CN113493762A

CN113493762A - Method for enhancing immune effect of plant and application thereof

Info

Publication number: CN113493762A
Application number: CN202010269871.9A
Authority: CN
Inventors: 辛秀芳; 袁民航; 江泽宇
Original assignee: Center for Excellence in Molecular Plant Sciences of CAS
Current assignee: Center for Excellence in Molecular Plant Sciences of CAS
Priority date: 2020-04-08
Filing date: 2020-04-08
Publication date: 2021-10-12
Anticipated expiration: 2040-04-08
Also published as: CN113493762B

Abstract

The present invention provides methods of modulating ETI in plants and ROS production of reactive oxygen species using as a target a protein or gene or RNA thereof selected from one or more of the group consisting of PRR receptor, PRR co-receptor, BIK1, and RBOHD. The invention also provides a method for regulating and controlling the ETI effect of the plant by regulating and controlling the PTI effect of the plant, thereby enhancing the weaker ETI effect in the plant and improving the disease resistance of the plant.

Description

Method for enhancing immune effect of plant and application thereof

Technical Field

The invention relates to the field of plant immunity to pathogenic microorganisms, in particular to a method for enhancing the immune effect of plants.

Background

In nature, plants have evolved two layers of innate immune systems to combat the invasion by pathogenic microorganisms, the first layer of Immunity being plant Immunity Triggered by Pattern-Recognition Receptors PRRs (Pattern-Recognition Receptors) located on cell membranes by recognizing conserved pathogen-Associated Molecular patterns (pamps) on pathogenic microorganisms, known as Pattern-Triggered Immunity (PTI). PTI has been shown to play a very important role in the disease-resistant immune system of plants. Although plant PTI successfully withstands most pathogenic microorganisms, a few pathogenic microorganisms have evolved corresponding strategies to break through the PTI line of defense: the host plant cells are injected with toxic proteins or effector factors (effects) to inhibit the PTI of the plant. Some effector factors cause perturbations in plants that are recognized, directly or indirectly, by disease-resistant proteins of plant cells, thus initiating an additional layer of immunity of the plant against the invasion of foreign microorganisms: effector-trigger Immunity (ETI). ETI is plant immunity mediated by NLR (nuclear-binding, Leucine-rich Repeat proteins) located in cells specifically recognizing effector factors of pathogenic bacteria.

In previous studies, PTI and ETI were considered to be two distinct immune signaling pathways. In the field of plant disease resistance, the relationship between the two basic immune signaling pathways, PTI and ETI, of plants is an important but unsolved scientific problem in the field. Previous studies have shown that immune activation of PTI and ETI is mediated by different activation mechanisms, mediated by recognition of specific signals by different receptors located in different subcellular locations. However, PTI and ETI signals possess numerous similar outputs of downstream immune signals, including expression of defense genes, Reactive Oxygen Species (ROS) production, and callose deposition. The existence of a correlation between the PTI and the ETI signal path and how to mutually coordinate plant immune output is not analyzed in the field, so that a blank exists for a method for enhancing plant disease resistance by combining the PTI and the ETI.

Disclosure of Invention

The invention discovers related factors in a PTI pathway and an ETI pathway, and provides an agent and a method for enabling plants to be more disease-resistant.

In a first aspect the present invention provides a method of enhancing the ETI effect of a plant or plant cell, said method comprising enhancing the PTI effect of said plant or plant cell, preferably said method comprises one or more steps selected from the group consisting of:

(1) cells were treated with agents that induce PTI.

(2) Upregulation of expression or activity of proteins that enhance the effects of PTI,

(3) downregulating expression or activity of a protein that inhibits the effects of PTI.

In one or more embodiments, the method comprises contacting the plant or plant cell with a combination of one or any of the agents selected from the group consisting of:

(1) (ii) an agent that induces PTI,

(2) agents that upregulate the expression or activity of proteins that enhance the effects of PTI,

(3) an agent that down-regulates the expression or activity of a protein that inhibits the effects of PTI.

In one or more embodiments, the agent that induces PTI is flg22 from bacterial flagellin, elongation factor elf18, fungal chitin, and the like.

In one or more embodiments, the chitin is β - (1,4) -2-acetamido-2-deoxy-D-glucan having the formula (C8H13O5N)_n。

In one or more embodiments, the amino acid sequence of flg22 is set forth in SEQ ID NO 19.

In one or more embodiments, the amino acid sequence of elf18 is set forth in SEQ ID NO: 20.

In one or more embodiments, the upregulating expression or activity of a protein that enhances the effect of PTI comprises one or more of the following:

(1) up-regulating the expression or activity of RBOHD,

(2) up-regulating the expression or activity of the PRR receptor,

(3) up-regulating the expression or activity of PRR co-receptors,

(4) up-regulating the expression or activity of BIK1 or a homologue thereof.

In one or more embodiments, the method comprises contacting the plant with a combination of one or any of the agents selected from the group consisting of:

(1) an agent that upregulates the expression or activity of RBOHD;

(2) an agent that upregulates expression or activity of a PRR receptor;

(3) an agent that upregulates the expression or activity of a PRR co-receptor,

(4) up-regulating the expression or activity of BIK1 or a homologue thereof.

In one or more embodiments, the agent is a nucleic acid molecule, an antibody, a carbohydrate, a lipid, or a small molecule compound.

In one or more embodiments, the agent that upregulates the expression of RBOHD, PRR receptor, PRR co-receptor, or BIK1 or a homolog thereof is

(1) An agent that enhances the transcriptional activity of the corresponding gene;

(2) an agent that increases the level of transcription of the corresponding gene;

(3) an agent that inhibits degradation of mRNA of the corresponding gene;

(4) an agent that promotes translation of mRNA of the corresponding gene; or

(5) Expression vectors and/or integration vectors containing the corresponding genes.

In one or more embodiments, the agent that upregulates expression of RBOHD is an expression vector for RBOHD.

In one or more embodiments, the agent that upregulates the expression of a PRR receptor is an expression vector for a PRR receptor.

In one or more embodiments, the agent that upregulates the expression of the PRR co-receptor is an expression vector for the PRR co-receptor.

In one or more embodiments, the agent that upregulates the expression of BIK1 or a homolog thereof is an expression vector for BIK1 or a homolog thereof.

In one or more embodiments, the homolog of BIK1 is OsRLCK185, OsRLCK 176.

In one or more embodiments, the PRR receptor is selected from FLS2, EFR, LYM1/2/3, LYK4/5, LORE, OsCEBiP, OsLYP4/6, FLS3, or CORE, preferably FLS2 or OsCEBiP or FLS 3.

In one or more embodiments, the PRR co-receptor is selected from BAK1, BKK1, CERK1, or OsCERK1, preferably BAK1 or CERK 1.

The present invention also provides a method of attenuating an ETI effect in a plant or plant cell, said method comprising attenuating a PTI effect in said plant or plant cell, preferably said method comprising one or more steps selected from the group consisting of:

(1) treating a plant or plant cell with an agent that inhibits PTI,

(2) downregulating the expression or activity of a protein that enhances the effects of PTI,

(3) up-regulating the expression or activity of proteins that inhibit the effects of PTI.

(1) (ii) an agent that inhibits PTI,

(2) an agent that down-regulates the expression or activity of a protein that enhances the effect of PTI,

(3) an agent that upregulates the expression or activity of a protein that inhibits the effect of PTI.

In one or more embodiments, the downregulating the expression or activity of a protein that enhances the effect of PTI comprises a combination of one or any of more steps selected from the group consisting of:

(1) down-regulating the expression or activity of the RBOHD,

(2) down-regulating the expression or activity of a PRR receptor,

(3) downregulating expression or activity of a PRR co-receptor,

(4) downregulating expression or activity of BIK1 or a homologue thereof.

(1) an agent that down-regulates the expression or activity of RBOHD;

(2) an agent that down-regulates the expression or activity of a PRR receptor;

(3) an agent that down-regulates the expression or activity of a PRR co-receptor; and

(4) an agent that down-regulates the expression or activity of BIK1 or a homologue thereof.

In one or more embodiments, downregulating expression of an RBOHD, PRR receptor, PRR co-receptor, or BIK1, or homolog thereof comprises:

(1) inhibiting the transcriptional activity of the corresponding gene;

(2) down-regulating the transcription level of the corresponding gene;

(3) promoting the mRNA degradation of the corresponding gene;

(4) inhibiting the translation of mRNA of the corresponding gene;

(5) introducing a targeting nucleic acid which specifically recognizes the corresponding gene into the cell and cleaving to reduce the expression level thereof; and

(6) knocking out or knocking down genes in the genome.

In one or more embodiments, downregulating activity of an RBOHD, PRR receptor, PRR co-receptor, or BIK1, or homolog thereof, comprises:

(1) up-regulating expression of E3 ubiquitin ligase that promotes degradation of RBOHD, PRR receptor, PRR co-receptor, or BIK1 or a homolog thereof; or

(2) Upregulation inhibits the expression of kinase or phosphatase that inhibits the activity of RBOHD, PRR receptor, PRR co-receptor, or BIK1 or a homolog thereof.

In one or more embodiments, the E3 ubiquitin ligase is selected from E3 ubiquitin ligase PUB12 or PUB13 of FLS2, or E3 ubiquitin ligase PUB25 or PUB26 of BIK 1.

In one or more embodiments, the kinase or phosphatase that inhibits the activity of RBOHD, PRR receptor, PRR co-receptor, or BIK1 or a homolog thereof is selected from the group consisting of CPK28, KAPP, PP2A, and PP2C 38.

In one or more embodiments, the agent that down-regulates the activity of a RBOHD, a PRR receptor, a PRR co-receptor, or BIK1 or a homolog thereof comprises: expression vector of E3 ubiquitin ligase for promoting degradation of RBOHD, PRR receptor, PRR co-receptor or BIK1 or homologues thereof or expression vector of kinase or phosphatase for inhibiting activity of RBOHD, PRR receptor, PRR co-receptor or BIK1 or homologues thereof

In one or more embodiments, the agent that down-regulates expression of a RBOHD is an inhibitor of a RBOHD, or a nucleic acid, such as an siRNA or shRNA, that knocks or knockdown a RBOHD in a cell.

In one or more embodiments, the agent that down-regulates PRR receptor expression is an inhibitor of a PRR receptor, or a nucleic acid, such as an siRNA or shRNA, that knocks or knockdown a PRR receptor in a cell.

In one or more embodiments, the agent that down-regulates the expression of a PRR co-receptor is an inhibitor of a PRR co-receptor, or a nucleic acid, such as an siRNA or shRNA, that knocks or knockdown a PRR co-receptor in a cell.

In one or more embodiments, the agent that down-regulates expression of BIK1 or a homolog thereof is an inhibitor of BIK1 or a homolog thereof, or a nucleic acid, such as an siRNA or shRNA, that knocks or knocks down BIK1 or a homolog thereof in a cell.

In one or more embodiments, the homolog of BIK1 is OsRLCK185, OsRLCK 176.

The present invention also provides a method of increasing the active oxygen, ROS, production of an ETI effect in a plant, said method comprising enhancing a PTI effect in said plant or plant cell, preferably said method comprising one or more steps selected from the group consisting of:

(1) treating the cells with an agent that induces PTI,

(1) (ii) an agent that induces PTI,

(1) up-regulating the expression or activity of RBOHD,

(2) up-regulating the expression or activity of the PRR receptor,

(3) up-regulating the expression or activity of PRR co-receptors,

(4) up-regulating the expression or activity of BIK1 or a homologue thereof.

(1) an agent that upregulates the expression or activity of RBOHD;

(2) an agent that upregulates expression or activity of a PRR receptor;

(3) an agent that upregulates the expression or activity of a PRR co-receptor; and

(4) an agent that upregulates the expression or activity of BIK1 or a homologue thereof.

(3) an agent that inhibits degradation of mRNA of the corresponding gene;

(4) an agent that promotes translation of mRNA of the corresponding gene; or

In one or more embodiments, the homolog of BIK1 is OsRLCK185, OsRLCK 176.

The invention also provides a plant, part or cell thereof, wherein said plant, part or cell overexpresses one or more of RBOHD, PRR receptor, PRR co-receptor, BIK1 or a homologue thereof and/or wherein said plant, part or cell comprises a vector expressing one or more of RBOHD, PRR receptor, PRR co-receptor, BIK1 or a homologue thereof.

In one or more embodiments, the homolog of BIK1 is OsRLCK185, OsRLCK 176.

In one or more embodiments, the plant is selected from arabidopsis thaliana, tomato, potato, cabbage, tobacco, cucumber, canola, moss, canola, rapeseed, soybean, crambe, mustard, castor bean, peanut, sesame, cottonseed, linseed, safflower, oil palm, flax, sunflower, maize, rice, barley, millet, rye, wheat, oat, alfalfa, sorghum.

The plant, part thereof or cell thereof may also have the features of the first aspect of the invention.

The invention also provides a product comprising or produced by a plant, part thereof or cell thereof which overexpresses one or more of RBOHD, PRR receptor, PRR co-receptor, BIK1 or a homologue thereof and/or which comprises a vector expressing one or more of RBOHD, PRR receptor, PRR co-receptor, BIK1 or a homologue thereof.

In one or more embodiments, the plant product is a food material comprising or prepared from the plant, part thereof or cells thereof, or the plant product is a food comprising or prepared from the plant, part thereof or cells thereof.

In one or more embodiments, the homolog of BIK1 is OsRLCK185, OsRLCK 176.

The product also has the features of the first aspect of the invention.

The present invention also provides a method of producing a food material or food product comprising (1) obtaining a plant, part thereof or cell thereof that comprises a plant, part thereof or cell thereof that overexpresses one or more of RBOHD, PRR receptor, PRR co-receptor, BIK1 or a homologue thereof and/or that comprises a vector that expresses one or more of RBOHD, PRR receptor, PRR co-receptor, BIK1 or homologue thereof, and (2) producing the food material or food product from the plant, part thereof or cell thereof.

