CN113481222B - Application of arrowed pea glutamylcysteine synthetase gene - Google Patents
Application of arrowed pea glutamylcysteine synthetase gene Download PDFInfo
- Publication number
- CN113481222B CN113481222B CN202110768333.9A CN202110768333A CN113481222B CN 113481222 B CN113481222 B CN 113481222B CN 202110768333 A CN202110768333 A CN 202110768333A CN 113481222 B CN113481222 B CN 113481222B
- Authority
- CN
- China
- Prior art keywords
- pea
- gene
- glutamylcysteine synthetase
- seq
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
- C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
- C12Y205/01047—Cysteine synthase (2.5.1.47)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses an application of an arrow pea glutamylcysteine synthetase gene, wherein the nucleotide sequence of the arrow pea glutamylcysteine synthetase gene is shown as SEQ ID No. 1; the amino acid sequence of the arrowed pea glutamylcysteine synthetase is shown in SEQ ID No. 2. The invention discovers that the arabidopsis thaliana with the arrowroot pea glutamylcysteine synthetase gene overexpressed in vivo has obviously improved cadmium tolerance compared with wild arabidopsis thaliana, and the gene can regulate and control the cadmium tolerance of plants, so that the arrowroot pea glutamylcysteine synthetase and the gene for coding the synthetase can be applied to genetic engineering genetic breeding of crops, and can be used as an efficient crop cadmium pollution control method.
Description
Technical Field
The invention belongs to the technical field of plant genetic engineering, and particularly relates to arrow pea glutamylcysteine synthetase (Vs gamma-ECS), an arrow pea glutamylcysteine synthetase gene and application of an overexpression vector inserted with the arrow pea glutamylcysteine synthetase gene in improvement of cadmium tolerance of plants.
Background
Cadmium (Cd) is a common heavy metal pollutant in soil and water, and the Cd has extremely strong migration capability in a water-soil-plant system, is easy to accumulate in rice, wheat, corn, vegetables and pasture (WHO, 2011), and can be continuously enriched in a human body finally along with the transmission of a food chain. Thus, long term exposure to low levels of Cd can also pose a serious threat to human health.
The Cd pollution farmland treatment is an effective measure for reducing the accumulation of Cd in crops. The method for restoring Cd polluted soil through physical and chemical methods such as chemical leaching, foreign soil covering, remote landfill, electric restoration, chemical fixation, biochar adsorption and the like has obvious effect, but has the problems of high cost, complex process, high equipment and technical requirements, easy initiation of secondary pollution and the like (Cao Chen Hao and the like, 2019). Therefore, the search for a more reasonable and efficient method for preventing and controlling the Cd pollution of crops becomes an important research direction for reducing the risk of the Cd in food.
Phytoremediation is a method for extracting pollutants from soil by using plants, has the advantages of low investment, high efficiency, easy operation, no secondary pollution and the like, is widely applied to remediation of heavy metal contaminated soil, and the improvement of cadmium tolerance and accumulation of plants are important factors for realizing phytoremediation of cadmium contaminated soil. Therefore, the research and the illustration of the absorption and distribution mechanism of the Cd in the plants, and the discovery of the potential key genes in the process are the basis and the necessary premise for phytoremediation of the Cd-polluted soil.
Disclosure of Invention
Based on the above, one of the purposes of the present invention is to provide an application of the arrowroot glutamylcysteine synthetase gene in improving the stress resistance of plants, especially the cadmium resistance, and an application in genetic breeding for improving the cadmium resistance of plants.
The specific technical scheme for realizing the aim of the invention is as follows:
the application of the arrowed pea glutamylcysteine synthetase gene in improving the stress resistance of plants, wherein the gene is a nucleotide sequence shown as SEQ ID No. 1; or a nucleotide sequence which is complementary and matched with SEQ ID No. 1; or a nucleotide sequence with the coding amino acid sequence shown as SEQ ID No. 2.
The application of the Arundina Gelatinosum glutamylcysteine synthetase gene in improving the cadmium tolerance of plants, wherein the gene is a nucleotide sequence shown as SEQ ID No. 1; or a nucleotide sequence which is complementary and matched with SEQ ID No. 1; or a nucleotide sequence with the coding amino acid sequence shown as SEQ ID No. 2.
The application of the arrowroot glutamylcysteine synthetase gene in genetic breeding for improving the tolerance of plants to cadmium, wherein the gene is a nucleotide sequence shown as SEQ ID No. 1; or a nucleotide sequence which is complementary and matched with SEQ ID No. 1; or a nucleotide sequence with the coding amino acid sequence shown as SEQ ID No. 2.
Another object of the present invention is to provide the use of a vetch glutamylcysteine synthetase for improving plant stress resistance, especially cadmium tolerance, and for genetic breeding to improve plant tolerance to cadmium.
The specific technical scheme for realizing the aim of the invention is as follows:
the application of the arrowroot pea glutamylcysteine synthetase in improving the stress resistance of plants is disclosed, wherein the amino acid sequence of the arrowroot pea glutamylcysteine synthetase is shown as SEQ ID No. 2; or the amino acid sequence shown in SEQ ID No.2 is substituted, deleted and/or added with one or more amino acids, but the protein activity is the same.
The application of the arrowroot pea glutamylcysteine synthetase in improving the cadmium tolerance of plants is disclosed, wherein the amino acid sequence of the arrowroot pea glutamylcysteine synthetase is shown as SEQ ID No. 2; or the amino acid sequence shown as SEQ ID No.2 is substituted, deleted and/or added with one or more amino acids, but the protein activity is the same.
The application of the arrowroot pea glutamylcysteine synthetase in genetic breeding for improving the tolerance of plants to cadmium, wherein the amino acid sequence of the arrowroot pea glutamylcysteine synthetase is shown as SEQ ID No. 2; or the amino acid sequence shown as SEQ ID No.2 is substituted, deleted and/or added with one or more amino acids, but the protein activity is the same.
The invention also provides an overexpression vector, which can improve the cadmium tolerance of plants and improve the cadmium tolerance of the plants.
The specific technical scheme for realizing the aim of the invention is as follows:
an overexpression vector inserted with an arrow pea glutamylcysteine synthetase gene, wherein the gene is a nucleotide sequence shown as SEQ ID No. 1; or a nucleotide sequence which is complementary and matched with SEQ ID No. 1; or a nucleotide sequence with the coding amino acid sequence shown as SEQ ID No. 2.
In some of these embodiments, the overexpression vector is pCAMBIA1304-Vs γ -ECS.
The invention also provides a biological agent for improving the cadmium tolerance of plants.
The specific technical scheme for realizing the aim of the invention is as follows:
a biological agent for improving plant cadmium tolerance, wherein the active ingredient of the biological agent is derived from an overexpression vector inserted with an arrow pea glutamylcysteine synthetase gene, or the active ingredient of the biological agent contains a biological product for regulating and controlling the expression of the arrow pea glutamylcysteine synthetase gene, and the gene is a nucleotide sequence shown as SEQ ID No. 1; or a nucleotide sequence which is complementary and matched with SEQ ID No. 1; or a nucleotide sequence with the coding amino acid sequence shown as SEQ ID No. 2.
The invention also provides a method for regulating and controlling the cadmium tolerance of plants.
The specific technical scheme for realizing the aim of the invention is as follows:
a method for regulating and controlling plant cadmium tolerance, which comprises regulating and controlling the expression of an arrow pea glutamylcysteine synthetase gene, wherein the gene is a nucleotide sequence shown as SEQ ID No. 1; or a nucleotide sequence which is complementary and matched with SEQ ID No. 1; or a nucleotide sequence with the coding amino acid sequence shown as SEQ ID No. 2.
Compared with the prior art, the invention has the following beneficial effects:
the method comprises the steps of carrying out reverse transcription on total RNA of arrow-tongue pea seedlings into cDNA, and carrying out amplification by taking the cDNA as a template to obtain a gene for coding arrow-tongue pea glutamylcysteine synthetase Vs gamma-ECS; the gene is cloned to a pCAMBIA1304 vector to obtain an overexpression vector, arabidopsis thaliana is transformed by agrobacterium to obtain a transgenic arabidopsis thaliana plant, and the arabidopsis thaliana with the over-expressed Vs gamma-ECS gene in vivo has obviously improved cadmium tolerance compared with wild arabidopsis thaliana, which indicates that the gene can regulate and control the cadmium tolerance of the plant, so the arrowroot glutamyl cysteine synthetase and the gene coding the synthetase can be applied to genetic engineering breeding of crops, and can be used as an efficient crop cadmium pollution control method.
Drawings
FIG. 1 is a comparison of relative expression levels of the Vs γ -ECS gene of Arundina fargesii in different tissues according to example 2 of the present invention.
