphate, 300mM sodium chloride, 500mM imidazole) was added, the gel was gently resuspended, and the supernatant was collected by centrifugation. The supernatant is the purified fluorescent protein.
6. Determination of the production of the fluorescent protein sfGFP
The obtained purified sample is subjected to SDS-PAGE electrophoresis experiment, and the expression quantity of the sfGFP-hUTI protein is measured to be 1.2mg/mL by using a Coomassie brilliant blue protein concentration determination kit.
7. Feasibility of producing other proteins
In addition to sfGFP-hUTI proteins, the present invention also allows the synthesis of other proteins (FIG. 4).
Example 3 expression of human urinary trypsin inhibitor (hUTI) with fluorescent protein (sfGFP) (lower parameter Range of cell-free reaction System)
The expression vector construction, the preparation of cell lysate and the experimental method for the expression and purification of sfGFP-hUTI protein expressed by continuous exchange type cell-free protein are as described in example 2, and the concentrations of the following components are changed:
preparation of the solution of the reaction System
The expression system comprises the following components: 5 ng/. mu.LpIJ 8660-sfGFP-hUTI, 2mM phosphate buffer, 0.5mM ATP, 0.5mM UTP, 0.5mM CTP, 0.5mM GTP, 50mM potassium glutamate, 0.5mM magnesium glutamate, 0.5mM potassium oxalate, 0.5mM amino acid mixture, and 15% by volume of Escherichia coli extract.
Preparation of solutions of make-up systems
The make-up solution had the following composition: 2mM phosphate buffer solution, 0.5mM ATP, 0.5mM UTP, 0.5mM CTP, 0.5mM GTP, 50mM potassium glutamate, 0.5mM magnesium glutamate, 0.5mM potassium oxalate, 0.5mM amino acid mixture, and 15% by volume of buffer B (10mM tris, 14mM magnesium acetate, 60mM potassium glutamate, 1mM dithiothreitol, pH 8.2). The volume ratio of the reaction system to the supplement system is 1: 10.
The expression level of sfGFP-hUTI protein was measured to be 1.01mg/mL using a Coomassie Brilliant blue assay kit for protein concentration measurement of the purified sample.
Example 4 expression of human urinary trypsin inhibitor (hUTI) with fluorescent protein (sfGFP) (upper limit of parameter range in cell-free reaction System)
The experimental method for expression vector construction, cell lysate preparation and continuous exchange type cell-free protein expression sfGFP-hUTI protein expression purification was as described in example 2, and the concentrations of the following components were changed:
preparation of the solution of the reaction System
The expression system comprises the following components: 100 ng/. mu.LpIJ 8660-sfGFP-hUTI, 100mM phosphate buffer, 1.5mM ATP, 1.5mM UTP, 1.5mM CTP, 1.5mM GTP, 350mM potassium glutamate, 20mM magnesium glutamate, 10mM potassium oxalate, 3mM amino acid mixture, and 50% by volume of Escherichia coli extract.
Preparation of solutions of make-up systems
The make-up solution had the following composition: 100mM phosphate buffer, 1.5mM ATP, 1.5mM UTP, 1.5mM CTP, 1.5mM GTP, 350mM potassium glutamate, 20mM magnesium glutamate, 10mM potassium oxalate, 3mM amino acid mixture, 50% by volume of BufferB (10mM tris, 14mM magnesium acetate, 60mM potassium glutamate, 1mM dithiothreitol, pH 8.2). The volume ratio of the reaction system to the supplement system is 1: 10.
The expression level of sfGFP-hUTI protein was measured to be 1.25mg/mL using a Coomassie Brilliant blue assay kit for protein concentration measurement of the purified sample.
Comparative example 1
Batch-wise E.coli cell-free protein expression using a constant temperature shaker and 96-well cell culture plates
1. Expression vector
The recombinant plasmid pIJ8660-sfGFP-hUTI from example 2 was used as an expression vector.