In one or more embodiments, the homolog of BIK1 is OsRLCK185, OsRLCK 176.

The method also features the first aspect of the invention.

The present invention also provides a method of reducing the reactive oxygen species, ROS, production of an ETI effect in a plant, said method comprising attenuating a PTI effect in said plant or plant cell, preferably said method comprising one or more steps selected from the group consisting of:

(1) treating a plant or plant cell with an agent that inhibits PTI,

(1) (ii) an agent that inhibits PTI,

(1) down-regulating the expression or activity of the RBOHD,

(2) down-regulating the expression or activity of a PRR receptor,

(3) downregulating expression or activity of a PRR co-receptor,

(4) downregulating expression or activity of BIK1 or a homologue thereof.

(1) an agent that down-regulates the expression or activity of RBOHD;

(2) an agent that down-regulates the expression or activity of a PRR receptor;

(1) inhibiting the transcriptional activity of the corresponding gene;

(2) down-regulating the transcription level of the corresponding gene;

(3) promoting the mRNA degradation of the corresponding gene;

(4) inhibiting the translation of mRNA of the corresponding gene;

(6) knocking out or knocking down genes in the genome.

In one or more embodiments, the agent that down-regulates the activity of a RBOHD, a PRR receptor, a PRR co-receptor, or BIK1 or a homolog thereof comprises: an expression vector for E3 ubiquitin ligase which promotes degradation of RBOHD, PRR receptor, PRR co-receptor or BIK1 or homologues thereof or an expression vector for kinase or phosphatase which inhibits the activity of RBOHD, PRR receptor, PRR co-receptor or BIK1 or homologues thereof.

In one or more embodiments, the homolog of BIK1 is OsRLCK185, OsRLCK 176.

A method of increasing expression or activity of BAK1, BIK1 or a homologue thereof, MPK3, RBOHD genes, of a plant or plant cell comprising enhancing the ETI effect of said plant or plant cell, preferably said method comprises one or more steps selected from the group consisting of:

(1) expression of an ETI inducer in a plant or plant cell,

(2) up-regulating the expression or activity of a gene that enhances the effects of ETI,

(3) downregulating expression or activity of a gene that inhibits the effects of ETI.

In one or more embodiments, the ETI inducing agent is selected from AvrRpt2, avrppthb, AvrRps4, NLR protein regulated by an inducible promoter (e.g., the mutated version of RPM1 RPM1-D505V), or other effector agent capable of inducing ETI.

A method of enhancing a PTI effect or of attenuating or preventing a PTI effect in a plant or plant cell from being inhibited, comprising enhancing an ETI effect in said plant or plant cell, preferably said method comprising one or more steps selected from the group consisting of:

(1) expression of an ETI inducer in a plant or plant cell,

In one or more embodiments, said PTI effect is inhibited by self-feedback from the plant or plant cell and/or by an effector of a pathogenic microorganism.

A method of reducing BAK1, BIK1 or homologue thereof, MPK3, RBOHD gene expression or activity in a plant or plant cell comprising attenuating the ETI effect of said plant or plant cell, preferably said method comprising one or more steps selected from the group consisting of:

(1) treating a plant or plant cell with an agent that inhibits the effects of ETI,

(2) downregulating the expression or activity of a gene that enhances the effects of ETI,

(3) up-regulating the expression or activity of a gene that inhibits the effects of ETI.

In one or more embodiments, the agent that inhibits the effects of ETI is an ion chelator or an ion channel inhibitor. Such as EDTA, EGTA or lanthanum chloride.

A method of attenuating a PTI effect or promoting inhibition of a PTI effect in a plant or plant cell, comprising attenuating an ETI effect in said plant or plant cell, preferably said method comprising one or more steps selected from the group consisting of:

In one or more embodiments, the inhibition of the PTI effect is caused by self-feedback by the plant or plant cell and/or by an effector of a pathogenic microorganism.

The present invention also provides the use of an agent that enhances the PTI effect of a plant or plant cell for enhancing the ETI effect of a plant or plant cell or increasing the Reactive Oxygen Species (ROS) production of the ETI effect of a plant, preferably, said agent is selected from one or any of the following:

(1) (ii) an agent that induces PTI,

(2) agents that upregulate the expression or activity of proteins that enhance the effects of PTI, and

In one or more embodiments, the agent that upregulates the expression or activity of a protein that enhances the effect of PTI is selected from the group consisting of one or a combination of any of the following agents:

(1) an agent that upregulates the expression or activity of RBOHD;

(2) an agent that upregulates expression or activity of a PRR receptor;

In one or more embodiments, the homolog of BIK1 is OsRLCK185, OsRLCK 176.

The present invention also provides the use of an agent that attenuates the effects of PTI in a plant or plant cell for attenuating the effects of ETI in a plant or plant cell or reducing the production of reactive oxygen species, ROS, of a plant ETI effect, preferably, the agent is selected from one or any of the following:

(1) (ii) an agent that inhibits PTI,

In one or more embodiments, the agent that down-regulates the expression or activity of a protein that enhances the effect of PTI is selected from the group consisting of a combination of one or any of the following agents:

(1) an agent that down-regulates the expression or activity of RBOHD;

(2) an agent that down-regulates the expression or activity of a PRR receptor; and

(3) an agent that down-regulates the expression or activity of BIK1 or a homologue thereof.

(1) inhibiting the transcriptional activity of the corresponding gene;

(2) down-regulating the transcription level of the corresponding gene;

(3) promoting the mRNA degradation of the corresponding gene;

(4) inhibiting the translation of mRNA of the corresponding gene;

(6) knocking out or knocking down genes in the genome.

In one or more embodiments, the agent that down-regulates the activity of a RBOHD, a PRR receptor, a PRR co-receptor, or BIK1 or a homolog thereof comprises:

(1) an agent that upregulates E3 ubiquitin ligase that promotes degradation of RBOHD, PRR receptor, PRR co-receptor, or BIK1 or a homolog thereof; or

(2) An agent that upregulates a kinase or phosphatase that inhibits the activity of an RBOHD, PRR receptor, PRR co-receptor, or BIK1 or a homolog thereof.

In one or more embodiments, the agent that down-regulates expression of a RBOHD is an inhibitor of a RBOHD, or a nucleic acid that knocks or knocks down a RBOHD in a cell.

In one or more embodiments, the agent that down-regulates PRR receptor expression is an inhibitor of a PRR receptor, or a nucleic acid that knocks or knocks down a PRR receptor in a cell.

In one or more embodiments, the agent that down-regulates the expression of a PRR co-receptor is an inhibitor of a PRR co-receptor, or a nucleic acid that knocks or knockdown a PRR co-receptor in a cell.

In one or more embodiments, the agent that down-regulates expression of BIK1 or a homologue thereof is an inhibitor of BIK1 or a homologue thereof, or a nucleic acid that knocks out or knocks down BIK1 or a homologue thereof in a cell.

In one or more embodiments, the homolog of BIK1 is OsRLCK185, OsRLCK 176.

In a preferred example of the embodiments described herein, the amino acid sequence of the RBOHD is shown in SEQ ID NO 1.

In a preferred example of the embodiments described herein, the amino acid sequence of FLS2 is shown in SEQ ID NO 2.

In a preferred example of the embodiments described herein, the amino acid sequence of BAK1 is shown in SEQ ID NO 3.

In a preferred example of the embodiments described herein, the amino acid sequence of BIK1 is shown in SEQ ID NO 4.

Drawings

Figure 1, ETI immune response is dependent on PRRs receptors and co-receptors (a, B) fec and bbc the tri-mutant lacks ETI immunity mediated by the effector AvrRpt2, avrppthb and avrrrp 4. OD was used for Arabidopsis plants₆₀₀0.002 or 0.004 (-1 x 10)⁶cfu/mL or 2X10⁶cfu/mL) of the strain. Three days after injection, samples were taken for counting the number of bacteria. Statistical analysis was performed using the two-way ANOVA, and different letters indicate that differences in the number of bacteria have significant biological significance. (mean. + -. SD; n.gtoreq.3; p<0.05). (C) Cell death by Hypersensitivity (HR) is also delayed in the fecs and bbc mutants. With a concentration of OD₆₀₀Leaves of arabidopsis thaliana were injected into Pst DC3000(avrRpt2) strain of 0.2, and a sampling photograph was taken 7.5 hours after the injection. The right ratio is the ratio of dead leaves to all injected leaves. (D) PRRs receptorPlants that are Trigonopsis of the soma and co-receptor are more sensitive to the D36E (avrRpt2) strain. By OD₆₀₀＝0.004(～2x10⁶cfu/mL) were injected with the wild type Col-0 and the mutants fec and bbc, respectively, and sampled three or four days later for counting the number of bacteria. Statistical analysis was performed using the two-way ANOVA, and different letters indicate that differences in the number of bacteria have significant biological significance. (mean. + -. SD; n.gtoreq.3; p<0.05)。

FIG. 2, the second persistent reactive oxygen species ROS production induced by AvrRpt2 activated ETI is dependent on PRRs or co-receptors. (A, B) the production of ROS in avrRpt2 was detected in three ways of 100nM flg22, 5. mu.M DEX and both, Col-0/DEX, based on the Luminol-HRP method. RLU denotes an opposite light emitting unit. The total photon number is the sum of the time intervals of the corresponding A diagram. Statistical analysis was performed using one-way ANOVA, with different letters indicating that the difference in total photon number has significant biological significance. (mean. + -. S.E.M (n.gtoreq.27); p < 0.05). (C) Transgenic material of various avrRpt2 gene expression levels of avrRpt2 were 2 hours after injection of 5 μ M DEX. Statistical analysis was performed using one-way ANOVA, with different letters indicating that differences between treatments were of significant biological significance. (mean + -S.E.M; n.gtoreq.3; p < 0.05). (D, E) Luminol-HRP-based method to detect ROS production in 5. mu.M DEX or 100nM flg22+ 5. mu.M DEX treated transgenic material Col-0/DEX:: avrRpt2 and bbc/DEX:: avrRpt 2. The total photon count is the sum of the time intervals of the corresponding (D) plots. Statistical analysis was performed using the two-way ANOVA, with different letters indicating that the difference in total photon number has significant biological significance. (mean. + -. S.E.M (n.gtoreq.6); p < 0.05).

Figure 3, avirpt 2 activated ETI induced ROS production dependent on RBOHD. (A) ROS production was examined five hours after inoculation of Col-0, bbc and rps2 with D36E (avrRpt2) or five hours after inoculation of Col-0 with D36E strain using the fluorescent dye H2 DCFDA. White snips represent the interstitial regions of the leaf. Scale bar 25 μm. (B, C) NADPH oxidase inhibitor DPI can inhibit the generation of ROS in transgenic material Col-0/DEX:: avrRpt 2L 1 plants. The leaves were treated with 100nM flg22+ 5. mu.M DEX and simultaneously with DPI, SHAM or NaN3(B), respectively. Leaf first 100nM flg22+5 μ M DEX treatment caused the first ROS production, approximately 40 minutes later, the inhibitors DPI, beam or DPI (c) were added to the solution, respectively. (mean. + -. S.E.M; n.gtoreq.6). (D) ROS production was tested five hours after injection of the Col-0 and rbohd mutants using the fluorescent dye H2DCFDA, D36E (avrRpt 2). Scale bar 25 μm. (E) Transcriptional expression level of the RBOHD gene in Col and bbc after inoculation with the pathogen. Statistical analysis was performed using the two-way ANOVA, with different letters indicating that the differences were of significant biological significance. (mean. + -. S.E.M; n.gtoreq.3; p<0.05). (F) Col-0 and bbc mutants after inoculation with H₂Protein levels of RBOHD were assayed at different time points after o (mock), D36E and D36E (avrRpt 2).

Figure 4, avirpt 2-activated ETI-induced ROS production was dependent on BIK 1. The bik1 mutant, but not the cpk4/5/6/11 mutant, greatly deleted the ROS produced by the ETI activated by AvrRpt 2. The plants were stained with H2DCFDA 4.5 hours after D36E (avrRpt2) had been treated. Scale bar 25 μm.

Figure 5, qRT-PCR quantification of PTI signaling component genes representative of ETI up-regulated core signaling component (a) of PTI. Col-0 and bbc were treated with different bacteria, and samples were taken 3 hours later to examine the expression of the genes. Statistical analysis was performed using the two-way ANOVA, with different letters indicating that the differences were of significant biological significance. (mean + -S.E.M; n.gtoreq.3; p < 0.05). (B) The protein levels of BAK1, BIK1 and MPK3 were varied under treatment of different bacteria. Different bacteria respectively process Col-0 and then sample at corresponding time points to detect protein changes. The same amount of total protein was loaded into the protein gel.

Detailed Description

It is to be understood that within the scope of the present invention, the above-described technical features of the present invention and the technical features described in detail below (e.g., the embodiments) may be combined with each other to constitute a preferred embodiment.

The inventors have found that Pattern Recognition Receptors (PRRs) of arabidopsis thaliana and their multiple mutants of co-receptors largely lack ETI immunity triggered by bacterial effector using an arabidopsis thaliana-Pseudomonas syringae pattern research system, and thus PTI is essential for ETI immunity. And pattern recognition receptors and their co-receptors are essential for the generation of Reactive Oxygen Species (ROS) in the ETI reaction, a process mediated by the RBOHD protein for which pattern recognition receptors are essential for activation.

Accordingly, provided herein is a method of Reactive Oxygen Species (ROS) production that modulates ETI effects in plants by modulating expression or activity of a plant's RBOHD. Meanwhile, the inventors also found that activation of RBOHD requires PRR receptors (e.g., FLS2 and EFR) and co-receptors (e.g., BAK1, BKK1 or CEKR1) and the downstream kinase BIK1 or homologues thereof, and BIK1 may be an important kinase to activate RBOHD mediated ETI-ROS production. Accordingly, also provided herein are methods of modulating the production of reactive oxygen species ROS that modulate the ETI effect in plants or modulating the anti-disease effect of plants by modulating the expression or activity of PRR receptors or co-receptors and BIK1 in plants, which in turn alters the expression or activity of RBOHD. Herein, "modulation" includes up-regulation including promotion, increase and/or enhancement and down-regulation including inhibition, reduction, attenuation, disruption and/or reduction. Herein, "plant" includes plants or parts thereof, such as cells of plants, in particular higher plants or cells thereof. "ETI-responsive reactive oxygen species ROS" means ROS production by a plant resulting from ETI-response. PRR receptors include Arabidopsis derived FLS2, EFR, LYM1/2/3, LYK4/5, LORE, or rice derived EFROsCEBiP, OsLYP4/6, or tomato derived FLS3, CORE, preferably FLS2, OsCEBiP or FLS 3. PRR co-receptors include BAK1, BKK1, CERK1 from arabidopsis thaliana, or OsCERK1 from rice, preferably BAK1 or CERK 1. The amino acid sequence of Arabidopsis derived RBOHD is shown in SEQ ID NO: 1. The amino acid sequence of the PRR receptor FLS2 derived from Arabidopsis is shown as SEQ ID NO. 2. The amino acid sequence of the PRR co-receptor BAK1 derived from Arabidopsis is shown as SEQ ID NO. 3. The amino acid sequence of BIK1 derived from Arabidopsis thaliana is shown in SEQ ID NO. 4. It is understood that the RBOHD, PRR receptor, PRR co-receptor, BIK1 described herein may be from a variety of plants of interest including, but not limited to, arabidopsis, tomato, potato, cabbage, tobacco, cucumber, canola, bolts, canola, rapeseed, soybean, crambe, mustard, castor bean, peanut, sesame, cottonseed, linseed, safflower, oil palm, flax, sunflower, maize, rice, barley, millet, rye, wheat, oats, alfalfa, sorghum. Thus, also contemplated herein are homologs of RBOHD of different species: XP _015616929.1 for rice, XP _008655905.1 for corn, NP _001305507.1 for potato, XP _013598618.1 for cabbage, NP _001313052.1 and XP _016510188.1 for tobacco, XP _003554649.1 for soybean and the like. Also contemplated herein are homologs of FLS2 of different species: XP _015634951.1 for rice, XP _008668880.1 for corn, XP _006365570.1 for potato, XP _003532650.1 for soybean, XP _013611677.1 for cabbage, and XP _016490799.1 for tobacco. Also contemplated herein are homologs of BAK1 of different species: XP _015649858.1 for rice, NP _001313384.1 for corn, NP _001234626.1 and NP _001233871.1 for tomato, XP _016442040.1 for tobacco, XP _003547599.1 for soybean, XP _002454054.1 for sorghum and the like. Also contemplated herein are homologues of BIK1 from different species: XP _015639740.1 for rice, NP _001141912.1 for corn, XP _025690300.1 for peanut, XP _008458866.1 for cucumber, XP _013734585.1 for rape, XP _013623444.1 for cabbage, XP _002466186.1 for sorghum and the like. In preferred embodiments, also encompassed herein are homologs of RBOHD, BIK1, such as RLCK185 or RLCK176, which is a homolog of BIK1 in rice. Also provided herein are mutants of RBOHD, PRR receptor, PRR co-receptor, BIK1, as long as they still have their respective functions in plant immunity.

The active oxygen ROS production of a plant ETI effect can be up-regulated or the plant ETI disease resistance effect can be up-regulated by up-regulating the activity of RBOHD, PRR receptor, PRR co-receptor, BIK1 in plant cells. The activity of RBOHD, PRR receptor, PRR co-receptor, BIK1 may be increased using agonists of RBOHD, PRR receptor, PRR co-receptor, BIK1 (e.g., pathogen molecule associated patterns from bacteria, flagellin flg22, elongation factor elf18, chitin) or small molecule compounds that increase the activity of RBOHD, PRR receptor, PRR co-receptor, BIK 1. Alternatively, mutations that enhance the activity of RBOHD, PRR receptor, PRR co-receptor, BIK1 can be introduced into the cell by knock-in or transgenic means. Typically, an increase in protein activity refers to an increase in protein activity of at least 20%, at least 30%, at least 40%, at least 50%, at least 60% compared to the wild type; or at least a 20%, at least a 30%, at least a 40%, at least a 50%, at least a 60% increase in protein activity in the host cell as compared to the wild-type cell.

Accordingly, the production of reactive oxygen species ROS in a plant ETI response or the disease resistance effects of a plant ETI can be down-regulated by down-regulating the activity of RBOHD, PRR receptor, PRR co-receptor, BIK1 in a plant cell. The activity of RBOHD, PRR receptor, PRR co-receptor, BIK1 antagonist, specific antibody or nucleic acid sequence encoding the same, or a small molecule compound that reduces the activity of RBOHD, PRR receptor, PRR co-receptor, BIK1 (e.g., DPI can specifically inhibit the activity of RBOHD) can be used to down-regulate the activity of RBOHD, PRR receptor, PRR co-receptor, BIK 1. Alternatively, mutations that reduce the activity of RBOHD, PRR receptor, PRR co-receptor, BIK1 can be introduced into cells by knock-in means. Herein, reducing the activity of a protein comprises reducing the activity of the protein by at least 30%, such as at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or even not expressing the protein at all or detecting the activity of the protein at all, compared to a control cell (wild-type cell).

The ROS production of a reactive oxygen species of a plant ETI effect or the plant ETI effect can be upregulated by upregulating expression of RBOHD, PRR receptor, PRR co-receptor, BIK1 in a plant cell. Methods for up-regulating the expression of RBOHD, PRR receptor, PRR co-receptor, BIK1 include, but are not limited to, (1) enhancing the transcriptional activity of a gene; (2) increasing the level of transcription of the gene; (3) inhibiting mRNA degradation of the gene; (4) promoting translation of gene mRNA; and (5) introducing an expression vector and/or an integration vector containing the gene into the cell. Upregulation of the respective expression of RBOHD, PRR receptor, PRR co-receptor, BIK1 may be achieved by overexpression of these molecules in the host or host cell. For example, expression vectors suitable for expressing these molecules in a host cell can be constructed using techniques conventional in the art and transferred to a host cell by conventional methods such that the expression vector expresses the molecule in the host cell, thereby effecting upregulation of its expression. In certain embodiments, the expression of genes upstream of these molecules can be modulated, thereby increasing the expression of such molecules.

Accordingly, the production of reactive oxygen species ROS in a plant ETI response or the disease resistance effects of a plant ETI can be down-regulated by down-regulating the expression of RBOHD, PRR receptor, PRR co-receptor, BIK1 in a plant cell. Methods of down-regulating expression or activity of RBOHD, PRR receptor, PRR co-receptor, BIK1 include, but are not limited to, (1) inhibiting transcriptional activity of a gene; (2) down-regulating the transcription level of a gene; (3) promoting the degradation of gene mRNA; (4) inhibition of translation of gene mRNA, such as siRNA or shRNA; (5) introducing a targeting nucleic acid of a specific recognition protein gene into a cell and shearing to reduce the expression level of the targeting nucleic acid; and (6) partial or complete knock-out of a gene in the genome; (7) upregulation of E3 ubiquitin ligases that regulate the degradation of these proteins and (8) upregulation of kinases or phosphatases that inhibit the activity of these proteins.

The activity of RBOHD, PRR receptor, PRR co-receptor, BIK1 can also be reduced by introducing mutations into its protein. Thus, in certain embodiments, mutations are introduced in the functional domains of proteins of RBOHD, PRR receptor, PRR co-receptor, BIK1 that result in a reduction or loss of their respective activities. The mutation may be an insertion, deletion or substitution of 1 or several or even more (e.g., 10 or more, 20 or more, 30 or more) amino acids. Mutations in the functional domains of the proteins encoded by these agents, which result in a reduction or loss of their associated biological activity, can be introduced by administering agents which act on the genes of RBOHD, PRR receptor, PRR co-receptor, BIK 1. Such agents may alter the sequence of the genes for RBOHD, PRR receptor, PRR co-receptor, BIK1, resulting in corresponding mutations in the encoded protein, thereby having reduced activity, or loss of activity. For example, the mutant RBOHD, PRR receptor, PRR co-receptor, BIK1 gene can be used to replace the response gene in wild-type cells by homologous recombination techniques, resulting in the expression of weakly active or inactive RBOHD, PRR receptor, PRR co-receptor, BIK1 protein.

Plant diseases caused by pathogenic microorganisms (including bacteria, fungi, oomycetes, etc.) are collectively referred to herein as plant pathogenic microbial diseases. Plant diseases often cause serious yield and quality reduction of crops, and threaten the food safety of human beings. The plant pathogenic bacteria mainly belong to the following 5 genera: pseudomonas (Pseudomonas), Xanthomonas (Xanthomonas), Erwinia (Erwinia), Eubacterium (Arobacterium) and Corynebacterium (Corynebacterium). Plant pathogenic bacterial diseases often cause a variety of plant disorders, such as tomato spot disease caused by pseudomonas, bacterial brown spot of rice, bacterial angular leaf spot of cucumber, bacterial wilt of tomato and potato, etc., in which pseudomonas solanacearum can attack more than 300 plants of 44 families; the diseases of the xanthomonas include rice bacterial leaf blight, cucumber bacterial leaf blight and the like; soybean bacterial leaf spot of Erwinia and tomato fruit bacterial leaf spot of Erwinia. The kingdom of plant fungi (funguses) includes the phylum myxomycota and the phylum mycomycota, which includes 5 subgenus: the subdivision of Trichophyton (Mastigomycotina), Zygomycotina, Ascomycotina, Basidiomycotina, Deuteromycotina. The main plant diseases caused by the method comprise rice blast, scab of cereal, stem rot caused by fusarium graminearum, wheat rust, vegetable powdery mildew, black spot of sweet potatoes and the like. Oomycetes are a kind of eukaryote and also very important plant pathogenic bacteria, and some diseases of crops mainly caused by the oomycetes comprise potato late blight, soybean downy mildew, soybean phytophthora blight, tobacco black shank and the like. An exemplary bacterium in the examples herein is Pst DC3000 derived from a tomato host of the pseudomonas syringae species of the genus pseudomonas. It is to be understood that the pathogenic microorganism described herein may be any microorganism of interest.

On the other hand, the inventors have also found that ETI is capable of strongly upregulating the transcriptional and protein levels of many important signaling components of PTI. The above findings indicate that two classes of immunoreceptors (PRR receptor/co-receptor and NLR) of plants are functionally important in association, that the PTI and ETI pathways are interdependent and activated, and that PTI is actually an indispensable component in ETI immunity. By modulating ETI, key components of PTI signaling can be modulated, including BAK1, BIK1, RBOHD, MPK3, and the like. Meanwhile, the inhibition effect of the negative feedback mechanism of the plant or the effector of the exogenous pathogenic substance can be overcome by regulating and controlling the ETI effect of the plant.

Accordingly, the present invention provides a method for up-regulating gene expression or activity of BAK1, BIK1, RBOHD, MPK3 and the like by enhancing the ETI effect of a plant, and a method for reducing or preventing the inhibition of the PTI effect by enhancing the ETI effect of a plant. The ETI effect may be enhanced by introducing an inducer of the ETI pathway into a plant or plant cell. The inducing agent may be a microbial effector capable of inducing ETI, for example, ETI effects may be induced by introducing a vector expressing the effector into a plant cell, and the like. Such as AvrRpt2(WP _080397204.1), avrpbhb (Q52430.1), avrrrps 4(WP _122271384.1) or other reported effectors capable of inducing ETI (including effectors derived from different pathogens infecting various plants); in addition, an activated version of the NLR protein RPM1(D505V) can be grafted with an inducible promoter. The ETI effect may also be enhanced by up-regulating the expression or activity of a gene in the ETI pathway that enhances the ETI effect, or down-regulating the expression or activity of a gene in the ETI pathway that inhibits the ETI effect. Methods of up-regulating gene expression include, but are not limited to, (1) enhancing the transcriptional activity of a gene; (2) increasing the level of transcription of the gene; (3) inhibiting mRNA degradation of the gene; (4) promoting translation of gene mRNA; and (5) introducing an expression vector and/or an integration vector containing the gene into the cell. Methods of down-regulating gene expression include, but are not limited to, (1) inhibiting the transcriptional activity of a gene; (2) down-regulating the transcription level of a gene; (3) promoting mRNA degradation of the gene; (4) inhibiting translation of gene mRNA; (5) introducing a targeting nucleic acid of a specific recognition protein gene into the cell and shearing to reduce the expression level of the targeting nucleic acid; and (6) partial or complete knock-out of protein genes in the genome; (7) upregulation of E3 ubiquitin ligases that regulate the degradation of these proteins and (8) upregulation of kinases or phosphatases that inhibit the activity of these proteins.

The present invention also provides methods of down-regulating BAK1, BIK1, MPK3, RBOHD gene expression or activity by inhibiting the ETI effect in a plant, and methods of promoting inhibition of the PTI effect by inhibiting the ETI effect in a plant. The ETI effect can be enhanced by treating plants or plant cells with an inhibitor of the ETI pathway. Such inhibitors are for example ion chelators or ion channel inhibitors. The ETI effect may also be enhanced by down-regulating the expression or activity of a gene in the ETI pathway that enhances the ETI effect, or up-regulating the expression or activity of a gene in the ETI pathway that inhibits the ETI effect. Methods for up-and down-regulating genes are described elsewhere herein.

The agents herein may be nucleic acid molecules, carbohydrates, lipids, small molecule compounds and proteins, such as antibodies. Herein, the nucleic acid molecule may be, for example, siRNA, shRNA, expression vector or targeting vector. Small molecule compounds generally refer to chemically synthesized compounds of relatively low molecular weight that are synthesized using chemical methods. The protein includes a specific antibody. For example, the agent may be an antibody that specifically binds to RBOHD, PRR receptor, PRR co-receptor, BIK 1. In certain embodiments, the above-described methods of the invention comprise introducing into a plant vector that overexpresses a RBOHD, a PRR receptor, a PRR co-receptor, BIK1, or a plant vector that overexpresses the antisense complement of miR-146a, thereby inhibiting or promoting an ETI effect.

The proteins or polypeptides described herein also include variants that have at least 80% sequence identity to the protein or polypeptide and retain protein or polypeptide activity. The variants include: an amino acid sequence having at least 70%, at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity to a reference sequence and retaining the biological activity (e.g., NADPH oxidase activity, kinase activity) of the reference sequence. Sequence identity between two aligned sequences can be calculated using, for example, BLASTp from NCBI. Mutants also include amino acid sequences having one or several mutations (insertions, deletions or substitutions) in the amino acid sequence while still retaining the biological activity of the reference sequence. The number of mutations usually means within 1-50, such as 1-20, 1-10, 1-8, 1-5 or 1-3. The substitution is preferably a conservative substitution. For example, conservative substitutions with amino acids of similar or similar properties are not typically used in the art to alter the function of a protein or polypeptide. "amino acids with similar or analogous properties" include, for example, families of amino acid residues with analogous side chains, including amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, substitution of one or more sites with another amino acid residue from the same side chain species in the polypeptide of the invention will not substantially affect its activity.

The proteins or polypeptides described herein and their adjacent polypeptides may be directly linked, or may be linked by linker sequences well known in the art, such as G and/or S containing linkers. Typically, the linker contains one or more motifs which repeat back and forth. For example, the motif may be GGGS, GGGGS, SSSSG, GSGSA and GGSGG.

The invention also includes the coding sequences and complements thereof of the various proteins or mutants thereof described herein, as well as nucleic acid constructs comprising the coding sequences or complements. Herein, a nucleic acid construct is an artificially constructed nucleic acid segment that can be introduced into a target cell or tissue. The nucleic acid construct comprises a coding sequence described herein or a complement thereof, and one or more regulatory sequences operatively linked to the sequences. The control sequence may be an appropriate promoter sequence. The promoter sequence is typically operably linked to the coding sequence of the amino acid sequence to be expressed. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is linked to the 3' terminus of the nucleotide sequence encoding the polypeptide, and any terminator which is functional in the host cell of choice may be used herein.

In certain embodiments, the nucleic acid construct is a vector. In particular, the coding sequences described herein can be cloned into many types of vectors, including but not limited to plasmids for plant or bacterial use. Methods for cloning coding sequences into these vectors by genetic engineering techniques are known in the art. The vector may be an expression vector, a targeting vector, or a cloning vector.

Generally, suitable vectors comprise an origin of replication functional in at least one organism, a promoter sequence, a convenient restriction enzyme site and one or more selectable markers. Representative examples of such promoters are: lac or trp promoter of E.coli; eukaryotic promoters include CMV35S promoter, maize or rice Ubi promoter, plant protein promoter and other known promoters capable of controlling gene expression in prokaryotic or eukaryotic cells. Marker genes can be used to provide phenotypic traits useful for selection of transformed host cells, including but not limited to dihydrofolate reductase, neomycin resistance, and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli. When the polynucleotides described herein are expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to increase transcription of a gene.

It will be clear to one of ordinary skill in the art how to select appropriate vectors, promoters, enhancers and host cells. Methods well known to those skilled in the art can be used to construct expression vectors containing the polynucleotide sequences described herein and appropriate transcription/translation control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like.

Also included herein are host cells comprising a polynucleotide sequence described herein or a nucleic acid construct thereof. The host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; filamentous fungal cells, or higher eukaryotic cells, such as plant cells. Representative examples are: escherichia coli, streptomyces; eukaryotic cells such as yeast, filamentous fungi, plant cells, and the like.

The vectors herein may be introduced into host cells, plant seeds or plants by conventional methods including microinjection, particle gun, electroporation, electron bombardment, calcium phosphate precipitation, agroinfiltration, tissue culture agroinfection. Those skilled in the art are aware of methods for obtaining transgenic plant plants, such as plant tissue culture, plant selfing or crossing, using host cells or plant seeds into which the vectors have been introduced.

Accordingly, the present invention also provides a plant, part or cell thereof which overexpresses one or any more of RBOHD, PRR receptor, PRR co-receptor, BIK1 or a homologue thereof and/or which comprises a vector which expresses one or any more of RBOHD, PRR receptor, PRR co-receptor, BIK1 or a homologue thereof. The plant is selected from Arabidopsis thaliana, tomato, potato, cabbage, tobacco, cucumber, canola, moss, canola, rapeseed, soybean, crambe, mustard, castor bean, peanut, sesame, cottonseed, linseed, safflower, oil palm, flax, sunflower, maize, rice, barley, millet, rye, wheat, oat, alfalfa, sorghum.

The plants or parts thereof described herein can be made into products, such as food materials or foods. The food material comprises or is prepared from the plant, part thereof or cell thereof. The food comprises or is prepared from the plant, part thereof or cell thereof, or is prepared from the food material. These plants, parts or cells overexpress one or any more of RBOHD, PRR receptor, PRR co-receptor, BIK1 or homologues thereof and/or said plants, parts or cells comprise a vector expressing one or any more of RBOHD, PRR receptor, PRR co-receptor, BIK1 or homologues thereof. For example, the food or food material may be oil, silage, meal, grain or flour. Methods for producing a product described herein (e.g., a food material or food product) are well known in the art and include (1) obtaining a plant, part thereof, or cell thereof that overexpresses one or more of RBOHD, PRR receptor, PRR co-receptor, BIK1, or a homolog thereof and/or that comprises a vector that expresses one or more of RBOHD, PRR receptor, PRR co-receptor, BIK1, or a homolog thereof, and (2) producing the food material or food product from the plant, part thereof, or cell thereof.

The present invention is described in further detail by referring to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Accordingly, the present invention should in no way be construed as limited to the following examples, but rather should be construed to include any and all variations which become apparent in light of the teachings provided herein. The methods and reagents used in the examples are, unless otherwise indicated, conventional in the art. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Examples

I materials and methods

1. Experimental Material

1.1. Plant material and growth conditions

Arabidopsis (Arabidopsis thaliana) plants used in this study were all based on the Col-0 ecotype. Ecotype Col-0 and mutant materials fls2/efr/cerk1(fec), bak1/bkk1/cerk1(bbc) and rps2 (obtained from professor Sheng Yang He, professor Michigan State University and Cyril Zipfel, University of Zurich, Switzerland), mutant rbohd and bik1 (or from professor Centron, institute of genetics and developmental biology, national institute of sciences), mutant cpk4/5/6/11 (obtained from European Arabidopsis center, Eurasian Arabidopsis Stock Centre). The seeds are disinfected by 5% sodium hypochlorite for 5-7 minutes, washed by sterile water for 5-7 times, then placed in a refrigerator at 4 ℃ for dark treatment for about 2 days, and then directly spotted into a small pot filled with arabidopsis thaliana soil, and moved to an illumination incubator with the conditions of 22 ℃, relative humidity of 60%, 12-hour illumination and 12-hour darkness. Arabidopsis thaliana, typically as long as 4-5 weeks, was used for this study.

1.2. Strains and vectors

Coli strain: DH5 α (purchased from geodetic organisms);

agrobacterium strains: GV3101 (purchased from geoonly organisms);

pseudomonas syringae strain: pst DC3000, Pst DC3000(avrRpt2), Pst DC3000(avrPphB), Pst DC3000(avrRps4) and Pst D36E (obtained from professor Sheng Yang He, Mich gan State University), Pst D36E (avrRpt2) (constructed in the laboratory);

constructing a vector by transgenes: pBUD-DEX (pBD) (obtained from professor Sheng Yang He, Michigan State University);

expression vector: pDSK519-AvrRpt2 (obtained from professor Sheng Yang He, Michigan State University)

2. Experimental methods

2.1. Construction of transgenic expression vectors

Pst DC3000(avrRpt2) was used as a template, and Q5 high fidelity DNA polymerase (purchased from NEB,

High-Fidelity DNA polymers), the DNA sequence of the effector AvrRpt2(768bp) was cloned, the AvrRpt2 gene was directly ligated into the pBUD-dex (pBD) transgenic vector with T4 DNA ligase (purchased from Invitrogen) by digestion with XhoI/SpeI, escherichia coli was transformed, positive clones were identified and sequence verified to obtain the plasmid pBD-AvrRpt 2. The obtained transgenic expression vector is used for transforming Col-0 and bbc plants. The primer sequences are shown in Table 1.

TABLE 1

2.2. Genetic transformation and selection of plants

The constructed vector pBD-AvrRpt2 was transferred into Agrobacterium GV3101 by chemical transformation, spread on LB medium containing Rif + Kan double antibody, and cultured at 30 ℃ for 2 days in an inverted manner. And selecting a single colony for PCR identification, inoculating the clone identified as positive into 5ml of LB liquid culture medium containing corresponding antibiotics, and carrying out shaking culture at 30 ℃ for 8-10 hours. At night according toInoculating Agrobacterium into 200ml culture medium containing corresponding antibiotic at ratio of 1:100, and shake culturing for 10-16 hr to OD₆₀₀0.6 to 1.0. The strain was collected at 5000rpm for 10min, the supernatant removed, and the bacterial suspension was suspended with transformation buffer. Then, respectively transforming Col-0 and bbc plants by using a flower soaking transformation method, wherein the dyeing time is 45-60 seconds each time, covering the plants with a cover, and processing the plants in the dark for one night. Taking out the seedlings the next day, putting the seedlings on a culture shelf, harvesting the seedlings after the seeds are mature, and screening the offspring. The seeds of T0 generation are directly spread in soil, and positive seedlings of T1 generation are screened by spraying glufosinate ammonium (purchased from assist in corporation) as the seedlings grow for about 10-14 days, and PCR amplification identification is carried out. The positive transgenic plants were used for subsequent experiments.

The culture medium and transformation buffer solution used in the experiment have the following formula:

1) LB culture medium:

trypsin (trypsin): 10g/L

Yeast extract (Yeast extract): 5g/L

Sodium chloride (NaCl): 10g/L

2) Transformation buffer:

1/2MS：2.2g/L

sucrose: 10g/L

Silwet L-77：0.025％

MES：0.5g/L

pH 5.8 adjusted with 10M KOH

2.3. Inoculation of plant pathogenic bacteria and hypersensitive response HR experiment

The strain D36E (avrRpt2) used in the research is a double verification of the strain D36E (avrRpt2) obtained by transferring a pDSK519-AvrRpt2 vector into D36E by an electric shock transformation method in the subject group through PCR and HR reactions. The remaining strains were obtained from the Sheng Yang He professor laboratory.

The pseudomonas syringae Pst strain is taken out from a refrigerator at the temperature of-70 ℃, inoculated to an LM culture medium containing corresponding antibiotics and subjected to inverted culture at the temperature of 30 ℃ for 2 days. Picking single colony, inoculating into 4-5 ml liquid LM culture medium containing corresponding antibiotics, and performing shaking culture at 30 ℃ overnight until OD₆₀₀0.8 to 1.0. Collecting bacteria at 2500g, centrifuging for 5min, removing supernatant, and washing with sterilized waterAnd then the steps are repeated. Centrifuging at 2500g for 5min, collecting supernatant, and adding sterilized water. Adjusting OD of each Strain₆₀₀0.2 (number of colonies approximately equal to 10)⁸cfu/ml) for use. For inoculation experiments with pathogenic bacteria, OD was measured₆₀₀Strains 0.2 were diluted to OD separately₆₀₀0.002 or 0.004 (-1 x 10)⁶cfu/mL or 2X10⁶cfu/mL), after which the bacterial solution was inoculated into the corresponding arabidopsis leaves with a syringe, respectively. The injected leaves are firstly wiped with a paper towel to dry the solution on the back, then the plants are placed under the environment humidity for about one hour until the water in the injected leaves is completely evaporated and dried, and then a plastic cover is covered on a tray to keep the high humidity for 3-4 days. Sampling was then performed to quantify colony counts. During sampling, the leaf surface is generally sterilized by 75% ethanol for about 20-40 seconds to kill the bacterial strains, then the leaf surface is cleaned twice by sterile water, then a perforator with the diameter of 7.5mm is used for punching two 4 small discs of the leaves from different plants to form a sample, the biological repetition is carried out, and 3-4 repetitions are taken in each experiment. The small disc was ground with a grinder, then diluted with sterile water to various concentration gradients, spotted on LM solid medium containing rifampicin (50mg/L), after air-drying, cultured in an inverted state at 30 ℃ for 24 hours, and the bacterial colony count was counted under a stereoscope.

For the hypersensitive response HR experiment, OD is adjusted well₆₀₀0.2 strain DC3000(avrRpt2) was injected directly into leaves of Col-0, fec, bbc and rps2 plants, and after the plants were placed under ambient humidity, leaf death was counted and photographed after approximately 7 hours.

The formula of the culture medium used in the experiment is as follows:

LM Medium:

trypsin (trypsin): 10g/L

Yeast extract (Yeast extract): 6g/L

Sodium chloride (NaCl): 0.6g/L

Potassium dihydrogen phosphate (KH)₂PO₄)：1.5g/L

Magnesium sulfate (MgSO)₄)：0.35g/L

2.4. Detection of reactive oxygen species ROS

The method based on Luminol-HRP for detecting the generation of reactive oxygen species ROS in vivo is referred to the previous method with little modification. The specific operation method comprises the following steps: in general, about 4-week-old leaves of Arabidopsis thaliana were used, and a disk-shaped leaflet was obtained by punching along the vein region with a punch having a diameter of 5.5 mm. The leaflets were then placed paraxially up into a 96-well white plate (purchased from Thermo Fisher Scientific) containing 200 μ l of sterile water and treated overnight under constant light at room temperature. The next day, solutions containing 30mg/L (w/v) Luminol (purchased from Sigma-Aldrich) and 20mg/L (w/v) HRP (Peroxidase from horse Aldrich, purchased from Sigma-Aldrich) were prepared, 100nM flg22 (purchased from PhytoTech), 5. mu.M DEX (purchased from Sigma-Aldrich) or 100nM flg22+ 5. mu.M DEX were added at the time of use, and after thoroughly mixing, sterilized water in the 96-well plate was replaced with the solutions. Then, the 96-well plate is placed into a Varioskan Flash plate reader enzyme-labeling instrument (Thermo Fisher Scientific) to detect chemiluminescence values once every two minutes, and the reading is continued for 5-6 hours. To examine the effect of different inhibitors on ROS production, 10 μ M DPI (Diphenyleneiodonium; purchased from Sigma-Aldrich), 15 μ M SHAM (Salicylhydrolic acid; purchased from Sigma-Aldrich) or 1 μ M sodium azide were added before and 40min after the test, respectively, and then statistical chemiluminescence was continued according to the above settings.

ROS production was detected under a confocal microscope for plants treated with the fluorescent indicator H2DCFDA (2 ', 7' -Dichlorofluorescein diacetate; purchased from Sigma-Aldrich). The specific method comprises the following steps: will adjust the OD well₆₀₀Different genotypes of arabidopsis leaves are injected into pseudomonas syringae Pst D36E and D36E (avrRpt2) of 0.02 respectively, then the plant leaves are wiped dry, placed under ambient humidity and aired until the leaves are completely free of water stain, then covered with a plastic cover to keep high humidity, and placed into an incubator. After about 4-5 hours, a solution containing 10 mu M H2DCFDA dye is injected again, after 10min of moisture preservation, the leaves are taken out directly to the slide glass, the slide glass is covered, excitation light with 488nm wavelength is set by a Leica SP8 confocal microscope, DCFDA signals are detected by emission light with 501-550 nm wavelength, and chloroplast autofluorescence is detected by emission light with 640-735 nm wavelength.

2.5. Extraction of total RNA from Arabidopsis leaves

To investigate the change in the expression level of the gene, Arabidopsis thaliana leaves grown for about 4 weeks were injected with sterilized water (mock) or OD₆₀₀Different Pst strains were obtained at 0.04 and sampled at 3 hours for total RNA extraction. Three leaves from different plants were one biological sample, and four replicates were taken for each treatment.

In order to ensure that high-quality RNA can be extracted, the consumables and reagents used in the experiment are RNase-free products.

1) The sample was ground to a powder using liquid nitrogen and added to 1mL Trizol (purchased from Invitrogen) per 50-100mg of material and mixed immediately, the volume of ground sample should not exceed 10% of Trizol.

2) Separating at room temperature for 5min, and if more samples are available, placing on ice to prevent degradation.

3) The precipitate was removed by centrifugation at 12000rpm for 10min at 4 ℃ and the supernatant was transferred to a new RNase-free centrifuge tube.

4) Adding 0.3mL of chloroform into 1mL of Trizol, tightly covering, violently shaking for 15 seconds, centrifuging at 4 ℃, 12000rpm for 15min, and separating the centrifuged liquid into three layers, wherein the lowest layer is dark red and is a phenol-chloroform phase, an intermediate phase and a colorless supernatant phase. RNA was dissolved in the aqueous phase and accounted for approximately 60% of Trizol.

5) Transferring the supernatant to a new RNase-free centrifuge tube, adding equal volume of chloroform, tightly covering, shaking vigorously for 15 seconds, centrifuging at 4 deg.C and 12000rpm for 15 min.

6) The supernatant was transferred to a new RNase-free centrifuge tube, 0.5mL of isopropanol was added to each 1mL of Trizol, and the mixture was left on ice for 10min, centrifuged at 12000rpm for 10min at 4 ℃.

7) Washing, removing supernatant, adding 1mL 75% ethanol, mixing (standing), centrifuging, 4 deg.C, 7500rpm, 5 min.

8) The supernatant was discarded, and after the precipitate was completely dried, RNase Free H2O was added and dissolved (20-30. mu.l).

9) The mRNA extracted by Trizol method was subjected to DNA degradation experiment (system shown below, Table 2):

TABLE 2

RNA	30μl
		RNase free H₂O	14μl
RNaseOUT^TM(400U/ul)	0.5μl
		10*DNase buffer	5μl
DNase(Rnase free)(5U/ul)	0.5μl
		Total of	50μl

10) Putting the prepared solution into a water bath kettle at 37 ℃ for incubation for 30 min;

11) taking the EP tube out of the water bath, adding 8 mul of 3.75% SDS, immediately flicking and uniformly mixing, and centrifuging for a short time;

12) adding 2 μ l of protease K, and incubating in a water bath at 37 deg.C for 15 min;

13) to the incubated sample was added 40. mu.l of RNase-free H2O (DEPC H2O), and the mixture was thoroughly mixed to prepare a 100. mu.l system solution (for subsequent purification)<QIAGEN

MinElute^TM Cleanup>)；

14) To the above solution was added 350. mu.l RLT (10. mu.l per 1ml of base-mercaptoethanol had been added to the RLT solution in advance), and mixed immediately;

15) then adding 250 mul of absolute ethyl alcohol into the solution for diluting RNA, and immediately mixing uniformly by using a gun head;

16) transferring the mixed solution of 700 μ l to RNeasy MinElute adsorption column, covering tube cover, centrifuging 8000g, 15S, and removing 2ml collection tube and liquid;

17) transferring the adsorption column into a new 2ml collection tube, adding 500 mul RPE, centrifuging 8000g, 15S, and pouring off the waste liquid in the collection tube;

18) adding 500 μ l 80% ethanol into adsorption column, centrifuging 8000g for 2min, and removing waste liquid in 2ml collection tube;

19) transferring the adsorption column into a new 2ml collection tube, opening the cover, and centrifuging for 5min at 8000 g;

20) the column was transferred to a new 1.5ml collection tube, 50ul RNase-free H2O was added to the column, the lid was closed, the column was centrifuged at 14000rpm for 1min, and then the concentration and mass of mRNA were measured by Nanodrop.

2.6. Reverse transcription and quantitative PCR

Using ReverTra

The reverse transcription was performed using a qPCR RT Master Mix with gDNA remover (purchased from TOYOBO) reverse transcription kit, and the detailed procedure was described in reference to the standard instructions.

1) Denaturation of RNA, namely taking 1 mu g of total RNA, placing the total RNA into a temperature of 65 ℃ for thermal denaturation for 5min, immediately taking out the total RNA, and placing the total RNA on ice for cooling;

2) removal of genomic DNA reaction (DNase reaction)

The following reaction solution was prepared on ice.

After the reaction solution was gently stirred to homogeneity, the reaction solution was incubated at 37 ℃ for 5 minutes.

3) Reverse transcription reaction

Next, the following reaction solution was prepared on ice.

Reaction solution of step (3) 8. mu.l

5x RT Master Mix II 2μl

Total 10μl

After the reaction solution was gently stirred uniformly, the reaction was carried out under the following conditions.

37℃,15min

50℃,15min

98℃,5min

4℃,-

After the reaction is finished, the reverse transcribed cDNA is directly applied with sterilized ddH₂Diluted 20 times with O to be used as a template for real-time fluorescence quantitative PCR. For quantitative PCR

Green real polymerase PCR Master Mix (purchased from TOYOBO) using methods reference standard methods. Quantitative PCR primers are referenced in Table 3, with the U-box gene as an internal reference.

TABLE 3

Primer name	Primer sequence (5 '-3')
		U-box qRT-FP	TGCGCTGCCAGATAATACACTATT(SEQ ID NO:7)
U-box qRT-RP	TGCTGCCCAACATCAGGTT(SEQ ID NO:8)
		RbohD qRT-FP	GATCAAGGTGGCTGTTTACCC(SEQ ID NO:9)
RbohD qRT-RP	TCGGCAGTTCACCAACATGA(SEQ ID NO:10)
		BAK1 qRT-FP	AGGTGTTCTCTTGGAGACTAGGA(SEQ ID NO:11)
BAK1 qRT-RP	AGAGATCCAGAACTTGTAGCGT(SEQ ID NO:12)
		BIK1 qRT-FP	TTCTTCACAGCGATCCCGTC(SEQ ID NO:13)
BIK1 qRT-RP	TTGCGTTGTAGTCCGCATCA(SEQ ID NO:14)
		MAPK3 qRT-FP	CCAAGAAGCCATAGCACTCA(SEQ ID NO:15)
MAPK3 qRT-RP	AGCCATTCGGATGGTTATTG(SEQ ID NO:16)
		AvrRpt2 qRT-FP	CTTTTCACGATCCCCGACAGGG(SEQ ID NO:17)
AvrRpt2 qRT-RP	GCGGTAGAGCATTGCGTGTGG(SEQ ID NO:18)

Protein extraction and immunodetection of PTI Signal component

The Arabidopsis thaliana leaves around are injected with sterilized water (mock) or with OD concentration₆₀₀＝0.02, and samples were taken after 0.5, 3, 6 and 8 hours for protein extraction. 3-4 leaves from different plants were used as a sample. Protein extraction Using the Plasma Membrane Protein Isolation Kit (purchased from Invent) Kit, the specific procedures were according to standard protocols. Cytoplasmic protein concentrations were quantified using the Bradford protein assay kit (purchased from Bio-Rad). The same amount of total protein was loaded onto SDS denatured protein gel. The different PTI signal components were detected with the following antibodies: anti-RBOHD (purchased from Agrisera),1: 1000; anti-BAK1 (purchased from Agriera), 1: 5000; anti-BIK1 (purchased from Agrisera),1: 3000; anti-MPK3 (purchased from Sigma-Aldrich).

Example 1 ETI immunization is dependent on PRRs receptors and co-receptors

To resolve the pattern of recognition of whether there is a functional association between the receptors PRRs and NLR protein-mediated immunity and whether PRRs receptors may play a role in ETI-mediated immunity, we utilized two independent and multi-mutant materials of arabidopsis thaliana plants, fecs (fls2/efr/cerk1) and bbc (bak1/bkk1/cerk1), which have reported deletion of the primary PTI immune response and their co-receptors, to study the role of PRRs in ETI immunity. First, we selected the relatively clear effector AvrRpt 2-mediated ETI of the nonpathogenic strain pseudomonas syringae that has been studied as the primary means of investigation. AvrRpt2 is derived from the receptor RPS2 (in plants)Resistance to P.syringae 2) Protein recognition triggers ETI and thus is not pathogenic in wild-type plants. We found that after inoculation of the fec and bbc mutants with pseudomonas syringae strain Pst DC3000(avrRpt2), ETI-mediated resistance was very significantly reduced in both mutants compared to the wild-type (Col-0) control (see figure 1A), indicating that the PRRs receptors are critical for ETI-mediated resistance. To further explore whether the effect of PRRs receptors on ETI immunity is directed only to specific effector-NLR protein mediated ETI immunity or more broadly, we selected two additional non-pathogenic strains, Pst DC3000 (avrpbps) and Pst DC3000 (avrps 4), to verify whether PRRs act equally on other NLR protein mediated ETI. These two strains contain the RPS of Arabidopsis thaliana5(Resistance to P.syringeae 5) and RPS4 (R)Resistance to P.syringeae 2) protein recognizes the effector factors AvrPphB and AvrRps4 that cause ETI. We found that similar to the phenotype of Pst DC3000(avrRpt2), both the fec and bbc mutants after Pst DC3000 (avrrpp B) and Pst DC3000(avrRps4) treatment showed a very significant phenotype with a loss of ETI resistance (fig. 1B). These results suggest that the PRRs receptors do have a broad and crucial mechanism of action for the ETI signaling pathway in arabidopsis thaliana. Next we will mainly use AvrRpt2 as an effector to further elucidate the specific molecular mechanism of PRRs receptors in the ETI signaling pathway. The hypersensitivity reaction (HR,Hypersensitive Response) is another very important macroscopic feature in ETI immunization, which is mainly characterized by rapid death of plant cells and displaying wilting and death of plant tissues visible to the naked eye under conditions of high concentration pathogen inoculation. When we inoculated the wild type Col-0, fec and bbc mutants with high concentrations of Pst DC3000(avrRpt2), we found that the rate of hypersensitivity reactions in the fec and bbc mutants was significantly slower than in the wild type (fig. 1C), further confirming that the ETI response was dependent on the PRRs receptor and its co-receptor.

In previous studies, the ETI signaling pathway was mostly studied by using pseudomonas syringae Pst DC3000 to transfer effector factors (such as AvrRpt2, avrrpphb, AvrRps4, etc.) that can cause ETI, whereas Pst DC3000 strain carries about 36 known endogenous effector factors. Previous studies found that many of the effectors carried by Pst DC3000 may directly or indirectly interfere with PTI or ETI immune responses, and therefore using Pst DC3000 to carry an effector that triggers ETI (e.g., avrRpt2) does not allow for easy and clear resolution of the direct relationship between PTI and ETI. To overcome this problem, we used recently published strain D36E knock-out of 36 endogenous effectors in Pst DC3000 to achieve the removal of the effect of endogenous effectors on plant immunity. Thus, when D36E (avrRpt2) was obtained by transferring AvrRpt2 into D36E, it was expected that this strain would cause only PTI immunity and ETI immunity mediated by RPS2 after infecting plants. Although earlier studies found that the pathogenic potential of the D36E strain was greatly reduced compared to Pst DC3000, we could still observe that the colony count of D36E (avrRpt2) was significantly less than that of the D36E strain (fig. 1D) when arabidopsis wild-type Col-0 was treated with D36E (avrRpt2), indicating that this strain was also able to induce a very strong ETI immunity. Similarly, we also found that ETI immunity triggered by avrRpt2 was greatly reduced in mutants when fec and bbc mutants were treated with D36E (avrRpt2) (fig. 1D). This result again confirms the importance of PRRs receptors for ETI immunization.

Example 2 PRR receptors and Co-receptors modulate ETI-mediated ROS production

Another important downstream immune response closely related to PTI and ETI is the production of reactive oxygen species ROS, such as superoxide and hydrogen peroxide, which are considered as defense molecules capable of directly killing pathogenic bacteria and signaling molecules that may further activate the immune response. Therefore we utilized luminol-horseradish catalase: (Luminol-horseradish pThe method of eroxidase (HRP)) as a substrate to detect ROS production by PTI and ETI in Col-0/DEX:: avrRpt2 transgenic material. In this material we used PAMPs (e.g. flg22, a 22 amino acid polypeptide from pathogenic flagellin that triggers PTI mediated by the FLS2 receptor protein) and dexamethasone (DEX,Dexamethasone, which induces the expression of the effector AvrRpt2) can mimic pathogenic bacteria and discriminate well between changes in ROS production caused by PTI, ETI and a combination of the two. As shown in fig. 2A, consistent with previous reports, flg22 alone caused a rapid and transient ROS production, while treatment of DEX alone caused expression of AvrRpt2, which stimulated a later and weaker ROS outbreak. Interestingly, when flg22 and DEX were treated simultaneously, in addition to the first rapid and transient ROS production (PTI-ROS), it also caused a strong and persistent burst of secondary ROS, peaking at approximately 2-3 hours and lasting for several hours (ETI-ROS; FIG. 2A, B). This is very similar to the ROS outbreak observed in bacteria in previous studies. This important finding suggests that ETI production of strong and persistent ROS must rely on activation of PTI immunity. To test this hypothesis, we introduced the same vector as that of avrRpt2 into Col-0 and bbc mutants by Agrobacterium-mediated transformationAnd bbc/DEX:: avrRpt2 transgenic plants with expression level of AvrRpt2 consistent with or higher than that of Col-0/DEX:: avrRpt2 after DEX induction were selected for further analysis (FIG. 2C). As shown in FIGS. 2D-E, bbc/DEX. the avrRpt2 transgenic plant not only lacked the first ROS production caused by flg22, but almost completely lost the second ROS production triggered by AvrRpt 2. This result clearly demonstrates that PRRs receptors are critical for ETI-mediated ROS production.

Example 3 BIK1 activation of ETI-ROS production mediated by RBOHD

To further elucidate whether PTI and ETI-related ROS outbreaks occur at the same or different organelle/subcellular sites, we observed the subcellular localization of ROS in real time using the fluorescent dye H2DCFDA, which can penetrate plant cell membranes and thus be able to detect ROS both intracellularly and apoplasmic. As shown in fig. 3A, when Col-0 plants were injected with D36E (avrRpt2) for 5 hours, a very strong fluorescence signal was observed in the apoplast region, whereas in the bbc mutant, the signal of the apoplast was very weak. Furthermore, it was expected that there was almost no fluorescent signal in the apoplast of the D36E (avrRpt2) -treated rps2 mutant and the D36E-treated Col-0 plant. Therefore, ROS caused by AvrRpt2 are mainly produced in the cytoplasmic exosome region. Previous studies have shown that ROS production in the cytoplasmic exosome region can be mediated by NADPH oxidase (e.g. RBOHD,Respiratory Burst Oxidase Homologues D) And Peroxidases (Peroxidases). Therefore, we utilized the chemical inhibitor DPI (capable of inhibiting NADPH oxidase activity) (ii)Diphenylene iodnium) and an inhibitor of peroxidase activity, SHAM (II)Salicylhydroxamic acid) and sodium azide (NaN)₃) To study which enzymes are primarily involved in the production of ROS triggered by AvrRpt 2. When DPI is co-processed with flg22 and DEX, instead of beam or sodium azide, as in fig. 3B, not only can PTI-induced ROS be greatly reduced, but also ETI-triggered ROS are almost completely lost. Further studies found that when we added chemical inhibitors after treating ROS causing PTI with flg22+ DEX, approximately 30-40min later (before induction of ETI-ROS), also only DPI,but not SHAM or sodium azide, was able to completely prevent the production of ROS (fig. 3C). The above results indicate that NADPH oxidase mediates ETI-triggered ROS production. Previous reports indicate that NADPH oxidase RBOHD is involved in ROS outbreaks caused by pathogenic bacteria, so we next sought to explore whether ETI-phase triggered ROS are mediated by RBOHD. As shown in FIG. 3D, when the D36E (avrRpt2) grafted rbohd mutant was treated with the fluorescent dye H2DCFDA, almost no signal was detected in the apoplast region. Thus, our results suggest that RBOHD mediates ETI-triggered ROS production and that PTI-related PRRs receptors play a key role in this process. We next examined changes in the transcriptional and protein levels of RBOHD, and found that vaccination with D36E in Col-0 plants promoted the transcriptional and protein level expression of RBOHD (fig. 3E, F), and interestingly, D36E (avrRpt2) caused stronger expression of RBOHD. Surprisingly, the expression level of RBOHD in D36E (avrRpt2) -treated bbc plants was consistent with Col-0 (fig. 3E, F). These results indicate that ETI induces expression of RBOHD independently of PRRs receptors, but activation of RBOHD requires PRRs receptors. Previous studies have reported that several kinases such as BIK1 and CPKs in the PTI signal are involved in direct phosphorylation of RBOHD to mediate ROS production. Therefore, we examined ETI-related ROS production in the cpk4/5/6/11 triple mutant and the bik1 mutant, and found that ETI-triggered ROS were greatly reduced in the bik1 mutant compared to Col-0 plants, while there was no significant effect in the cpk4/5/6/11 mutant (FIG. 4). This result suggests that BIK1 is an important kinase for activating RBOHD-mediated ETI-ROS production.

Example 4 ETI upregulates expression of BAK1, BIK1, MPK3, and RBOHD genes

If PRRs and their co-receptors are critical to ETI immunity, plants may develop a mechanism that enables ETI to enhance plant immunity by enhancing PRRs or their co-receptors or other PTI pathway components. To test this hypothesis, we examined several key PTI core components including BAK1, BIK1, MPK3, and RBOHD at the transcriptional and protein levels, respectively, by real-time fluorescent quantitative PCR (fig. 5A and 3E) and western blot (fig. 5B and 3F). We found that these key components of the PTI signalling pathway induced some level of up-regulated expression upon treatment with D36E (which activates only PTI), while strain D36E (avrRpt2) which induced ETI induced significantly higher expression of these genes. More importantly, the bbc mutant also induced a large upregulation of these genes after treatment of the D36E (avrRpt2) strain, thus indicating that ETI causes the expression of a strong key signal component of PTI and that this process is independent of the PRRs receptors or co-receptors. An important part of the ETI immune response elicited by AvrRpt2 is to ensure high level expression of key components of the PTI signaling pathway (such as PRRs co-receptors and downstream signaling components), consistent with the conclusion that PTI is an important component of ETI.

Taken together, our studies indicate that PTI-related PRRs receptors or co-receptors are critical for plants to elicit normal and efficient ETI immunity, and we also reveal previously undiscovered mutual potentiation and dependence between PTI and ETI pathways. Our findings suggest a novel mechanism of plant double-layer immunity in which plants activate robust immune output by integrating the PTI mechanism including PRRs-BIK1-RBOHD cascade as an important constituent essential to ETI. Very interestingly, ETI can also strongly enhance the expression of the transcriptional and protein levels of the key components BAK1, BIK1, RBOHD and MPK3 of the PTI upstream signaling pathway. Previous studies reported that PTI signals in plants are down-regulated by their own feedback mechanisms or inhibited by effector factors of pathogenic pathogens after activation. The ETI of the plant can restore PTI signal components greatly, and further successfully overcome the inhibition effect of negative feedback mechanism of the plant or exogenous pathogenic bacteria effector. Our studies well explain the reasons and mechanisms that there are many similarities in the downstream immune responses of PTI and ETI, and this important knowledge theory may provide a basis for guiding the defense against pest effects on agricultural production in future agriculture by enhancing PTI as a general strategy for activating ETI.

Sequence listing

<110> China academy of sciences molecular plant science remarkable innovation center

<120> method for enhancing immune effect of plant and use thereof

<130> 200173

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 921

<212> PRT

<213> Arabidopsis thaliana

<400> 1

Met Lys Met Arg Arg Gly Asn Ser Ser Asn Asp His Glu Leu Gly Ile

1 5 10 15

Leu Arg Gly Ala Asn Ser Asp Thr Asn Ser Asp Thr Glu Ser Ile Ala

20 25 30

Ser Asp Arg Gly Ala Phe Ser Gly Pro Leu Gly Arg Pro Lys Arg Ala

35 40 45

Ser Lys Lys Asn Ala Arg Phe Ala Asp Asp Leu Pro Lys Arg Ser Asn

50 55 60

Ser Val Ala Gly Gly Arg Gly Asp Asp Asp Glu Tyr Val Glu Ile Thr

65 70 75 80

Leu Asp Ile Arg Asp Asp Ser Val Ala Val His Ser Val Gln Gln Ala

85 90 95

Ala Gly Gly Gly Gly His Leu Glu Asp Pro Glu Leu Ala Leu Leu Thr

100 105 110

Lys Lys Thr Leu Glu Ser Ser Leu Asn Asn Thr Thr Ser Leu Ser Phe

115 120 125

Phe Arg Ser Thr Ser Ser Arg Ile Lys Asn Ala Ser Arg Glu Leu Arg

130 135 140

Arg Val Phe Ser Arg Arg Pro Ser Pro Ala Val Arg Arg Phe Asp Arg

145 150 155 160

Thr Ser Ser Ala Ala Ile His Ala Leu Lys Gly Leu Lys Phe Ile Ala

165 170 175

Thr Lys Thr Ala Ala Trp Pro Ala Val Asp Gln Arg Phe Asp Lys Leu

180 185 190

Ser Ala Asp Ser Asn Gly Leu Leu Leu Ser Ala Lys Phe Trp Glu Cys

195 200 205

Leu Gly Met Asn Lys Glu Ser Lys Asp Phe Ala Asp Gln Leu Phe Arg

210 215 220

Ala Leu Ala Arg Arg Asn Asn Val Ser Gly Asp Ala Ile Thr Lys Glu

225 230 235 240

Gln Leu Arg Ile Phe Trp Glu Gln Ile Ser Asp Glu Ser Phe Asp Ala

245 250 255

Lys Leu Gln Val Phe Phe Asp Met Val Asp Lys Asp Glu Asp Gly Arg

260 265 270

Val Thr Glu Glu Glu Val Ala Glu Ile Ile Ser Leu Ser Ala Ser Ala

275 280 285

Asn Lys Leu Ser Asn Ile Gln Lys Gln Ala Lys Glu Tyr Ala Ala Leu

290 295 300

Ile Met Glu Glu Leu Asp Pro Asp Asn Ala Gly Phe Ile Met Ile Glu

305 310 315 320

Asn Leu Glu Met Leu Leu Leu Gln Ala Pro Asn Gln Ser Val Arg Met

325 330 335

Gly Asp Ser Arg Ile Leu Ser Gln Met Leu Ser Gln Lys Leu Arg Pro

340 345 350

Ala Lys Glu Ser Asn Pro Leu Val Arg Trp Ser Glu Lys Ile Lys Tyr

355 360 365

Phe Ile Leu Asp Asn Trp Gln Arg Leu Trp Ile Met Met Leu Trp Leu

370 375 380

Gly Ile Cys Gly Gly Leu Phe Thr Tyr Lys Phe Ile Gln Tyr Lys Asn

385 390 395 400

Lys Ala Ala Tyr Gly Val Met Gly Tyr Cys Val Cys Val Ala Lys Gly

405 410 415

Gly Ala Glu Thr Leu Lys Phe Asn Met Ala Leu Ile Leu Leu Pro Val

420 425 430

Cys Arg Asn Thr Ile Thr Trp Leu Arg Asn Lys Thr Lys Leu Gly Thr

435 440 445

Val Val Pro Phe Asp Asp Ser Leu Asn Phe His Lys Val Ile Ala Ser

450 455 460

Gly Ile Val Val Gly Val Leu Leu His Ala Gly Ala His Leu Thr Cys

465 470 475 480

Asp Phe Pro Arg Leu Ile Ala Ala Asp Glu Asp Thr Tyr Glu Pro Met

485 490 495

Glu Lys Tyr Phe Gly Asp Gln Pro Thr Ser Tyr Trp Trp Phe Val Lys

500 505 510

Gly Val Glu Gly Trp Thr Gly Ile Val Met Val Val Leu Met Ala Ile

515 520 525

Ala Phe Thr Leu Ala Thr Pro Trp Phe Arg Arg Asn Lys Leu Asn Leu

530 535 540

Pro Asn Phe Leu Lys Lys Leu Thr Gly Phe Asn Ala Phe Trp Tyr Thr

545 550 555 560

His His Leu Phe Ile Ile Val Tyr Ala Leu Leu Ile Val His Gly Ile

565 570 575

Lys Leu Tyr Leu Thr Lys Ile Trp Tyr Gln Lys Thr Thr Trp Met Tyr

580 585 590

Leu Ala Val Pro Ile Leu Leu Tyr Ala Ser Glu Arg Leu Leu Arg Ala

595 600 605

Phe Arg Ser Ser Ile Lys Pro Val Lys Met Ile Lys Val Ala Val Tyr

610 615 620

Pro Gly Asn Val Leu Ser Leu His Met Thr Lys Pro Gln Gly Phe Lys

625 630 635 640

Tyr Lys Ser Gly Gln Phe Met Leu Val Asn Cys Arg Ala Val Ser Pro

645 650 655

Phe Glu Trp His Pro Phe Ser Ile Thr Ser Ala Pro Gly Asp Asp Tyr

660 665 670

Leu Ser Val His Ile Arg Thr Leu Gly Asp Trp Thr Arg Lys Leu Arg

675 680 685

Thr Val Phe Ser Glu Val Cys Lys Pro Pro Thr Ala Gly Lys Ser Gly

690 695 700

Leu Leu Arg Ala Asp Gly Gly Asp Gly Asn Leu Pro Phe Pro Lys Val

705 710 715 720

Leu Ile Asp Gly Pro Tyr Gly Ala Pro Ala Gln Asp Tyr Lys Lys Tyr

725 730 735

Asp Val Val Leu Leu Val Gly Leu Gly Ile Gly Ala Thr Pro Met Ile

740 745 750

Ser Ile Leu Lys Asp Ile Ile Asn Asn Met Lys Gly Pro Asp Arg Asp

755 760 765

Ser Asp Ile Glu Asn Asn Asn Ser Asn Asn Asn Ser Lys Gly Phe Lys

770 775 780

Thr Arg Lys Ala Tyr Phe Tyr Trp Val Thr Arg Glu Gln Gly Ser Phe

785 790 795 800

Glu Trp Phe Lys Gly Ile Met Asp Glu Ile Ser Glu Leu Asp Glu Glu

805 810 815

Gly Ile Ile Glu Leu His Asn Tyr Cys Thr Ser Val Tyr Glu Glu Gly

820 825 830

Asp Ala Arg Val Ala Leu Ile Ala Met Leu Gln Ser Leu Gln His Ala

835 840 845

Lys Asn Gly Val Asp Val Val Ser Gly Thr Arg Val Lys Ser His Phe

850 855 860

Ala Lys Pro Asn Trp Arg Gln Val Tyr Lys Lys Ile Ala Val Gln His

865 870 875 880

Pro Gly Lys Arg Ile Gly Val Phe Tyr Cys Gly Met Pro Gly Met Ile

885 890 895

Lys Glu Leu Lys Asn Leu Ala Leu Asp Phe Ser Arg Lys Thr Thr Thr

900 905 910

Lys Phe Asp Phe His Lys Glu Asn Phe

915 920

<210> 2

<211> 1173

<212> PRT

<213> Arabidopsis thaliana

<400> 2

Met Lys Leu Leu Ser Lys Thr Phe Leu Ile Leu Thr Leu Thr Phe Phe

1 5 10 15

Phe Phe Gly Ile Ala Leu Ala Lys Gln Ser Phe Glu Pro Glu Ile Glu

20 25 30

Ala Leu Lys Ser Phe Lys Asn Gly Ile Ser Asn Asp Pro Leu Gly Val

35 40 45

Leu Ser Asp Trp Thr Ile Ile Gly Ser Leu Arg His Cys Asn Trp Thr

50 55 60

Gly Ile Thr Cys Asp Ser Thr Gly His Val Val Ser Val Ser Leu Leu

65 70 75 80

Glu Lys Gln Leu Glu Gly Val Leu Ser Pro Ala Ile Ala Asn Leu Thr

85 90 95

Tyr Leu Gln Val Leu Asp Leu Thr Ser Asn Ser Phe Thr Gly Lys Ile

100 105 110

Pro Ala Glu Ile Gly Lys Leu Thr Glu Leu Asn Gln Leu Ile Leu Tyr

115 120 125

Leu Asn Tyr Phe Ser Gly Ser Ile Pro Ser Gly Ile Trp Glu Leu Lys

130 135 140

Asn Ile Phe Tyr Leu Asp Leu Arg Asn Asn Leu Leu Ser Gly Asp Val

145 150 155 160

Pro Glu Glu Ile Cys Lys Thr Ser Ser Leu Val Leu Ile Gly Phe Asp

165 170 175

Tyr Asn Asn Leu Thr Gly Lys Ile Pro Glu Cys Leu Gly Asp Leu Val

180 185 190

His Leu Gln Met Phe Val Ala Ala Gly Asn His Leu Thr Gly Ser Ile

195 200 205

Pro Val Ser Ile Gly Thr Leu Ala Asn Leu Thr Asp Leu Asp Leu Ser

210 215 220

Gly Asn Gln Leu Thr Gly Lys Ile Pro Arg Asp Phe Gly Asn Leu Leu

225 230 235 240

Asn Leu Gln Ser Leu Val Leu Thr Glu Asn Leu Leu Glu Gly Asp Ile

245 250 255

Pro Ala Glu Ile Gly Asn Cys Ser Ser Leu Val Gln Leu Glu Leu Tyr

260 265 270

Asp Asn Gln Leu Thr Gly Lys Ile Pro Ala Glu Leu Gly Asn Leu Val

275 280 285

Gln Leu Gln Ala Leu Arg Ile Tyr Lys Asn Lys Leu Thr Ser Ser Ile

290 295 300

Pro Ser Ser Leu Phe Arg Leu Thr Gln Leu Thr His Leu Gly Leu Ser

305 310 315 320

Glu Asn His Leu Val Gly Pro Ile Ser Glu Glu Ile Gly Phe Leu Glu

325 330 335

Ser Leu Glu Val Leu Thr Leu His Ser Asn Asn Phe Thr Gly Glu Phe

340 345 350

Pro Gln Ser Ile Thr Asn Leu Arg Asn Leu Thr Val Leu Thr Val Gly

355 360 365

Phe Asn Asn Ile Ser Gly Glu Leu Pro Ala Asp Leu Gly Leu Leu Thr

370 375 380

Asn Leu Arg Asn Leu Ser Ala His Asp Asn Leu Leu Thr Gly Pro Ile

385 390 395 400

Pro Ser Ser Ile Ser Asn Cys Thr Gly Leu Lys Leu Leu Asp Leu Ser

405 410 415

His Asn Gln Met Thr Gly Glu Ile Pro Arg Gly Phe Gly Arg Met Asn

420 425 430

Leu Thr Phe Ile Ser Ile Gly Arg Asn His Phe Thr Gly Glu Ile Pro

435 440 445

Asp Asp Ile Phe Asn Cys Ser Asn Leu Glu Thr Leu Ser Val Ala Asp

450 455 460

Asn Asn Leu Thr Gly Thr Leu Lys Pro Leu Ile Gly Lys Leu Gln Lys

465 470 475 480

Leu Arg Ile Leu Gln Val Ser Tyr Asn Ser Leu Thr Gly Pro Ile Pro

485 490 495

Arg Glu Ile Gly Asn Leu Lys Asp Leu Asn Ile Leu Tyr Leu His Ser

500 505 510

Asn Gly Phe Thr Gly Arg Ile Pro Arg Glu Met Ser Asn Leu Thr Leu

515 520 525

Leu Gln Gly Leu Arg Met Tyr Ser Asn Asp Leu Glu Gly Pro Ile Pro

530 535 540

Glu Glu Met Phe Asp Met Lys Leu Leu Ser Val Leu Asp Leu Ser Asn

545 550 555 560

Asn Lys Phe Ser Gly Gln Ile Pro Ala Leu Phe Ser Lys Leu Glu Ser

565 570 575

Leu Thr Tyr Leu Ser Leu Gln Gly Asn Lys Phe Asn Gly Ser Ile Pro

580 585 590

Ala Ser Leu Lys Ser Leu Ser Leu Leu Asn Thr Phe Asp Ile Ser Asp

595 600 605

Asn Leu Leu Thr Gly Thr Ile Pro Gly Glu Leu Leu Ala Ser Leu Lys

610 615 620

Asn Met Gln Leu Tyr Leu Asn Phe Ser Asn Asn Leu Leu Thr Gly Thr

625 630 635 640

Ile Pro Lys Glu Leu Gly Lys Leu Glu Met Val Gln Glu Ile Asp Leu

645 650 655

Ser Asn Asn Leu Phe Ser Gly Ser Ile Pro Arg Ser Leu Gln Ala Cys

660 665 670

Lys Asn Val Phe Thr Leu Asp Phe Ser Gln Asn Asn Leu Ser Gly His

675 680 685

Ile Pro Asp Glu Val Phe Gln Gly Met Asp Met Ile Ile Ser Leu Asn

690 695 700

Leu Ser Arg Asn Ser Phe Ser Gly Glu Ile Pro Gln Ser Phe Gly Asn

705 710 715 720

Met Thr His Leu Val Ser Leu Asp Leu Ser Ser Asn Asn Leu Thr Gly

725 730 735

Glu Ile Pro Glu Ser Leu Ala Asn Leu Ser Thr Leu Lys His Leu Lys

740 745 750

Leu Ala Ser Asn Asn Leu Lys Gly His Val Pro Glu Ser Gly Val Phe

755 760 765

Lys Asn Ile Asn Ala Ser Asp Leu Met Gly Asn Thr Asp Leu Cys Gly

770 775 780

Ser Lys Lys Pro Leu Lys Pro Cys Thr Ile Lys Gln Lys Ser Ser His

785 790 795 800

Phe Ser Lys Arg Thr Arg Val Ile Leu Ile Ile Leu Gly Ser Ala Ala

805 810 815

Ala Leu Leu Leu Val Leu Leu Leu Val Leu Ile Leu Thr Cys Cys Lys

820 825 830

Lys Lys Glu Lys Lys Ile Glu Asn Ser Ser Glu Ser Ser Leu Pro Asp

835 840 845

Leu Asp Ser Ala Leu Lys Leu Lys Arg Phe Glu Pro Lys Glu Leu Glu

850 855 860

Gln Ala Thr Asp Ser Phe Asn Ser Ala Asn Ile Ile Gly Ser Ser Ser

865 870 875 880

Leu Ser Thr Val Tyr Lys Gly Gln Leu Glu Asp Gly Thr Val Ile Ala

885 890 895

Val Lys Val Leu Asn Leu Lys Glu Phe Ser Ala Glu Ser Asp Lys Trp

900 905 910

Phe Tyr Thr Glu Ala Lys Thr Leu Ser Gln Leu Lys His Arg Asn Leu

915 920 925

Val Lys Ile Leu Gly Phe Ala Trp Glu Ser Gly Lys Thr Lys Ala Leu

930 935 940

Val Leu Pro Phe Met Glu Asn Gly Asn Leu Glu Asp Thr Ile His Gly

945 950 955 960

Ser Ala Ala Pro Ile Gly Ser Leu Leu Glu Lys Ile Asp Leu Cys Val

965 970 975

His Ile Ala Ser Gly Ile Asp Tyr Leu His Ser Gly Tyr Gly Phe Pro

980 985 990

Ile Val His Cys Asp Leu Lys Pro Ala Asn Ile Leu Leu Asp Ser Asp

995 1000 1005

Arg Val Ala His Val Ser Asp Phe Gly Thr Ala Arg Ile Leu Gly Phe

1010 1015 1020

Arg Glu Asp Gly Ser Thr Thr Ala Ser Thr Ser Ala Phe Glu Gly Thr

1025 1030 1035 1040

Ile Gly Tyr Leu Ala Pro Glu Phe Ala Tyr Met Arg Lys Val Thr Thr

1045 1050 1055

Lys Ala Asp Val Phe Ser Phe Gly Ile Ile Met Met Glu Leu Met Thr

1060 1065 1070

Lys Gln Arg Pro Thr Ser Leu Asn Asp Glu Asp Ser Gln Asp Met Thr

1075 1080 1085

Leu Arg Gln Leu Val Glu Lys Ser Ile Gly Asn Gly Arg Lys Gly Met

1090 1095 1100

Val Arg Val Leu Asp Met Glu Leu Gly Asp Ser Ile Val Ser Leu Lys

1105 1110 1115 1120

Gln Glu Glu Ala Ile Glu Asp Phe Leu Lys Leu Cys Leu Phe Cys Thr

1125 1130 1135

Ser Ser Arg Pro Glu Asp Arg Pro Asp Met Asn Glu Ile Leu Thr His

1140 1145 1150

Leu Met Lys Leu Arg Gly Lys Ala Asn Ser Phe Arg Glu Asp Arg Asn

1155 1160 1165

Glu Asp Arg Glu Val

1170

<210> 3

<211> 615

<212> PRT

<213> Arabidopsis thaliana

<400> 3

Met Glu Arg Arg Leu Met Ile Pro Cys Phe Phe Trp Leu Ile Leu Val

1 5 10 15

Leu Asp Leu Val Leu Arg Val Ser Gly Asn Ala Glu Gly Asp Ala Leu

20 25 30

Ser Ala Leu Lys Asn Ser Leu Ala Asp Pro Asn Lys Val Leu Gln Ser

35 40 45

Trp Asp Ala Thr Leu Val Thr Pro Cys Thr Trp Phe His Val Thr Cys

50 55 60

Asn Ser Asp Asn Ser Val Thr Arg Val Asp Leu Gly Asn Ala Asn Leu

65 70 75 80

Ser Gly Gln Leu Val Met Gln Leu Gly Gln Leu Pro Asn Leu Gln Tyr

85 90 95

Leu Glu Leu Tyr Ser Asn Asn Ile Thr Gly Thr Ile Pro Glu Gln Leu

100 105 110

Gly Asn Leu Thr Glu Leu Val Ser Leu Asp Leu Tyr Leu Asn Asn Leu

115 120 125

Ser Gly Pro Ile Pro Ser Thr Leu Gly Arg Leu Lys Lys Leu Arg Phe

130 135 140

Leu Arg Leu Asn Asn Asn Ser Leu Ser Gly Glu Ile Pro Arg Ser Leu

145 150 155 160

Thr Ala Val Leu Thr Leu Gln Val Leu Asp Leu Ser Asn Asn Pro Leu

165 170 175

Thr Gly Asp Ile Pro Val Asn Gly Ser Phe Ser Leu Phe Thr Pro Ile

180 185 190

Ser Phe Ala Asn Thr Lys Leu Thr Pro Leu Pro Ala Ser Pro Pro Pro

195 200 205

Pro Ile Ser Pro Thr Pro Pro Ser Pro Ala Gly Ser Asn Arg Ile Thr

210 215 220

Gly Ala Ile Ala Gly Gly Val Ala Ala Gly Ala Ala Leu Leu Phe Ala

225 230 235 240

Val Pro Ala Ile Ala Leu Ala Trp Trp Arg Arg Lys Lys Pro Gln Asp

245 250 255

His Phe Phe Asp Val Pro Ala Glu Glu Asp Pro Glu Val His Leu Gly

260 265 270

Gln Leu Lys Arg Phe Ser Leu Arg Glu Leu Gln Val Ala Ser Asp Asn

275 280 285

Phe Ser Asn Lys Asn Ile Leu Gly Arg Gly Gly Phe Gly Lys Val Tyr

290 295 300

Lys Gly Arg Leu Ala Asp Gly Thr Leu Val Ala Val Lys Arg Leu Lys

305 310 315 320

Glu Glu Arg Thr Gln Gly Gly Glu Leu Gln Phe Gln Thr Glu Val Glu

325 330 335

Met Ile Ser Met Ala Val His Arg Asn Leu Leu Arg Leu Arg Gly Phe

340 345 350

Cys Met Thr Pro Thr Glu Arg Leu Leu Val Tyr Pro Tyr Met Ala Asn

355 360 365

Gly Ser Val Ala Ser Cys Leu Arg Glu Arg Pro Glu Ser Gln Pro Pro

370 375 380

Leu Asp Trp Pro Lys Arg Gln Arg Ile Ala Leu Gly Ser Ala Arg Gly

385 390 395 400

Leu Ala Tyr Leu His Asp His Cys Asp Pro Lys Ile Ile His Arg Asp

405 410 415

Val Lys Ala Ala Asn Ile Leu Leu Asp Glu Glu Phe Glu Ala Val Val

420 425 430

Gly Asp Phe Gly Leu Ala Lys Leu Met Asp Tyr Lys Asp Thr His Val

435 440 445

Thr Thr Ala Val Arg Gly Thr Ile Gly His Ile Ala Pro Glu Tyr Leu

450 455 460

Ser Thr Gly Lys Ser Ser Glu Lys Thr Asp Val Phe Gly Tyr Gly Val

465 470 475 480

Met Leu Leu Glu Leu Ile Thr Gly Gln Arg Ala Phe Asp Leu Ala Arg

485 490 495

Leu Ala Asn Asp Asp Asp Val Met Leu Leu Asp Trp Val Lys Gly Leu

500 505 510

Leu Lys Glu Lys Lys Leu Glu Ala Leu Val Asp Val Asp Leu Gln Gly

515 520 525

Asn Tyr Lys Asp Glu Glu Val Glu Gln Leu Ile Gln Val Ala Leu Leu

530 535 540

Cys Thr Gln Ser Ser Pro Met Glu Arg Pro Lys Met Ser Glu Val Val

545 550 555 560

Arg Met Leu Glu Gly Asp Gly Leu Ala Glu Arg Trp Glu Glu Trp Gln

565 570 575

Lys Glu Glu Met Phe Arg Gln Asp Phe Asn Tyr Pro Thr His His Pro

580 585 590

Ala Val Ser Gly Trp Ile Ile Gly Asp Ser Thr Ser Gln Ile Glu Asn

595 600 605

Glu Tyr Pro Ser Gly Pro Arg

610 615

<210> 4

<211> 395

<212> PRT

<213> Arabidopsis thaliana

<400> 4

Met Gly Ser Cys Phe Ser Ser Arg Val Lys Ala Asp Ile Phe His Asn

1 5 10 15

Gly Lys Ser Ser Asp Leu Tyr Gly Leu Ser Leu Ser Ser Arg Lys Ser

20 25 30

Ser Ser Thr Val Ala Ala Ala Gln Lys Thr Glu Gly Glu Ile Leu Ser

35 40 45

Ser Thr Pro Val Lys Ser Phe Thr Phe Asn Glu Leu Lys Leu Ala Thr

50 55 60

Arg Asn Phe Arg Pro Asp Ser Val Ile Gly Glu Gly Gly Phe Gly Cys

65 70 75 80

Val Phe Lys Gly Trp Leu Asp Glu Ser Thr Leu Thr Pro Thr Lys Pro

85 90 95

Gly Thr Gly Leu Val Ile Ala Val Lys Lys Leu Asn Gln Glu Gly Phe

100 105 110

Gln Gly His Arg Glu Trp Leu Thr Glu Ile Asn Tyr Leu Gly Gln Leu

115 120 125

Ser His Pro Asn Leu Val Lys Leu Ile Gly Tyr Cys Leu Glu Asp Glu

130 135 140

His Arg Leu Leu Val Tyr Glu Phe Met Gln Lys Gly Ser Leu Glu Asn

145 150 155 160

His Leu Phe Arg Arg Gly Ala Tyr Phe Lys Pro Leu Pro Trp Phe Leu

165 170 175

Arg Val Asn Val Ala Leu Asp Ala Ala Lys Gly Leu Ala Phe Leu His

180 185 190

Ser Asp Pro Val Lys Val Ile Tyr Arg Asp Ile Lys Ala Ser Asn Ile

195 200 205

Leu Leu Asp Ala Asp Tyr Asn Ala Lys Leu Ser Asp Phe Gly Leu Ala

210 215 220

Arg Asp Gly Pro Met Gly Asp Leu Ser Tyr Val Ser Thr Arg Val Met

225 230 235 240

Gly Thr Tyr Gly Tyr Ala Ala Pro Glu Tyr Met Ser Ser Gly His Leu

245 250 255

Asn Ala Arg Ser Asp Val Tyr Ser Phe Gly Val Leu Leu Leu Glu Ile

260 265 270

Leu Ser Gly Lys Arg Ala Leu Asp His Asn Arg Pro Ala Lys Glu Glu

275 280 285

Asn Leu Val Asp Trp Ala Arg Pro Tyr Leu Thr Ser Lys Arg Lys Val

290 295 300

Leu Leu Ile Val Asp Asn Arg Leu Asp Thr Gln Tyr Leu Pro Glu Glu

305 310 315 320

Ala Val Arg Met Ala Ser Val Ala Val Gln Cys Leu Ser Phe Glu Pro

325 330 335

Lys Ser Arg Pro Thr Met Asp Gln Val Val Arg Ala Leu Gln Gln Leu

340 345 350

Gln Asp Asn Leu Gly Lys Pro Ser Gln Thr Asn Pro Val Lys Asp Thr

355 360 365

Lys Lys Leu Gly Phe Lys Thr Gly Thr Thr Lys Ser Ser Glu Lys Arg

370 375 380

Phe Thr Gln Lys Pro Phe Gly Arg His Leu Val

385 390 395

<210> 5

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 5

ccgctcgaga tgaaaattgc tccagttgc 29

<210> 6

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 6

cggactagtt tagcggtaga gcattgcgt 29

<210> 7

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 7

tgcgctgcca gataatacac tatt 24

<210> 8

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 8

tgctgcccaa catcaggtt 19

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 9

gatcaaggtg gctgtttacc c 21

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 10

tcggcagttc accaacatga 20

<210> 11

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 11

aggtgttctc ttggagacta gga 23

<210> 12

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 12

agagatccag aacttgtagc gt 22

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 13

ttcttcacag cgatcccgtc 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 14

ttgcgttgta gtccgcatca 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 15

ccaagaagcc atagcactca 20

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 16

agccattcgg atggttattg 20

<210> 17

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 17

cttttcacga tccccgacag gg 22

<210> 18

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 18

gcggtagagc attgcgtgtg g 21

<210> 19

<211> 22

<212> PRT

<213> Artificial Sequence

<400> 19

Gln Arg Leu Ser Thr Gly Ser Arg Ile Asn Ser Ala Lys Asp Asp Ala

1 5 10 15

Ala Gly Leu Gln Ile Ala

20

<210> 20

<211> 18

<212> PRT

<213> Artificial Sequence

<400> 20

Ser Lys Glu Lys Phe Glu Arg Thr Lys Pro His Val Asn Val Gly Thr

1 5 10 15

Ile Gly

Claims

1. A method of increasing the reactive oxygen species, ROS, production of an ETI effect in a plant, or enhancing an ETI effect in a plant or plant cell, comprising enhancing a PTI effect in said plant or plant cell, preferably said method comprising one or more steps selected from the group consisting of:

(1) treating a plant or plant cell with an agent that induces PTI,

(3) down-regulating the expression or activity of a protein that inhibits the effects of PTI,

more preferably, upregulating the expression or activity of a protein that enhances the effect of PTI comprises one or more of the following steps:

(1) up-regulating the expression or activity of RBOHD,

(2) up-regulating the expression or activity of the PRR receptor,

(3) up-regulating the expression or activity of PRR co-receptors,

(4) up-regulating the expression or activity of BIK1 or a homologue thereof.

2. The method of claim 1, wherein the method has one or more characteristics selected from the group consisting of:

the agents inducing PTI were flg22 from bacterial flagellin, elongation factor elf18, fungal chitin;

the method comprises contacting the plant with a combination of one or any of the following agents:

(1) an agent that upregulates the expression or activity of RBOHD,

(2) an agent that upregulates the expression or activity of a PRR receptor,

(3) an agent that upregulates the expression or activity of a PRR co-receptor,

(4) up-regulating the expression or activity of BIK1 or a homologue thereof;

the homologues of BIK1 are OsRLCK185, OsRLCK 176;

the PRR receptor is selected from FLS2, EFR, LYM1/2/3, LYK4/5, LORE, OsCEBiP, OsLYP4/6, FLS3 or CORE, preferably FLS2, OsCEBiP or FLS 3;

the PRR co-receptor is selected from BAK1, BKK1, CERK1 or OsCERK1, preferably BAK1 or CERK 1.

3. The method of claim 2, wherein the agent that upregulates expression of RBOHD, PRR receptor, PRR co-receptor, or BIK1, or a homolog thereof is selected from the group consisting of

(1) An agent which enhances the transcriptional activity of the corresponding gene,

(2) an agent which increases the transcription level of the corresponding gene,

(3) an agent that inhibits degradation of mRNA of a corresponding gene,

(4) an agent for promoting translation of mRNA of the corresponding gene, or

(5) Expression vectors and/or integration vectors containing the corresponding genes,

preferably, the first and second electrodes are formed of a metal,

the agent for up-regulating the expression of the RBOHD is an expression vector of the RBOHD;

the agent for up-regulating the expression of the PRR receptor is an expression vector of the PRR receptor;

the agent for up-regulating the expression of the PRR co-receptor is an expression vector of the PRR co-receptor;

the reagent for up-regulating the expression of BIK1 or the homologue thereof is an expression vector of BIK1 or the homologue thereof.

4. A method of reducing the reactive oxygen species, ROS, production of an ETI effect in a plant, or of attenuating an ETI effect in a plant or plant cell, said method comprising attenuating a PTI effect in said plant or plant cell, preferably said method comprising one or more steps selected from the group consisting of:

(1) treating a plant or plant cell with an agent that inhibits PTI,

5. A plant, part or cell thereof, wherein said plant, part or cell overexpresses one or more of RBOHD, PRR receptor, PRR co-receptor, BIK1 or a homologue thereof and/or wherein said plant, part or cell comprises a vector expressing one or more of RBOHD, PRR receptor, PRR co-receptor, BIK1 or a homologue thereof.

6. A product comprising or produced from a plant, part thereof or cell thereof, which plant, part or cell overexpresses one or any more of RBOHD, PRR receptor, PRR co-receptor, BIK1 or a homologue thereof, and/or which plant, part or cell comprises a vector expressing one or any more of RBOHD, PRR receptor, PRR co-receptor, BIK1 or a homologue thereof,

preferably, the plant product is a foodstuff comprising or prepared from the plant, part thereof or cells thereof, or the plant product is a foodstuff comprising or prepared from the plant, part thereof or cells thereof,

preferably, the plant is selected from arabidopsis thaliana, tomato, potato, cabbage, tobacco, cucumber, canola, moss, canola, rapeseed, soybean, crambe, mustard, castor bean, peanut, sesame, cottonseed, linseed, safflower, oil palm, flax, sunflower, maize, rice, barley, millet, rye, wheat, oat, alfalfa, sorghum.

7. A method for producing a food material or food product comprising

(1) Obtaining a plant, part thereof or cell thereof which overexpresses one or more of RBOHD, PRR receptor, PRR co-receptor, BIK1 or a homologue thereof and/or which comprises a vector which expresses one or more of RBOHD, PRR receptor, PRR co-receptor, BIK1 or a homologue thereof,

(2) producing said food material or food from said plant, part thereof or cell thereof.

8. A method of increasing expression or activity of BAK1, BIK1, MPK3, a RBOHD gene or a homologue thereof, or enhancing a PTI effect in a plant or plant cell, or attenuating or preventing suppression of a PTI effect in a plant or plant cell, the method comprising enhancing an ETI effect in the plant or plant cell, preferably the method comprising one or more steps selected from:

(1) expression of an ETI inducer in a plant or plant cell,

(3) down-regulating the expression or activity of a gene that inhibits the effects of ETI,

preferably, said PTI effect is inhibited by a plant or plant cell self-feedback and/or by an effector of a pathogenic microorganism, or

The ETI inducer is selected from an effector of a pathogen infecting the plant, an NLR protein regulated by an inducible promoter, or other effector capable of inducing ETI.

9. Use of an agent that enhances the PTI effect of a plant or plant cell for enhancing the ETI effect of a plant or plant cell, or for increasing the reactive oxygen species production of the ETI effect of a plant, preferably, the agent is selected from one or any of the following:

(1) (ii) an agent that induces PTI,

10. Use of an agent that attenuates the effects of PTI in a plant or plant cell for attenuating the effects of ETI in a plant or plant cell or reducing the production of Reactive Oxygen Species (ROS) that effects ETI in a plant, preferably, said agent is selected from one or any of the following:

(1) (ii) an agent that inhibits PTI,