FIG. 2 shows the expression level of Vs γ -ECS gene extracted from the tissue of the root of Arundina angustifolia in example 2 of the present invention in cadmium-induced for 0-96 hours.
FIG. 3 is a PCR amplification map of transgenic Arabidopsis positive seedlings overexpressing the Vs γ -ECS gene in example 3 of the present invention.
FIG. 4 is a phenotypic analysis of transgenic Arabidopsis plants overexpressing the Vs γ -ECS gene under cadmium treatment and a comparison of root length and fresh weight in example 4 of the present invention; wherein, A is a phenotype analysis; b is a root length comparison graph; c is fresh weight comparison graph.
Detailed Description
In order that the invention may be more fully understood, reference will now be made to the following description. The present invention may be embodied in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.
Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. The various chemicals used in the examples are commercially available.
The amino acid sequence of the arrowed pea glutamylcysteine synthetase is shown as SEQ ID No.2, and the nucleotide sequence of the arrowed pea glutamylcysteine synthetase gene is shown as SEQ ID No. 1.
SEQ ID No.1
ATGGCTACTATCTTCCGAGTGGCGTCCTCCTCCGCCGCTCCTCCTCCGCCGCATAACTTCCGTCTACGGAAAACAACTTCCATTCCTAACAGTTTCTCTTTCTCGTCAATTTGTTCTGACAGGAGAGTTGTTAGCTCCGCTGGCCGTAGATTGATTGTTGCTGCTAGTCCTCCTACTGAAGACGCTGTCGTTGCTACTGAACCGCTCACGAGACAGGATCTCATCGATTATCTCGCTTCTGGTTGTAAACCTAAGGATAAATGGAGAATAGGTACCGAACATGAAAAGTTTGGCTTTGAGCTTGGAAGTTTGCGTCCTGTGAAGTATGAGCAAATAGCAGAATTGCTGAATGGCATTGCTGAGAGATTTGACTGGGAAAAAATAATGGAAGGTGATTACATTATTGGACTCAAACAGGGGAAGCAAAGCATATCATTGGAGCCAGGGGGTCAGTTTGAACTTAGTGGAGCCCCTCTTGAAACCCTGCATCAAACTTGTGCTGAAGTTAATTCGCACCTCTATCAAGTAAAGGCTGTTACTGAAGAAATGGGAATTGGATTTTTGGGGATTGGTTTCCAGCCAAAGTGGGAGCGCAAAGATATACCTATGATGCCAAAGGGAAGATATGAGATTATGAAAAGATACATGCCCAAAGTTGGTTCTCTTGGGCTTGACATGATGTTCAGGACATGCACTGTACAGGTCAATCTGGACTTTAGTTCTGAAGCTGACATGATCAGGAAATTTCGTGCTGGCCTAGCTTTGCAGCCTATAGCAACAGCTCTTTTTGCAAATTCACCTTTCACAGAGGGAAAGCCCAATGGGTTTGTCAGTATGAGAAGTCATATTTGGACTGATACTGACAAGGACCGCACAGGCATGCTGCCTTTTGTTTTTGACGACTCTTTCGGGTTTGAGCAGTACGTTGATTATGCTCTTGATGTTCCAATGTATTTTGCATATCGGCAAAAGAAATATGTCGACTGTACTGGAATGACCTTCAGGGACTTTTTGGCAGGAAGGCTTCCTAGTATTCCTGGTGAATTACCGACTCTTAATGATTGGGAGAATCATTTAACCACTATATTTCCCGAGGTCAGGCTAAAGAGGTATTTGGAGATGAGAGGGGCTGACGGAGGGCCTTGGAGAAGGTTGTGTGCTTTACCAGCATTTTGGGTAGGTTTATTGTACGATGAGGTTTCTTTGCAGCGTGTTTTGGATTTGACAGCAGATTGGACTTTAGAAGAAAGAGAAATGCTAAGGAATAAGGTCACTGTAACCGGTCTAAGGACACCATTTCGAGATGGTTTGCTGAAGCATGTCGCTGAAGAGGTTCTAAAGTTGGCAAAGGATGGCTTGGAAAGAAGAGGCTTTAAGGAATCAGGATTTTTAAATGCGGTAGCTGAGGTGGTTAGAACAGGTGTAACTCCAGCTGAGAGGCTTTTGGAATTGTATCATGGAAAGTGGGAGCAATCTGTAGATCATGTATTTGAAGAATTGCTTTATTAA
SEQ ID No.2
MATIFRVASSSAAPPPPHNFRLRKTTSIPNSFSFSSICSDRRVVSSAGRRLIVAASPPTEDAVVATEPLTRQDLIDYLASGCKPKDKWRIGTEHEKFGFELGSLRPVKYEQIAELLNGIAERFDWEKIMEGDYIIGLKQGKQSISLEPGGQFELSGAPLETLHQTCAEVNSHLYQVKAVTEEMGIGFLGIGFQPKWERKDIPMMPKGRYEIMKRYMPKVGSLGLDMMFRTCTVQVNLDFSSEADMIRKFRAGLALQPIATALFANSPFTEGKPNGFVSMRSHIWTDTDKDRTGMLPFVFDDSFGFEQYVDYALDVPMYFAYRQKKYVDCTGMTFRDFLAGRLPSIPGELPTLNDWENHLTTIFPEVRLKRYLEMRGADGGPWRRLCALPAFWVGLLYDEVSLQRVLDLTADWTLEEREMLRNKVTVTGLRTPFRDGLLKHVAEEVLKLAKDGLERRGFKESGFLNAVAEVVRTGVTPAERLLELYHGKWEQSVDHVFEELLY*