2. Preparation of cell lysate
Escherichia coli BL21(DE3) was cultured in 1L of 2 YT medium (16g of peptone, 10g of yeast extract, 5g of sodium chloride, 7g of dipotassium hydrogenphosphate, 3g of potassium dihydrogenphosphate, pH 7.2), at 37 ℃ and 220rpm until OD600 reached 0.6 to 0.8, 1mM of isopropyl-. beta. -D thiogalactopyranoside (IPTG) was added to induce expression of T7RNA polymerase, and when OD600 reached 3 to 3.5, 5000g of the medium was centrifuged for 15min to harvest the cells, and the supernatant was discarded. The cells were washed 3 times with BufferA (10mM Tris, 14mM magnesium acetate, 60mM potassium glutamate, 2mM dithiothreitol, pH 8.2), weighed for wet weight, and stored in a freezer at-80 ℃. 1.1 mM LBufferb (10mM Tris, 14mM magnesium acetate, 60mM potassium glutamate, 1mM dithiothreitol, pH 8.2) is taken to suspend 1g of thallus again, the thallus is crushed by a high pressure homogenizer, the thallus is centrifuged for 10min at 4 ℃ and 12000g, the supernatant is taken to be kept still at 37 ℃ for incubation for 30min, then the thallus is centrifuged for 10min at 4 ℃ and 12000g, and the supernatant is taken as an Escherichia coli lysate. Store to-80 ℃ freezer until cell lysate is used.
3. Preparation of batch type cell-free protein expression system solution
The expression system comprises the following components: 10 ng/mu LpIJ8660-sfGFP-hUTI template, 10mM phosphate buffer, 1.2mM ATP, 0.85mM UTP, 0.85mM CTP, 0.85mM GTP, 280mM potassium glutamate, 8mM magnesium glutamate, 2.7mM potassium oxalate, 2mM amino acid mixture and 25% by volume of Escherichia coli extract; 100 mu L of the reaction solution is taken to be put into a 96-well culture plate, incubated overnight at 30 ℃ and 1000rpm in a constant temperature oscillator, centrifuged, and the supernatant and the precipitate are separated, wherein the supernatant contains the expressed fluorescent protein.
4. Purification of sfGFP-hUTI proteins
Taking 50 mu L of nickel column, centrifuging 6000g for 30s, and removing supernatant; resuspend the nickel column with 25. mu.L phosphate buffered saline, centrifuge at 6000g for 30s and repeat washing 2 times, add 50. mu.L washed nickel column to the reaction supernatant, shake slowly on a shaker at 4 ℃ for 1h to bind the histidine-tagged target protein sufficiently. After 1h, the supernatant was centrifuged and discarded, 100. mu.L of 20mM imidazole wash (50mM sodium dihydrogen phosphate, 300mM NaCl, 20mM imidazole) was added to resuspend the gel, the supernatant was centrifuged and discarded, and the wash was repeated 5 times; 500 μ L of 500mM imidazole eluent (50mM sodium dihydrogen phosphate, 300mM NaCl, 500mM imidazole) was added, the gel was gently resuspended, and the supernatant was collected by centrifugation. The supernatant is the purified fluorescent protein.
5. Determination of the yield of the fluorescent protein sfGFP-hUTI
The obtained purified sample is subjected to SDS-PAGE electrophoresis experiment, and the expression quantity of the sfGFP-hUTI protein is measured to be 0.8mg/mL by using a Coomassie brilliant blue protein concentration determination kit.
Comparative example 2
A continuous exchange reaction was carried out using a 10kDa dialysis tube (Slide-A-lyzeridiosdevices, Thermoscientific).
1. Expression vector
The recombinant plasmid pIJ8660-sfGFP-hUTI in the example was taken as an expression vector.
2. Preparation of cell lysate
Escherichia coli BL21(DE3) was cultured in 1L of 2 × YT medium (16g of peptone, 10g of yeast extract, 5g of sodium chloride, 7g of dipotassium hydrogenphosphate, 3g of monopotassium hydrogenphosphate, pH 7.2) at 37 ℃ and 220rpm until OD600 reached 0.6-0.8, 1mM of isopropyl-. beta. -D thiogalactopyranoside (IPTG) was added to induce expression of T7RNA polymerase, and when OD600 reached 3-3.5, 5000g of the mixture was centrifuged for 15min to harvest the cells, and the supernatant was discarded. The cells were washed 3 times with BufferA (10mM Tris, 14mM magnesium acetate, 60mM potassium glutamate, 2mM dithiothreitol, pH 8.2), weighed for wet weight, and stored in a freezer at-80 ℃. 1.1 mM LBufferb (10mM Tris, 14mM magnesium acetate, 60mM potassium glutamate, 1mM dithiothreitol, pH 8.2) is taken to suspend 1g of thallus again, the thallus is crushed by a high pressure homogenizer, the thallus is centrifuged for 10min at 4 ℃ and 12000g, the supernatant is taken to be kept still at 37 ℃ for incubation for 30min, then the thallus is centrifuged for 10min at 4 ℃ and 12000g, and the supernatant is taken as an Escherichia coli lysate. Store to-80 ℃ freezer until cell lysate is used.
3. Preparation of continuous cell-free protein expression system solution
3-1: preparation of the solution of the reaction System
The expression system comprises the following components: 10 ng/. mu.LpIJ 8660-sfGFP-hUTI template, 10mM phosphate buffer, 1.2mM ATP, 0.85mM UTP, 0.85mM CTP, 0.85mM GTP, 280mM potassium glutamate, 8mM magnesium glutamate, 2.7mM potassium oxalate, 2mM amino acid mixture, 25% by volume of Escherichia coli extract.
3-2: preparation of solutions of make-up systems
The make-up solution had the following composition: 10mM phosphate buffer solution, 1.2mM ATP, 0.85mM UTP, 0.85mM CTP, 0.85mM GTP, 280mM potassium glutamate, 8mM magnesium glutamate, 2.7mM potassium oxalate, 2mM amino acid mixture and 25% by volume of buffer B. The volume ratio of the reaction system to the supplement system is 1: 10.
4. Continuous exchange type cell-free protein expression sfGFP-hUTI protein expression
Add 100. mu.L of the reaction to a dialysis tube, add 1mL of the replenishment solution to a 2mL sterile centrifuge tube, place the dialysis tube in the centrifuge tube to ensure contact of the semi-permeable membrane with the replenishment solution and maintain the reaction temperature at 30 ℃. And after 24 hours of expression, taking out the reaction system, centrifuging, and separating supernatant and precipitate, wherein the supernatant contains the expressed fluorescent protein.
5. Determination of the yield of the fluorescent protein sfGFP-hUTI
The obtained purified sample is subjected to SDS-PAGE electrophoresis experiment, and the expression quantity of the sfGFP-hUTI protein is measured to be 0.32mg/mL by using a Coomassie brilliant blue protein concentration determination kit.
The results of comparison of the reaction conditions and the protein expression amounts of the synthetic proteins of example 2, comparative example 1 and comparative example 2 are shown in the following table.
As can be seen from the above table, by the continuous production method of the protein of the present invention, it is preferable to prolong the reaction duration and to increase the yield of the protein.
The aspects, embodiments, features and examples of the present invention should be considered as illustrative in all respects and not intended to be limiting of the invention, the scope of which is defined only by the claims. Other embodiments, modifications, and uses will be apparent to those skilled in the art without departing from the spirit and scope of the claimed invention.
The use of headings and chapters in this disclosure is not meant to limit the disclosure; each section may apply to any aspect, embodiment, or feature of the disclosure.
Throughout this specification, where compositions are described as having, containing, or comprising specific components, or where processes are described as having, containing, or comprising specific process steps, it is contemplated that compositions taught by the present invention also consist essentially of, or consist of, the recited components, and that processes taught by the present invention also consist essentially of, or consist of, the recited process steps.
Unless specifically stated otherwise, use of the terms "comprising", "including", "having" or "having" is generally to be understood as open-ended and not limiting.
It should be understood that the order of steps or the order in which particular actions are performed is not critical, so long as the teachings of the invention remain operable. Further, two or more steps or actions may be performed simultaneously.
In addition, the inventors of the present invention have also made experiments with other materials, process operations, and process conditions described in the present specification with reference to the above examples, and have obtained preferable results.
While the invention has been described with reference to illustrative embodiments, it will be understood by those skilled in the art that various other changes, omissions and/or additions may be made and substantial equivalents may be substituted for elements thereof without departing from the spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from its scope. Therefore, it is intended that the invention not be limited to the particular embodiment disclosed for carrying out this invention, but that the invention will include all embodiments falling within the scope of the appended claims. Moreover, unless specifically stated any use of the terms first, second, etc. do not denote any order or importance, but rather the terms first, second, etc. are used to distinguish one element from another.
Sequence listing
<110> Perot biotech, Suzhou Ltd
<120> protein continuous production device and method
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1245
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
atgcatcatc atcatcatca cagcagcggc ctggtgccac gaggaagcca tatgatgcgt 60
aaaggcgaag agctgttcac tggtgtcgtc cctattctgg tggaactgga tggtgatgtc 120
aacggtcata agttttccgt gcgtggcgag ggtgaaggtg acgcaactaa tggtaaactg 180
acgctgaagt tcatctgtac tactggtaaa ctgccggtac cttggccgac tctggtaacg 240
acgctgactt atggtgttca gtgctttgct cgttatccgg accatatgaa gcagcatgac 300
ttcttcaagt ccgccatgcc ggaaggctat gtgcaggaac gcacgatttc ctttaaggat 360
gacggcacgt acaaaacgcg tgcggaagtg aaatttgaag gcgataccct ggtaaaccgc 420
attgagctga aaggcattga ctttaaagaa gacggcaata tcctgggcca taagctggaa 480
tacaatttta acagccacaa tgtttacatc accgccgata aacaaaaaaa tggcattaaa 540
gcgaatttta aaattcgcca caacgtggag gatggcagcg tgcagctggc tgatcactac 600
cagcaaaaca ctccaatcgg tgatggtcct gttctgctgc cagacaatca ctatctgagc 660
acgcaaagcg ttctgtctaa agatccgaac gagaaacgcg atcatatggt tctgctggag 720
ttcgtaaccg cagcgggcat cacgcatggt atggatgaac tgtacaaagg tggtggtggt 780
tctggtggtg gtggttctgg tggtggtggt tctgctgttc tgccgcagga agaagaaggt 840
tctggtggtg gtcagctggt taccgaagtt accaaaaaag aagactcttg ccagctgggt 900
tactctgctg gtccgtgcat gggtatgacc tctcgttact tctacaacgg tacctctatg 960
gcttgcgaaa ccttccagta cggtggttgc atgggtaacg gtaacaactt cgttaccgaa 1020
aaagaatgcc tgcagacctg ccgtaccgtt gctgcttgca acctgccgat cgttcgtggt 1080
ccgtgccgtg ctttcatcca gctgtgggct ttcgacgctg ttaaaggtaa atgcgttctg 1140
ttcccgtacg gtggttgcca gggtaacggt aacaaattct actctgaaaa agaatgccgt 1200
gaatactgcg gtgttccggg tgacggtgac gaagaactgc tgtaa 1245
Claims (9)
1. A method for continuously producing a protein, comprising:
providing a protein continuous production device which comprises
A substance exchange unit (3), the substance exchange unit (3) having a chamber which is divided into a reaction chamber (31) and a supply chamber (32) by a semipermeable membrane (2), and the chamber wall of which is formed of a gas-permeable, hydrophobic material; the reaction chamber (31) is at least used for accommodating a liquid-phase cell-free protein synthesis reaction system, the supply chamber (32) is at least used for accommodating a liquid-phase supplement system, and the supply chamber (32) is matched with a supply unit of the liquid-phase supplement system to form a working loop which can allow the liquid-phase supplement system to circularly flow;
a ventilation unit (5), wherein the ventilation unit (5) is provided with a chamber, the chamber is divided into a liquid conveying chamber (51) and a gas conveying chamber (52) by a separation mechanism (4), and the chamber wall of the chamber is formed by a gas-permeable hydrophobic material; the liquid conveying chamber (51), the reaction chamber (31) and a supply unit of the liquid-phase cell-free protein synthesis reaction system are matched to form a working loop for the liquid-phase cell-free protein synthesis reaction system to flow circularly, the inlet of the gas conveying chamber (52) is communicated with a gas source (10) through a gas conveying pump (6) and is used for inputting working gas containing oxygen, and the outlet is used for discharging waste gas containing carbon dioxide; and
a reaction temperature control unit (9) at least for regulating the temperature of the substance exchange unit (3) and the aeration unit (5);
wherein the supply unit of the liquid-phase cell-free protein synthesis reaction system comprises a container (7) for accommodating the liquid-phase cell-free protein synthesis reaction system, the inlet of the reaction chamber (31) is communicated with the container (7) through a liquid conveying pump (1), the outlet is communicated with the inlet of a liquid conveying chamber (51), and the outlet of the liquid conveying chamber (51) is communicated with the container (7);
the supply unit of the liquid phase supplement system comprises a container (8) for accommodating the liquid phase supplement system, and an inlet and an outlet of the supply chamber (32) are communicated with the container (8);
injecting the liquid-phase cell-free protein synthesis reaction system provided by the supply unit of the liquid-phase cell-free protein synthesis reaction system into the reaction chamber (31) and the liquid conveying chamber (51), and circularly performing protein expression in the reaction chamber (31) and the liquid conveying chamber (51);
injecting the liquid phase supplement system provided by the supply unit of the liquid phase supplement system into the supply chamber (32) to exchange substances with the liquid phase cell-free protein synthesis reaction system in the reaction chamber (31);
working gas is input into the gas conveying chamber (52) by a gas source (10) so as to provide oxygen for the liquid-phase cell-free protein synthesis reaction system in the liquid conveying chamber (51) and remove carbon dioxide in the liquid-phase cell-free protein synthesis reaction system; and
the temperature of the material exchange unit (3) and the aeration unit (5) is regulated and controlled by a reaction temperature control unit (9).
2. The continuous protein production process according to claim 1, characterized in that: the liquid delivery pump (1) is a peristaltic pump.
3. The continuous protein production process according to claim 1, characterized in that: the semipermeable membrane (2) is a cellulose lipid membrane.
4. The continuous protein production process according to claim 1, characterized in that: the breathable hydrophobic material is polydimethylsiloxane.
5. The method for continuously producing protein according to claim 1, wherein the liquid phase cell-free protein synthesis reaction system comprises the following components: 2-100mM of phosphate buffer solution, 0.5-1.5mM of ATP, 0.5-1.5mM of UTP, 0.5-1.5mM of CTP, 0.5-1.5mM of GTP, 50-350mM of potassium glutamate, 0.5-20mM of magnesium glutamate, 0.5-10mM of potassium oxalate, 0.5-3mM of amino acid mixture, 15-50% of volume ratio of escherichia coli extract and 5-100 ng/muL of expression vector.
6. The continuous protein production process according to claim 1, wherein the liquid phase replenishment system comprises the following components: 2-100mM of phosphate Buffer solution, 0.5-1.5mM of ATP, 0.5-1.5mM of UTP, 0.5-1.5mM of CTP, 0.5-1.5mM of GTP, 50-350mM of potassium glutamate, 0.5-20mM of magnesium glutamate, 0.5-10mM of potassium oxalate, 0.5-3mM of amino acid mixture and 15-50% of Buffer B by volume; wherein the Buffer B comprises 10mM tris, 14mM magnesium acetate, 60mM potassium glutamate and 1mM dithiothreitol, and the Buffer B has a pH = 8.2.
7. The continuous protein production process according to claim 5 or 6, characterized in that: when the protein expression is carried out, the reaction temperature is 0-60 ℃.
8. The continuous protein production process according to claim 5 or 6, characterized in that: the working gas comprises 0-100v/v% oxygen, the remainder being nitrogen.
9. The continuous protein production process according to claim 5 or 6, characterized in that: the time for the liquid-phase cell-free protein synthesis reaction system to circularly express the protein in the reaction chamber (31) and the liquid conveying chamber (51) is 2-48 h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110497773.5A CN113512088B (en) | 2021-05-08 | 2021-05-08 | Device and method for continuously producing protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110497773.5A CN113512088B (en) | 2021-05-08 | 2021-05-08 | Device and method for continuously producing protein |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113512088A CN113512088A (en) | 2021-10-19 |
| CN113512088B true CN113512088B (en) | 2022-09-27 |
Family
ID=78063903
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110497773.5A Active CN113512088B (en) | 2021-05-08 | 2021-05-08 | Device and method for continuously producing protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113512088B (en) |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2148649C1 (en) * | 1998-03-31 | 2000-05-10 | Институт белка РАН | Method and apparatus for preparing polypeptides in acellular system (versions) |
| JP4881356B2 (en) * | 2008-08-25 | 2012-02-22 | 株式会社東芝 | Extraction system, extraction method, protein synthesis system, and protein synthesis method |
| WO2015009893A1 (en) * | 2013-07-18 | 2015-01-22 | University Of Florida Research Foundation, Incorporated | Apparatuses and methods for high-throughput protein synthesis |
| CN110283716B (en) * | 2019-06-20 | 2020-11-06 | 清华大学 | Device and method for continuously synthesizing cell-free protein |
-
2021
- 2021-05-08 CN CN202110497773.5A patent/CN113512088B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN113512088A (en) | 2021-10-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101232656B1 (en) | Improved methods of in vitro protein synthesis | |
| KR100749053B1 (en) | Methods of synthesizing cell-free protein | |
| JP4829215B2 (en) | Enhancement of protein expression yield in cell-free protein synthesis system by adding antifoaming agent | |
| Shirokov et al. | Continuous-exchange protein-synthesizing systems | |
| US10287542B2 (en) | Apparatus for automatically preparing cell-free proteins and method for preparing proteins using same | |
| CN106148296A (en) | A kind of production method of glutamine transaminage of recombinating | |
| CN113512088B (en) | Device and method for continuously producing protein | |
| JPH04200390A (en) | Production polypeptide by cell-free polypeptide synthesis system | |
| JP4654449B2 (en) | A method for introducing tyrosine analogs into proteins in a site-specific manner | |
| CN111378708A (en) | Optimized in-vitro cell-free protein synthesis system and application thereof | |
| CN112813012A (en) | Genetically engineered bacterium, preparation method thereof and application thereof in cysteine production | |
| US7074595B2 (en) | General means of labeling protein by using wheat embryo cell-free protein synthesis system | |
| CN108531492A (en) | The method for building active sheep beta-alexin sbd-1 vivoexpressions using class elastin laminin elp | |
| CN113174312A (en) | Protein production device and method | |
| US20220275028A1 (en) | Systems, Methods And Compositions For Recombinant In Vitro Transcription And Translation Utilizing Thermophilic Proteins | |
| CN1346889A (en) | Method for generating active isdime AMV-RT in procaryotic cell | |
| KR101555534B1 (en) | Automatic cell-free protein production instrument | |
| CN102220365A (en) | Prokaryotic expression vector of tryptophan hydroxylase-2 gene | |
| CN1806040A (en) | Extract from cultured mammalian cell, process for preparation thereof and method of cell-free protein synthesis using the extract | |
| CN106632648A (en) | Expression-aiding sequence and cell-free expression ADCY2 protein system thereof | |
| CN112779303B (en) | Method for synthesizing orotic acid by biological enzyme method | |
| JP6978609B2 (en) | New promoters and their uses | |
| Cook et al. | Crystallization and preliminary X-ray investigation of a ubiquitin carrier protein (E2) from Arabidopsis thaliana | |
| CN116042755A (en) | Wheat germ-based in vitro protein expression method | |
| CN116103360A (en) | Method for preparing selenoamino acid by using enzyme method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |