CN113174312A

CN113174312A - Protein production device and method

Info

Publication number: CN113174312A
Application number: CN202110497772.0A
Authority: CN
Inventors: 杜静; 杨修竹; 张忆恒; 贺亮; 其他发明人请求不公开姓名
Original assignee: Suzhou Perotin Biotechnology Co ltd
Current assignee: Suzhou Perotin Biotechnology Co ltd
Priority date: 2021-05-08
Filing date: 2021-05-08
Publication date: 2021-07-27

Abstract

The invention discloses a protein production device and a method, which comprises a reaction chamber, a supplement chamber and a dialysis membrane, wherein the reaction chamber is communicated with a supply device of a liquid-phase cell-free protein synthesis reaction system, and the supplement chamber is communicated with a supply device of a liquid-phase material supplement system; the dialysis membrane is used for separating the reaction chamber from the supplement chamber, byproducts for inhibiting protein synthesis reaction and waste gas such as carbon dioxide generated in the liquid-phase cell-free protein synthesis reaction system can continuously pass through the dialysis membrane to be removed, and substrates required by the protein synthesis reaction in the liquid-phase material supplement system can continuously permeate through the dialysis membrane to be supplemented into the reaction unit. The protein production device and the method provided by the invention combine the continuous feeding type and the continuous exchange type of cell-free protein production to effectively reduce the overall size of the reaction vessel, so that the reaction is more flexible.

Description

Protein production device and method

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a protein production device and method.

Background

In recent years, cell-free protein synthesis (CFPS) has shown great potential and application prospects as a novel protein synthesis method. The major components of the protein synthesis system include crude extracts having basic transcription and translation functions, DNA templates, energy regeneration substances, cofactors, inorganic salts, and the like. Different from the synthesis of protein by living cells in a natural state, the cell-free protein synthesis system is not limited by cell membranes, so that the cell-free protein system is allowed to synthesize the protein harmful to the activity of the cells, genes are easier to edit, the protein synthesis process is better monitored, and the flexibility of the protein synthesis process is greatly improved. Thus, cell-free synthesis systems have faster protein expression rates, higher protein yields, and can synthesize more complex proteins than living cell synthesis methods.

The reaction modes of cell-free protein expression are as follows:

(1) batch reaction (batch): the method is to add a template, a cell extract and an energy buffer solution into a CFPS system for expression of related proteins at one time. The system is closed, both an energy supply system and a substrate can be utilized to the maximum extent, and the amplification of the reaction system and the parallel expression of a plurality of proteins can be realized.

(2) Continuous flow-addition formula (continuous-flow): the production method needs to continuously add substances and energy required by the reaction in the reaction process and regularly remove reaction byproducts, and the reaction time can be prolonged to 20 hours when the production method is applied to escherichia coli and wheat germ CFPS.

(3) Continuous exchange-based reaction (CECF) protein expression in this manner occurs in the reaction solution of a dialysis membrane having selective permeability. Energy and substrate can be continuously supplied through the dialysis membrane, meanwhile, byproducts of reactions such as inorganic small molecules and the like diffuse to the supplementary liquid through the dialysis membrane, and the inhibition effect of metabolites on protein expression is reduced. The method prolongs reaction time and improves protein expression yield.

However, the existing cell-free expression system is difficult to realize large-scale application of protein in terms of cost and yield, and the problems are as follows:

(1) the system of batch reaction (batch) is closed, in the reaction process of the system, required substances cannot be added, energy and substrates are gradually consumed along with the reaction, the accumulation inhibition reaction of metabolites, free phosphate and the like causes short service life of the system, the protein expression system is mostly 50 mu L, the reaction time is about 3h, the protein yield is low, and the protein yield can only reach mu g mL < -1 > generally.

(2) The continuous flow-feeding type (continuous-flow) production mode requires continuous addition of materials and energy required by the reaction and regular removal of reaction byproducts during the reaction process, and the practicality of the continuous flow-feeding mode is severely limited by the complexity of the continuous flow-feeding operation and the device.

(3) The continuous exchange reaction, like the current commercialized rapid translation system of cell-free synthesis system RTS 100/500/9000E.coli HY kit, comprises reaction reagents and reaction containers, needs to be matched with a constant temperature oscillator for reaction, has high cost, has the maximum reaction volume limited by instruments of 10mL, is generally applied to the research fields of protein structure determination, protein crystallization and the like, and when the cell-free system is applied to large-scale production of heterologous proteins by replacing the traditional intracellular gene expression method, the production cost is increased and the competitiveness is reduced due to the requirement of sufficient long-term supplement of energy and reaction substrates.

The existing continuous exchange type cell-free production mode is shown in figure 1, reaction mixtures in a dialysis tube in the system cannot be mixed or stirred, the reaction rate is relatively low, certain volume requirements exist, and the conditions of the reaction system are stricter; the rotor with mixing and stirring functions can generate heat when being stirred in a container filled with supplementary liquid, the temperature of the whole reaction system is uncontrollable and is not suitable for some temperature-sensitive synthetic reactions, the dialysis tube is not reusable, the price of the dialysis tube is expensive, and the cost of each experiment is increased.

In addition, the prior art does not solve the problem of aeration in the reaction process, and oxygen, which is a key component in an Adenosine Triphosphate (ATP) regeneration system, has an important influence on the ATP regeneration process. Insufficient oxygen supply reduces the rate of ATP regeneration, increases deoxyribonucleic acid (DNA) transcription-translation time, and thereby reduces protein yield and synthesis efficiency. At the same time, carbon dioxide generated during protein synthesis may also inhibit metabolic processes, affecting protein expression.

Disclosure of Invention

The invention mainly aims to provide a protein production device and a method so as to overcome the defects in the prior art.

In order to achieve the purpose, the technical scheme adopted by the invention comprises the following steps:

the embodiment of the invention provides a protein production device, which comprises:

a reaction unit including a reaction chamber communicating with a supply device of a liquid-phase cell-free protein synthesis reaction system capable of continuously flowing and performing a protein synthesis reaction in the reaction chamber;

a material replenishing unit comprising a replenishing chamber communicating with a supply device of a liquid phase material replenishing system capable of continuously flowing in the replenishing chamber;

and a substance exchange unit including a dialysis membrane for separating the reaction chamber from the replenishment chamber, wherein byproducts of the protein synthesis reaction-inhibiting reaction and waste gases generated in the liquid-phase cell-free protein synthesis reaction system can be continuously removed through the dialysis membrane, and substrates required for the protein synthesis reaction in the liquid-phase material replenishment system can be continuously replenished into the reaction unit through the dialysis membrane.

Further, the protein production device comprises an integral chamber, the integral chamber is divided into a reaction chamber and a supplement chamber by the dialysis membrane, and the outer side of the integral chamber is fixed by a fixing unit.

Furthermore, a plurality of protrusions are distributed on the surface of the dialysis membrane.

Furthermore, a plurality of inward or outward protrusions are arranged on the inner wall of the reaction chamber and/or the supplement chamber.

Furthermore, the protein production device comprises a reaction chamber with a hollow structure, and a supplementary chamber with a hollow structure formed by a dialysis membrane is arranged in the reaction chamber with the hollow structure.

Further, a hollow ventilation unit formed by a dialysis membrane is arranged in the reaction chamber of the hollow structure, the inlet of the hollow ventilation unit is communicated with a gas source and is used for inputting working gas containing oxygen or other gases, and the outlet of the hollow ventilation unit is used for discharging waste gas containing carbon dioxide or other gases.

The embodiment of the invention also provides a protein production method, which comprises the following steps:

providing the aforementioned protein production apparatus;

injecting the liquid-phase cell-free protein synthesis reaction system provided by the supply equipment of the liquid-phase cell-free protein synthesis reaction system into the reaction chamber, and circularly performing protein expression in the reaction chamber;

injecting the liquid-phase material supplementing system provided by the supply equipment of the liquid-phase material supplementing system into the supplementing chamber, and performing substance exchange with the liquid-phase cell-free protein synthesis reaction system in the reaction chamber;

and working gas is input into the ventilation unit by a gas source so as to provide oxygen for the liquid-phase cell-free protein synthesis reaction system in the reaction chamber and remove carbon dioxide in the liquid-phase cell-free protein synthesis reaction system.

Further, when the protein expression is carried out, the protein expression time is 2-48h, and the working gas contains 0-100 v/v% of oxygen, and the balance is nitrogen or other inert gases.

Compared with the prior art, the invention has the following beneficial effects:

(1) the protein production device and the method of the invention combine the continuous feeding type (continuous-flow) and the continuous exchange type (continuous-exchange) of the cell-free protein production to effectively reduce the overall size of the reaction vessel, so that the reaction is more flexible, the exogenous gene can be continuously and efficiently expressed, the supplementing liquid of amino acid, energy and other substances required by the system is continuously and constantly fed into the human feeding supplementing unit through the peristaltic pump, a certain concentration difference is formed between the two units along with the reaction, the exchange of substances is possible by means of the two units of the dialysis membrane, i.e.by-products and the like which are produced in the reaction unit and which are capable of inhibiting protein synthesis, pass through the dialysis membrane by diffusion (concentration difference) and are rapidly removed from the flowing substance supplement, and the reaction substrates required in the material supplementing unit can be continuously supplied to the reaction unit, so that the whole device is always in a dynamic equilibrium state.

(2) The invention relates to a protein production device and a method, wherein a dialysis membrane is made into a shape with columnar protrusions, the specific surface area of the dialysis membrane is increased, the material exchange rate is improved, a reaction unit and a material supplement unit can also be made into a cavity with columnar protrusions, the contact area of reactants is increased, the material exchange is accelerated, oxygen is provided for the reaction by adding a ventilation unit, waste gases such as carbon dioxide and the like generated by the reaction are removed in time, the reaction proceeding time is prolonged, and the protein expression yield is improved.

Drawings

In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings needed to be used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments described in the present application, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a diagram of a conventional continuous exchange type cell-free production apparatus in the background art of the present application.

Fig. 2 is a schematic structural diagram of a protein production apparatus according to a first embodiment of the present application.

FIG. 3 is a schematic diagram showing the structure of the reaction chamber, the material exchange unit and the replenishment chamber in FIG. 2.

FIG. 4 is a cross-sectional view of the reaction chamber, the substance exchange unit, and the replenishment chamber of FIG. 2.

Fig. 5 is a schematic structural view of a protein production apparatus according to a second embodiment of the present application.

FIG. 6 is a schematic diagram showing the detailed structure of the reaction chamber, the material exchange unit and the replenishment chamber in FIG. 5.

FIG. 7 is a cross-sectional view of the reaction chamber, the substance exchange unit, and the replenishment chamber of FIG. 5.

Fig. 8 is a schematic structural view of a protein production apparatus according to a third embodiment of the present application.

FIG. 9 is a schematic diagram of the reaction chamber, the material exchange unit and the replenishment chamber of FIG. 8.

Fig. 10 is a cross-sectional view taken along fig. 9A-a.

FIG. 11 is a longitudinal sectional view of FIG. 9B-B.

FIG. 12 is a map of an expression plasmid in a comparative example of the present application.

Description of reference numerals: 1. the device comprises a fixing unit, 1-1, a first interface, 1-2, a second interface, 1-3, a third interface, 1-4, a fourth interface, 1-5, screws, 2, a reaction chamber, 2-1, a reaction liquid inlet, 2-2, a reaction liquid outlet, 3, a dialysis membrane, 3-1, a columnar protrusion, 4, a supplement chamber, 4-1, a supplement liquid outlet, 4-2, a supplement liquid inlet, 5, a hollow reaction chamber, 6, a supplement chamber with a hollow structure, 7, a hollow ventilation unit, 8, supply equipment for a liquid-phase cell-free protein synthesis reaction system, 9, supply equipment for a liquid-phase material supplement system, 10, a peristaltic pump, 11, an air source, 12 and a substance exchange unit.

Detailed Description

The present invention will be more fully understood from the following detailed description, which should be read in conjunction with the accompanying drawings. Detailed embodiments of the present invention are disclosed herein; however, it is to be understood that the disclosed embodiments are merely exemplary of the invention, which can be embodied in various forms. Therefore, specific functional details disclosed herein are not to be interpreted as limiting, but merely as a basis for the claims and as a representative basis for teaching one skilled in the art to variously employ the present invention in virtually any appropriately detailed embodiment.

In view of the problems of limited volume and high price of the reaction vessel and the influence on the synthesis efficiency due to the limited gas circulation rate in the cell-free synthesis process in the prior art, the inventors of the present invention have made extensive research and practice to provide a technical solution of the present invention, which mainly combines the continuous flow-in (continuous-flow) and continuous exchange (continuous-exchange) for cell-free protein production to effectively reduce the overall size of the reaction vessel so as to make the reaction more flexible. The technical solution, its implementation and principles will be further explained as follows.

Comparative example:

a continuous exchange reaction was carried out using a 10kD dialysis tube (Slide-A-lyzeridiosdevices, Thermoscientific).

1. Expression vector

In the present invention, the sfGFP-hUTI gene expression vector is used for the production of cell-free proteins. The sfGFP-rhUTI expression vector was used to confirm the feasibility of the application of the present invention to the production of cell-free proteins.

The expression vector construction process is as follows:

(1) searching cDNA of a human urinary trypsin inhibitor in GeneBank, adding 6 His labels and sfGFP bases at the N end, and carrying out gene synthesis on the genes, wherein the gene synthesis sequence is shown as SEQ ID NO: 1.

(2) as pIJ 8660F: GGTGACGAAGAACTGCTGtaaGGATCCGAATTCAAGCTTtg and pIJ 8660R: GCTGTGATGATGATGATGATGCATGGTATATCTCCTTCTTAAAG are upstream and downstream primers (homologous complementary segments are introduced respectively), and PCR amplification is carried out with the vector pIJ8660 as a template. mu.L of the template, 2.5. mu.L of 10. mu.M upstream and downstream primers, 25. mu.L of LPCR polymerase Q5High-Fidelity2XMastermix (NEB, USA), and sterile water were added to bring the volume to 50. mu.L. Pre-denaturation at 98 ℃ for 30s, then denaturation at 98 ℃ for 10s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 2min and final extension at 72 ℃ for 2min, wherein the whole PCR reaction system is subjected to 35 cycles. And (3) after the amplified product is treated by DpnI enzyme to eliminate a template, carrying out DNA gel cutting purification after 1% agarose gel electrophoresis inspection, and obtaining a linear plasmid pIJ 8660.

(3) And (3) a linear plasmid pIJ8660 which is similar to the synthetic gene SEQ ID NO: 1 Gibson assembly: mu.L of the linear plasmid pIJ8660 and SEQ ID NO: 1 were added to 10. mu.L of LGibsonassmblyMasterMix (2X) (NEB, USA) at a molar ratio of 1: 3, the reaction was brought to 20. mu.L with sterile water and incubated at 50 ℃ for 1 h.

(4) Transforming the ligation product obtained in the step (3) into an escherichia coli competent cell DH5 alpha, culturing for 16h at 37 ℃, selecting a positive clone, and obtaining a recombinant plasmid piJ8660-sfGFP-hUTI (the map is shown in figure 12) after the positive clone is verified to be correct by sequencing.

2. Preparation of cell lysate

Escherichia coli BL21(DE3) was cultured in 1L of 2 × YT medium (16g of peptone, 10g of yeast extract, 5g of sodium chloride, 7g of K2HPO4, 3gKH2PO4, pH 7.2), cultured at 37 ℃ and 220rpm until OD600 reached 0.6-0.8, added with 1mM of isopropyl-. beta. -D thiogalactopyranoside (IPTG) to induce expression of T7RNA polymerase, cultured until OD600 reached 3-3.5, centrifuged at 5000g for 15min to collect the bacteria, and the supernatant was discarded. The cells were washed 3 times with BufferA (10mM tris, 14mM magnesium acetate, 60mM potassium glutamate, 2mM dtt, pH 8.2), weighed wet, and stored in a freezer at-80 ℃. 1.1mLBufferb (10mMTrisbase, 14mM magnesium acetate, 60mM potassium glutamate, 1mMDTT, pH 8.2) is taken to resuspend 1g of thallus, crushed by a high pressure homogenizer, centrifuged for 10min at 4 ℃ and 12000g, the supernatant is taken to be kept still at 37 ℃ for incubation for 30min, and then centrifuged for 10min at 4 ℃ and 12000g, and the supernatant is taken as an escherichia coli lysate. Store to-80 ℃ freezer until cell lysate is used.

3. Preparation of continuous cell-free protein expression system solution

3-1: preparation of the solution of the reaction System

The expression system comprises the following components: 10 ng/. mu.LpIJ 8660-sfGFP-hUTI template, 10mM phosphate buffer, 1.2mM ATP, 0.85mM UTP, 0.85mM CTP, 0.85mM GTP, 280mM potassium glutamate, 8mM magnesium glutamate, 2.7mM potassium oxalate, 2mM amino acid mixture, 25% by volume of Escherichia coli extract.

3-2: preparation of solutions of make-up systems

The make-up solution had the following composition: 10mM phosphate buffer solution, 1.2mM ATP, 0.85mM UTP, 0.85mM CTP, 0.85mM GTP, 280mM potassium glutamate, 8mM magnesium glutamate, 2.7mM potassium oxalate, 2mM amino acid mixture and 25% by volume of buffer B. The volume ratio of the reaction system to the supplement system is 1: 10.

4. Continuous exchange type cell-free protein expression sfGFP-hUTI protein expression

Add 100. mu.L of the reaction into a dialysis tube, add 1mL of the make-up solution into a 2mL sterile centrifuge tube, place the tube in the centrifuge tube to ensure that the dialysis membrane is in contact with the make-up solution and the reaction temperature is maintained at 30 ℃. And after 24 hours of expression, taking out the reaction system, centrifuging, and separating supernatant and precipitate, wherein the supernatant contains the expressed fluorescent protein.

5. Determination of the yield of the fluorescent protein sfGFP-hUTI

mu.L of the purified fluorescent protein sample was added to a 96-well cell culture plate, 90. mu.L of phosphate buffer was added thereto, and the fluorescence value of sfGFP-hUTI protein measured with a microplate reader was 8.2X 10⁴。

Example 1

Referring to fig. 2, 3 and 4, a protein production apparatus according to an embodiment of the present invention includes a reaction unit, a material supplement unit and a material exchange unit 12, wherein the material reaction unit includes a reaction chamber 2, the reaction chamber 2 is communicated with a supply device 8 of a liquid-phase cell-free protein synthesis reaction system, and the liquid-phase cell-free protein synthesis reaction system is capable of flowing in the reaction chamber 2 and performing a protein synthesis reaction; the material supplementing unit comprises a supplementing chamber 4, the supplementing chamber 4 is communicated with a supply device 9 of a liquid-phase material supplementing system, and the liquid-phase material supplementing system can continuously flow in the supplementing chamber; the substance exchange unit 12 includes a dialysis membrane 3, the dialysis membrane 3 is used for separating the reaction chamber 2 from the replenishment chamber 4, by-products inhibiting protein synthesis reaction and waste gas such as carbon dioxide generated in the liquid-phase cell-free protein synthesis reaction system can continuously pass through the dialysis membrane 3 and be removed, and substrates required for protein synthesis reaction in the liquid-phase material replenishment system can continuously permeate through the dialysis membrane 3 and be replenished into the reaction unit.

In this embodiment, the protein production apparatus comprises an integrated chamber, which is partitioned into a reaction chamber 2 and a replenishment chamber 4 by a dialysis membrane 3, and the outside of which is fixed by a fixing unit 1; the dialysis membrane 3 is a wrinkled dialysis membrane, the wall of the integral chamber is made of Polydimethylsiloxane (PDMS), and the fixing unit 1 is a polymethyl methacrylate (PMMA) plate.

In the specific implementation process, an outlet of a supply device 8 of the liquid-phase cell-free protein synthesis reaction system is communicated with a reaction liquid inlet 2-1 of the reaction chamber 2 through a peristaltic pump 10, and an inlet of the supply device 8 of the liquid-phase cell-free protein synthesis reaction system is communicated with a reaction liquid outlet 2-2 of the reaction chamber 2; an outlet of a supply device 9 of the liquid-phase material supplementing system is communicated with a supplementing liquid inlet 4-2 of the supplementing chamber 4 through a peristaltic pump 10, and an inlet of the supply device 9 of the liquid-phase material supplementing system is communicated with a supplementing liquid outlet 4-1 of the supplementing chamber 4; wherein a curved flow passage, such as an S-shaped flow passage, is formed between the reaction liquid inlet 2-1 and the reaction liquid outlet 2-2, and a curved flow passage is formed between the supplementary liquid inlet 4-2 and the supplementary liquid outlet 4-1.

The fixing unit 1 is also provided with a first interface 1-1, a second interface 1-2, a third interface 1-3 and a fourth interface 1-4 which are respectively arranged corresponding to the reaction liquid inlet 2-1, the reaction liquid outlet 2-2, the supplementary liquid inlet 4-1 and the supplementary liquid outlet 4-2, and the whole chamber is fixed through screws 1-5.

This example implements the continuous exchange method illustrated by FIGS. 2, 3 and 4, and the protein synthesis using E.coli extracts, as follows:

1. expression vector

The recombinant plasmid pIJ8660-sfGFP-hUTI in the comparative example was taken as an expression vector.

2. Preparation of cell lysate

1L of 2 × YT medium (16g peptone, 10g yeast extract, 5g sodium chloride, 7g K)₂HPO₄，3g KH₂PO₄pH 7.2), culturing Escherichia coli BL21(DE3), culturing at 37 deg.C and 220rpm until OD600 value reaches 0.6-0.8, adding 1mM isopropyl-beta-D thiogalactopyranoside (IPTG) to induce expression of T7RNA polymerase, culturing until OD600 reaches 3-3.5, centrifuging at 5000g for 15min to collect the strain, and discarding the supernatant. Using Buffer A (10mM Tris base, 14mM magnesium acetate, 60mM potassium glutamate, 2mM DTT, pH 8.2) the cells were washed 3 times, weighed wet, and stored in a refrigerator at-80 ℃. 1.1mL of BufferB (10mM Tris base, 14mM magnesium acetate, 60mM potassium glutamate, 1mM DTT, pH 8.2) was taken to suspend 1g of the cells, and the cells were disrupted by a high pressure homogenizer, centrifuged at 4 ℃ and 12000g for 10min, the supernatant was taken and incubated at 37 ℃ for 30min, and then centrifuged at 12000g for 10min, and the supernatant was taken as a lysate of Escherichia coli. Store to-80 ℃ freezer until cell lysate is used.

3. Preparation of continuous cell-free protein expression system solution

3-1: preparation of the solution of the reaction System

The expression system comprises the following components: 10 ng/. mu.L pIJ8660-sfGFP-hUTI, 10mM phosphate buffer, 1.2mM ATP, 0.85mM UTP, 0.85mM CTP, 0.85mM GTP, 280mM potassium glutamate, 8mM magnesium glutamate, 2.7mM potassium oxalate, 2mM amino acid mixture, 25% by volume of Escherichia coli extract.

3-2: preparation of solutions of make-up material systems

The make-up solution had the following composition: 10mM phosphate Buffer solution, 1.2mM ATP, 0.85mM UTP, 0.85mM CTP, 0.85mM GTP, 280mM potassium glutamate, 8mM magnesium glutamate, 2.7mM potassium oxalate, 2mM amino acid mixture, and 25% Buffer B by volume. The volume ratio of the reaction system to the supplementary material system is 1: 10.

3mL of reaction system for synthesizing fluorescent protein and 30mL of supplementary liquid system are respectively and continuously injected into a supply device 8 of the liquid-phase cell-free protein synthesis reaction system and a supply device 9 of the liquid-phase material supplementary system to fill a reaction chamber 2 and a supplementary chamber 4 through a peristaltic pump 10, wherein the reaction chamber 2 and the supplementary chamber 4 are communicated through a dialysis membrane 3, the reaction liquid circulates in a reaction unit through the peristaltic pump 10 at a peristaltic speed of 1.5mL/min, and the reaction temperature is maintained at 30 ℃. And after 24 hours of expression, taking out the reaction system, centrifuging, and separating supernatant and precipitate, wherein the supernatant contains the expressed fluorescent protein.

5. Purification of sfGFP-hUTI proteins

Taking 500 mu L of nickel column, 6000g of nickel columnHeart for 30s, removing supernatant; resuspend the nickel column with 250. mu.L phosphate buffer, centrifuge at 6000g for 30s and repeat washing 2 times, add 500. mu.L washed nickel column to the reaction supernatant, shake slowly on a shaker at 4 ℃ for 1h to bind the His-tagged target protein sufficiently. After 1h, the supernatant was centrifuged and washed by adding 1mL of 20mM imidazole (50mM NaH)₂PO₄300mM NaCl, 20mM imidazole) resuspension gel, centrifugation and discarding of supernatant, repeated washing 5 times; 500uL of 500mM imidazole eluent (50mM NaH) was added₂PO₄300mM NaCl, 500mM imidazole), gently resuspending the gel, and centrifuging to collect the supernatant. The supernatant is the purified fluorescent protein.

6. Determination of the fluorescence value of the fluorescent protein sfGFP

Adding 10 μ L of purified fluorescent protein sample into 96-well cell culture plate, adding 90 μ L of phosphate buffer solution, mixing well, and measuring the fluorescence value of sfGFP-hUTI protein with microplate reader to be 2.5 × 10⁵。

Example 2

Referring to fig. 5, 6 and 7, in a protein production apparatus according to an embodiment of the present invention, compared to embodiment 1, the wall of the reaction chamber 2 is provided with inward columnar protrusions 2-3, the wall of the supplementary chamber 4 is provided with inward columnar protrusions 4-3, and both sides of the semi-permeable membrane 3 are also provided with columnar protrusions 3-1; the other structures are unchanged.

The design of the columnar protrusions added on the reaction chamber 2 and the supplement chamber 4 can enlarge the specific surface area of the reaction chamber and the supplement chamber, increase the contact area between reactants and improve the material exchange speed. The specific experimental protocol is the same as example 1, and finally 10. mu.L of the purified fluorescent protein sample is added into a 96-well cell culture plate, 90. mu.L of phosphate buffer is added into the plate, and after uniform mixing, the fluorescence value of the sfGFP-hUTI protein is measured by a microplate reader to be 3.2X 10⁵。

Example 3

Referring to fig. 5, 6 and 7, a protein production apparatus according to an embodiment of the present invention, which changes the structure of the overall chamber compared to embodiment 1, includes a reaction chamber 5 having a hollow structure, and a replenishment chamber 6 having a hollow structure and formed by a dialysis membrane is disposed in the reaction chamber 5 having a hollow structure; a hollow reaction chamber 5 is formed by Polydimethylsiloxane (PDMS), and the chamber walls of the hollow reaction chamber 5 and the hollow supplement chamber 6 are both provided with inward columnar protrusions; in the embodiment, a hollow ventilation unit 7 formed by a dialysis membrane is further arranged in the reaction chamber 5 with a hollow structure, the inlet of the hollow ventilation unit 7 is communicated with a gas source 11 and is used for inputting working gas containing oxygen, and the outlet is used for discharging waste gas containing carbon dioxide.

The whole chamber is changed into a hollow reaction container and a ventilation unit 7 is added, wherein the chamber of the reaction chamber 5 with a hollow structure and the dialysis membrane for communicating the reaction chamber 5 with the supplement chamber 6 with the hollow structure are designed into columnar protrusions so as to increase the specific surface area of the reaction chamber 5 with the hollow structure and improve the reaction rate and the material exchange rate; meanwhile, the reaction chamber is made of Polydimethylsiloxane (PDMS), which has good air permeability and can promote the reaction (or any other air-permeable hydrophobic material with high plasticity meeting the conditions). In addition, the ventilation unit 7 which is newly added can also be added with the design of the columnar protrusion, so that the specific surface area is larger, the ventilation effect is further improved, the reaction is accelerated, and the reaction time is prolonged. Experimental protocol As in example 1, 10. mu.L of purified fluorescent protein sample was added to a 96-well cell culture plate, 90. mu.L of phosphate buffer was added thereto, and after mixing well, the fluorescence value of sfGFP-hUTI protein measured by microplate reader was 4.5X 10⁵。

The results of comparing the reaction conditions of the comparative example and examples 1 to 3 with the fluorescence values of the synthesized proteins are shown in the following table.

As can be seen from the above table, by the protein production method of the present invention, it is preferable to prolong the reaction duration and to increase the yield of the protein.

The aspects, embodiments, features and examples of the present invention should be considered as illustrative in all respects and not intended to be limiting of the invention, the scope of which is defined only by the claims. Other embodiments, modifications, and uses will be apparent to those skilled in the art without departing from the spirit and scope of the claimed invention.

The use of headings and chapters in this disclosure (invention) is not meant to limit the disclosure; each section may apply to any aspect, embodiment, or feature of the disclosure.

Throughout this specification, where a composition is described as having, containing or comprising specific components or where a process is described as having, containing or comprising specific process steps, it is contemplated that the composition taught by the present invention also consists essentially of or consists of the recited components and the process taught by the present invention also consists essentially of or consists of the recited process steps.

Unless specifically stated otherwise, use of the terms "comprising", "including", "having" or "having" is generally to be understood as open-ended and not limiting.

It should be understood that the order of steps or the order in which particular actions are performed is not critical, so long as the teachings of the invention remain operable. Further, two or more steps or actions may be performed simultaneously.

In addition, the inventors of the present invention have also made experiments with other materials, process operations, and process conditions described in the present specification with reference to the above examples, and have obtained preferable results.

While the invention has been described with reference to illustrative embodiments, it will be understood by those skilled in the art that various other changes, omissions and/or additions may be made and substantial equivalents may be substituted for elements thereof without departing from the spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from its scope. Therefore, it is intended that the invention not be limited to the particular embodiment disclosed for carrying out this invention, but that the invention will include all embodiments falling within the scope of the appended claims. Moreover, unless specifically stated any use of the terms first, second, etc. do not denote any order or importance, but rather the terms first, second, etc. are used to distinguish one element from another.

Claims

1. A protein production apparatus, comprising:

2. The protein production apparatus according to claim 1, comprising an integrated chamber which is partitioned into a reaction chamber and a replenishment chamber by the dialysis membrane, and the outside of which is fixed by a fixing unit; and/or the walls of the integral chamber are formed of a gas permeable, hydrophobic material; and/or the fixing unit is a polymethyl methacrylate plate.

3. The protein production device according to claim 2, characterized in that: a plurality of protrusions are distributed on the surface of the dialysis membrane; and/or the inner walls of the reaction chamber and/or the supplement chamber are provided with a plurality of inward or outward protrusions; preferably, the protrusion is columnar.

4. A protein production device according to any one of claims 1 to 3, wherein: an outlet of the supply equipment of the liquid-phase cell-free protein synthesis reaction system is communicated with a reaction liquid inlet of the reaction chamber through a liquid delivery pump, and an inlet of the supply equipment of the liquid-phase cell-free protein synthesis reaction system is communicated with a reaction liquid outlet of the reaction chamber; preferably, a curved flow passage is formed between the reaction liquid inlet and the reaction liquid outlet;

and/or an outlet of the supply device of the liquid-phase material supplementing system is communicated with a supplementing liquid inlet of the supplementing chamber through a liquid delivery pump, and an inlet of the supply device of the liquid-phase material supplementing system is communicated with a supplementing liquid outlet of the supplementing chamber; preferably, the supplementary liquid inlet and the supplementary liquid outlet form a curved flow path therebetween.

5. The protein production apparatus according to claim 4, wherein: the fixed unit is also provided with a first interface, a second interface, a third interface and a fourth interface which are respectively arranged corresponding to the reaction liquid inlet, the reaction liquid outlet, the supplementary liquid inlet and the supplementary liquid outlet.

6. The protein production apparatus according to claim 1, comprising a reaction chamber of hollow structure, wherein a supplementary chamber of hollow structure formed by a dialysis membrane is provided in the reaction chamber of hollow structure; and/or the chamber walls of the reaction chamber are formed from a gas-permeable, hydrophobic material; and/or a plurality of inward protrusions are arranged on the inner walls of the reaction chamber and/or the supplement chamber of the hollow structure; preferably, the protrusion is columnar.

7. The protein production device according to claim 6, characterized in that: and a hollow ventilation unit formed by a dialysis membrane is also arranged in the reaction chamber of the hollow structure, the inlet of the hollow ventilation unit is communicated with a gas source and is used for inputting working gas containing oxygen or other gases, and the outlet of the hollow ventilation unit is used for discharging waste gas containing carbon dioxide or other gases.

8. A method for producing a protein, comprising:

providing a protein production device according to any one of claims 1 to 7;

and inputting working gas into the ventilation unit by using a gas source so as to provide the working gas for the liquid-phase cell-free protein synthesis reaction system in the reaction chamber and exhaust gas in the liquid-phase cell-free protein synthesis reaction system.

9. The protein production method according to claim 8, characterized in that: the liquid-phase cell-free protein synthesis reaction system comprises the following components: 2-100mM of phosphate buffer solution, 0.5-1.5mM of ATP, 0.5-1.5mM of UTP, 0.5-1.5mM of CTP, 0.5-1.5mM of GTP, 50-350mM of potassium glutamate, 0.5-20mM of magnesium glutamate, 0.5-10mM of potassium oxalate, 0.5-3mM of amino acid mixture, 15-50% of volume ratio of escherichia coli extract and 5-100ng/ul of expression vector;

and/or the liquid-phase material supplementing system comprises the following components: 2-100mM of phosphate Buffer solution, 0.5-1.5mM of ATP adenosine triphosphate, 0.5-1.5mM of UTP, 0.5-1.5mM of CTP, 0.5-1.5mM of GTP, 50-350mM of potassium glutamate, 0.5-20mM of magnesium glutamate, 0.5-10mM of potassium oxalate, 0.5-3mM of amino acid mixture and 15-50% of Buffer B by volume.

10. The protein production method according to claim 8 or 9, characterized in that: when the protein expression is carried out, the protein expression time is 2-48h, and/or the working gas contains 0-100 v/v% of oxygen, and the rest is nitrogen or other inert gases.