It is understood that modifications of the base sequences referred to in the following examples without changing the amino acid sequence, in view of the degeneracy of the codons, also fall within the scope of the present invention.
The present invention will be described in further detail with reference to the following specific examples and the accompanying drawings.
Example 1 obtaining of the Gene of Arrowed pea glutamylcysteine synthetase (Vs γ -ECS)
The method comprises the following steps:
1. RNA extraction and cDNA cloning
The arrow-headed peas are used as tension fluid numb peas (ZM).
Washing Arrowse pea seeds with deionized water, 10% 2 O 2 Soaking for 15min, washing with deionized water for 8-10 times, placing on a wetting filter paper for germination acceleration at 25 deg.C, placing on a plastic net after the seeds are exposed, and floating in deionized water. When the arrow pea seedlings grow to 10cm, the arrow pea seedlings are cultured in black plastic cups containing 1/2Hoagland (pH 5.5) nutrient solution.
The growth environment of the Arrowed peas is an artificial incubator (PGX-600D, saifu), and the culture conditions are as follows: day temperature 25 ℃, time 16h, night temperature 20 ℃, time 8h, relative humidity (60% -80%).
After 10 days of culture, taking a proper amount of seedlings of the vetch, adding liquid nitrogen, grinding the tissues by using a mortar, quickly transferring the seedlings into a 2.0mL centrifuge tube, and adopting a Plant total RNA Extraction Kit (MiniBEST Plant RNA Extraction Kit, takara); the concentration of RNA was determined spectrophotometrically, while the integrity of RNA was determined by agarose gel electrophoresis. Then, an RNA reverse transcription kit (PrimeScript) was used TM RT reagent Kit with gDNA Eraser, takara), reverse transcribed into cDNA.
2. Amplification of the Vs γ -ECS Gene
Using total cDNA of arrowed pea as a template, and using Vs gamma-ECS-F: 5 'ATGGCTACTACTATCTTCCGAGT GGCG-doped 3' (SEQ ID No: 3) and Vs γ -ECS-R:5 'TTAATAAAGCAATTCTTCAAATACATG-3' (SEQ ID No: 4) are forward and reverse primers, a Virginia Arundinacea Vs gamma-ECS gene fragment is obtained by PCR amplification, and products with correct sizes are detected and recovered by electrophoresis.
PCR amplification procedure: step 1.
Example 2 expression and cadmium-induced expression Studies of the Vs γ -ECS Gene in different Swiss pea tissues
After 10 days of culture of the arrowed peas of example 1, the roots, stems and leaves of the arrowed peas were harvested, respectively. Root, stem and leaf RNAs were extracted separately according to the method of example 1, and then reverse-transcribed into cDNA, real-time quantitative PCR was performed to examine the expression difference of the Vs γ -ECS gene in different tissues of Arrowia Arrowiana. 3 biological replicates were set for each sample, each biological replicate comprising 3 technical replicate quantitations.
After 10 days of culture of Arundina in example 1, 25. Mu.M Cd (CdCl) was added to the culture 2 ·2.5H 2 O), collecting the root of the arrow pea after 0, 6, 12, 24, 48 and 96 hours of treatment. RNA was extracted according to the method of example 1, reverse transcribed into cDNA, real time quantitative PCR and cadmium induced expression of the Virginia Arundina Vs γ -ECS gene was examined. Each sample was set up with 3 biological replicates, each biological replicate comprising 3 technical replicate quantifications.
Real-time quantitative PCR (qRT-PCR) primers:
Vsγ-ECS-Q-F:5′-TTCCCGAGGTCAGGCTAAAG-3′(SEQ ID No:5)
Vsγ-ECS-Q-R:5′-AGTCCAATCTGCTGTCAAATCC-3′(SEQ ID No:6)
taking an Actin11 primer of arrowed pea as an internal reference primer:
Actin11-Q-F：GAGATGAGCGTTTCAGATGTCC(SEQ ID No:7)
Actin11-Q-R:GTTACCATACAAGTCTTTCCTGAT(SEQ ID No:8)
the cDNA template was diluted 5-fold to prepare 20. Mu.L of a reaction system: 10 μ L SYBR Premix Ex Taq II (2X), 0.4 μ L Foorward Primer,0.4 μ L Reverse Primer,2 μ L cDNA,7.8 μ L ddH 2 O, then in a fluorescent quantitative PCR instrument (1)
ep preamplex, eppendorf) was performed. The reaction procedure is as follows: 95 deg.C, 30sec,95 deg.C, 5sec,60 deg.C, 34sec, for a total of 40 cycles. The relative expression quantity of the gene is calculated by taking the Actin11 gene as an internal reference.
The relative expression results of the Vietnamese pea Vs gamma-ECS gene in different tissues are shown in figure 1, the Vs gamma-ECS gene is expressed in roots, stems and leaves, and the expression difference is not obvious; the expression quantity results of the Vs gamma-ECS gene extracted from the root tissue of the arrow-tongue pea in 0-96 hours of cadmium induction are shown in figure 2, and it can be seen that cadmium can induce the Vs gamma-ECS gene of the arrow-tongue pea to be up-regulated and expressed.
Example 3 construction of Vs gamma-ECS Gene overexpression vectors and detection of Positive plants
The method comprises the following steps:
1. construction of Vs Gamma-ECS Gene overexpression vector
Taking cDNA of Vs gamma-ECS gene as a template, carrying out PCR amplification on a 1506bp coding region, recovering and purifying PCR amplification products, connecting the Vs gamma-ECS gene to pCAMBIA1304 plasmid by enzyme digestion and enzyme ligation, selecting positive clones after transformation, sequencing, transforming the correct plasmid into agrobacterium EHA105, taking 50mg/L hygromycin and 50mg/L kara adriamycin as resistance screens, and identifying the obtained single clone as positive through PCR. The Arabidopsis thaliana material was transformed by the Agrobacterium-mediated method.
2. Detection of positive seedlings in transgenic plants over-expressing Vs gamma-ECS gene
The expression level of the Vs gamma-ECS gene in the transgenic plant is determined by RT-PCR technology, the plant with high expression of the Vs gamma-ECS gene is detected to be a positive seedling, the mark is 35S:: vs gamma-ECS (figure 3), and positive homozygous lines # 1, #4 and #6 over-expressing the Vs gamma-ECS gene are selected for subsequent experiments.
Example 4 detection of cadmium tolerance in transgenic plants
Disinfecting the seeds of transgenic Arabidopsis thaliana and wild Arabidopsis thaliana, sowing them in 1/2MS minimal medium or containing 0-60 muM CdCl 2 Vernalizing the strain on a 1/2MS culture medium at 4 ℃ for 2 days, vertically culturing the strain in an incubator for 8 days, observing the growth condition of the transgenic plant, and photographing and recording. The root length and fresh weight of the plants were then determined, and the results are shown in FIG. 4.
As can be seen from FIG. 4, the root length of the transgenic Arabidopsis thaliana (# 1, #4, and # 6) is significantly longer than that of the wild type Arabidopsis thaliana under the cadmium treatment of 60 μ M, and the fresh weight of the transgenic Arabidopsis thaliana (# 1, #4, and # 6) is significantly greater than that of the wild type Arabidopsis thaliana, which shows that the Vs γ -ECS gene improves the cadmium tolerance of the Arabidopsis thaliana, and plays a certain role in the response of the Virginia Arundina to the cadmium stress.
The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that various changes and modifications can be made by those skilled in the art without departing from the spirit of the invention, and these changes and modifications are all within the scope of the invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> institute of bioengineering, academy of sciences of Guangdong province
Application of <120> arrow-tongue pea glutamylcysteine synthetase gene
<130> 1
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1509
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atggctacta tcttccgagt ggcgtcctcc tccgccgctc ctcctccgcc gcataacttc 60
cgtctacgga aaacaacttc cattcctaac agtttctctt tctcgtcaat ttgttctgac 120
aggagagttg ttagctccgc tggccgtaga ttgattgttg ctgctagtcc tcctactgaa 180
gacgctgtcg ttgctactga accgctcacg agacaggatc tcatcgatta tctcgcttct 240
ggttgtaaac ctaaggataa atggagaata ggtaccgaac atgaaaagtt tggctttgag 300
cttggaagtt tgcgtcctgt gaagtatgag caaatagcag aattgctgaa tggcattgct 360
gagagatttg actgggaaaa aataatggaa ggtgattaca ttattggact caaacagggg 420
aagcaaagca tatcattgga gccagggggt cagtttgaac ttagtggagc ccctcttgaa 480
accctgcatc aaacttgtgc tgaagttaat tcgcacctct atcaagtaaa ggctgttact 540
gaagaaatgg gaattggatt tttggggatt ggtttccagc caaagtggga gcgcaaagat 600
atacctatga tgccaaaggg aagatatgag attatgaaaa gatacatgcc caaagttggt 660
tctcttgggc ttgacatgat gttcaggaca tgcactgtac aggtcaatct ggactttagt 720
tctgaagctg acatgatcag gaaatttcgt gctggcctag ctttgcagcc tatagcaaca 780
gctctttttg caaattcacc tttcacagag ggaaagccca atgggtttgt cagtatgaga 840
agtcatattt ggactgatac tgacaaggac cgcacaggca tgctgccttt tgtttttgac 900
gactctttcg ggtttgagca gtacgttgat tatgctcttg atgttccaat gtattttgca 960
tatcggcaaa agaaatatgt cgactgtact ggaatgacct tcagggactt tttggcagga 1020
aggcttccta gtattcctgg tgaattaccg actcttaatg attgggagaa tcatttaacc 1080
actatatttc ccgaggtcag gctaaagagg tatttggaga tgagaggggc tgacggaggg 1140
ccttggagaa ggttgtgtgc tttaccagca ttttgggtag gtttattgta cgatgaggtt 1200
tctttgcagc gtgttttgga tttgacagca gattggactt tagaagaaag agaaatgcta 1260
aggaataagg tcactgtaac cggtctaagg acaccatttc gagatggttt gctgaagcat 1320
gtcgctgaag aggttctaaa gttggcaaag gatggcttgg aaagaagagg ctttaaggaa 1380
tcaggatttt taaatgcggt agctgaggtg gttagaacag gtgtaactcc agctgagagg 1440
cttttggaat tgtatcatgg aaagtgggag caatctgtag atcatgtatt tgaagaattg 1500
ctttattaa 1509
<210> 2
<211> 502
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Met Ala Thr Ile Phe Arg Val Ala Ser Ser Ser Ala Ala Pro Pro Pro
1 5 10 15
Pro His Asn Phe Arg Leu Arg Lys Thr Thr Ser Ile Pro Asn Ser Phe
20 25 30
Ser Phe Ser Ser Ile Cys Ser Asp Arg Arg Val Val Ser Ser Ala Gly
35 40 45
Arg Arg Leu Ile Val Ala Ala Ser Pro Pro Thr Glu Asp Ala Val Val
50 55 60
Ala Thr Glu Pro Leu Thr Arg Gln Asp Leu Ile Asp Tyr Leu Ala Ser
65 70 75 80
Gly Cys Lys Pro Lys Asp Lys Trp Arg Ile Gly Thr Glu His Glu Lys
85 90 95
Phe Gly Phe Glu Leu Gly Ser Leu Arg Pro Val Lys Tyr Glu Gln Ile
100 105 110
Ala Glu Leu Leu Asn Gly Ile Ala Glu Arg Phe Asp Trp Glu Lys Ile
115 120 125
Met Glu Gly Asp Tyr Ile Ile Gly Leu Lys Gln Gly Lys Gln Ser Ile
130 135 140
Ser Leu Glu Pro Gly Gly Gln Phe Glu Leu Ser Gly Ala Pro Leu Glu
145 150 155 160
Thr Leu His Gln Thr Cys Ala Glu Val Asn Ser His Leu Tyr Gln Val
165 170 175
Lys Ala Val Thr Glu Glu Met Gly Ile Gly Phe Leu Gly Ile Gly Phe
180 185 190
Gln Pro Lys Trp Glu Arg Lys Asp Ile Pro Met Met Pro Lys Gly Arg
195 200 205
Tyr Glu Ile Met Lys Arg Tyr Met Pro Lys Val Gly Ser Leu Gly Leu
210 215 220
Asp Met Met Phe Arg Thr Cys Thr Val Gln Val Asn Leu Asp Phe Ser
225 230 235 240
Ser Glu Ala Asp Met Ile Arg Lys Phe Arg Ala Gly Leu Ala Leu Gln
245 250 255
Pro Ile Ala Thr Ala Leu Phe Ala Asn Ser Pro Phe Thr Glu Gly Lys
260 265 270
Pro Asn Gly Phe Val Ser Met Arg Ser His Ile Trp Thr Asp Thr Asp
275 280 285
Lys Asp Arg Thr Gly Met Leu Pro Phe Val Phe Asp Asp Ser Phe Gly
290 295 300
Phe Glu Gln Tyr Val Asp Tyr Ala Leu Asp Val Pro Met Tyr Phe Ala
305 310 315 320
Tyr Arg Gln Lys Lys Tyr Val Asp Cys Thr Gly Met Thr Phe Arg Asp
325 330 335
Phe Leu Ala Gly Arg Leu Pro Ser Ile Pro Gly Glu Leu Pro Thr Leu
340 345 350
Asn Asp Trp Glu Asn His Leu Thr Thr Ile Phe Pro Glu Val Arg Leu
355 360 365
Lys Arg Tyr Leu Glu Met Arg Gly Ala Asp Gly Gly Pro Trp Arg Arg
370 375 380
Leu Cys Ala Leu Pro Ala Phe Trp Val Gly Leu Leu Tyr Asp Glu Val
385 390 395 400
Ser Leu Gln Arg Val Leu Asp Leu Thr Ala Asp Trp Thr Leu Glu Glu
405 410 415
Arg Glu Met Leu Arg Asn Lys Val Thr Val Thr Gly Leu Arg Thr Pro
420 425 430
Phe Arg Asp Gly Leu Leu Lys His Val Ala Glu Glu Val Leu Lys Leu
435 440 445
Ala Lys Asp Gly Leu Glu Arg Arg Gly Phe Lys Glu Ser Gly Phe Leu
450 455 460
Asn Ala Val Ala Glu Val Val Arg Thr Gly Val Thr Pro Ala Glu Arg
465 470 475 480
Leu Leu Glu Leu Tyr His Gly Lys Trp Glu Gln Ser Val Asp His Val
485 490 495
Phe Glu Glu Leu Leu Tyr
500
<210> 3
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atggctacta tcttccgagt ggcg 24
<210> 4
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ttaataaagc aattcttcaa atacatg 27
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
<210> 6
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
agtccaatct gctgtcaaat cc 22
<210> 7
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gagatgagcg tttcagatgt cc 22
<210> 8
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gttaccatac aagtctttcc tgat 24
Claims (8)
1. An arrow pea glutamylcysteine synthetase gene is characterized in that the nucleotide sequence of the gene is shown as SEQ ID No. 1; or the gene codes an amino acid sequence shown as SEQ ID No. 2.
2. An Arundina angustifolia glutamylcysteine synthetase, wherein the amino acid sequence of the Arundina angustifolia glutamylcysteine synthetase is shown in SEQ ID No. 2.
3. An overexpression vector into which the arrowed pea glutamylcysteine synthetase gene according to claim 1 is inserted.
4. The overexpression vector according to claim 3, wherein the overexpression vector is pCAMBIA1304-Vs γ -ECS.
5. Use of the arrow pea glutamylcysteine synthetase gene according to claim 1, or the arrow pea glutamylcysteine synthetase according to claim 2, or the overexpression vector according to claim 3 or 4 for increasing the cadmium tolerance of a plant, which is arabidopsis thaliana.
6. Use of the arrow pea glutamylcysteine synthetase gene according to claim 1, or the arrow pea glutamylcysteine synthetase according to claim 2, or the overexpression vector according to claim 3 or 4 for genetic breeding to improve the tolerance of a plant to cadmium, said plant being arabidopsis thaliana.
7. A biological agent for improving cadmium tolerance of a plant, wherein an active ingredient of the biological agent is derived from the overexpression vector of claim 3 or 4, and the plant is Arabidopsis thaliana.
8. A method of increasing cadmium tolerance in a plant, said plant comprising arabidopsis thaliana, comprising increasing expression of the agate vetch glutamylcysteine synthetase gene of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110768333.9A CN113481222B (en) | 2021-07-07 | 2021-07-07 | Application of arrowed pea glutamylcysteine synthetase gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110768333.9A CN113481222B (en) | 2021-07-07 | 2021-07-07 | Application of arrowed pea glutamylcysteine synthetase gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113481222A CN113481222A (en) | 2021-10-08 |
| CN113481222B true CN113481222B (en) | 2023-03-28 |
Family
ID=77940877
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110768333.9A Active CN113481222B (en) | 2021-07-07 | 2021-07-07 | Application of arrowed pea glutamylcysteine synthetase gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113481222B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2005073638A (en) * | 2003-09-02 | 2005-03-24 | Ajinomoto Co Inc | Glutathione synthetase-coding gene of candida utilis |
| CN112626091A (en) * | 2020-11-10 | 2021-04-09 | 华南农业大学 | Application of onion gamma-glutamylcysteine ligase AcGCL gene in improving heavy metal resistance of plants |
-
2021
- 2021-07-07 CN CN202110768333.9A patent/CN113481222B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN113481222A (en) | 2021-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109456982B (en) | Application of rice OsMYB6 gene and encoding protein thereof in drought resistance and salt resistance | |
| CN107188940B (en) | Application of GsA 12 protein and coding gene thereof in regulation and control of plant stress tolerance | |
| CN109232725B (en) | Soybean C2H2 type single zinc finger protein transcription factor, coding gene and application | |
| CN111675755B (en) | Bermuda grass transcription factor CdWRKY50 for regulating and controlling plant salt tolerance and application thereof | |
| CN112779234B (en) | Phyllostachys pubescens PeAPX5 gene and application thereof | |
| CN114752579B (en) | ZmMAPK protein and application of coding gene thereof in regulation and control of low-temperature stress tolerance of plants | |
| CN109880829B (en) | Barley HvPAA1 gene and application thereof | |
| CN111763251A (en) | Trifolium repens transcription factor TrNAC and coding sequence and application thereof | |
| CN113621625B (en) | Application of sesame SiERF103 gene in enhancing plant resistance | |
| CN109355295B (en) | Peanut AhWRKY75 gene and application thereof in improving peanut salt tolerance | |
| CN113088526B (en) | Heat shock related gene ZmHsf11 and application thereof in regulation and control of plant heat resistance | |
| CN108866081B (en) | Gene for improving cadmium resistance and cadmium content and application thereof | |
| CN110713994B (en) | Plant stress tolerance associated protein TaMAPK3, and coding gene and application thereof | |
| CN108276481B (en) | Upland cotton GhLEA3 gene and application thereof in low-temperature stress resistance | |
| CN104328127A (en) | Tumorous stem mustard stress resistance gene BjEFh1 as well as plant expression vector and application thereof | |
| CN113481222B (en) | Application of arrowed pea glutamylcysteine synthetase gene | |
| CN102449154A (en) | Methods and compositions for stress tolerance in plants | |
| CN112877326B (en) | Application of aluminum ion receptor ALR1 gene or protein for regulating and controlling aluminum resistance of plants | |
| CN108948162B (en) | Peanut adversity stress gene AhDOG1L and application thereof | |
| CN108148843A (en) | Chinese milk vetch LEAFY genes and its application | |
| CN114525298B (en) | Application of soybean protein GmFVE in regulation and control of salt tolerance of plants | |
| CN115322977A (en) | Application of laugh LacOMT and coding gene thereof in improving mercury stress tolerance of plants | |
| CN114540381A (en) | Apple histone deacetylase MdHDA6 gene and application thereof | |
| CN109880845B (en) | Method for improving plant nodulation nitrogen fixation efficiency | |
| CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20230309 Address after: No.10, shiliugang Road, Haizhu District, Guangzhou City, Guangdong Province 510000 Applicant after: Nanfan Seed Industry Research Institute Guangdong Academy of Sciences Address before: No.10, shiliugang Road, Haizhu District, Guangzhou City, Guangdong Province 510000 Applicant before: Institute of bioengineering, Guangdong Academy of Sciences |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |